blastn task: aaa

Status
finished finished
Modified 2013-11-19T13:02:24Z
CPU time (s) 0.1
Size (bytes) 78810
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_lactis_Y-1140.fna -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces lactis NRRL Y-1140
           7 sequences; 10,729,447 total letters



Query= query

Length=1268
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  2287    0.0  
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  60.8    7e-09
  gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 c...  60.8    7e-09
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  57.2    8e-08
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  57.2    8e-08
  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  57.2    8e-08


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 2287 bits (2536),  Expect = 0.0
 Identities = 1268/1268 (100%), Gaps = 0/1268 (0%)
 Strand=Plus/Plus

Query  1       GAATATATGATGGGTGCGGAATCACGATCGGTATTTGTGTGATGCAATTTCTGGGGTGGT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611456  GAATATATGATGGGTGCGGAATCACGATCGGTATTTGTGTGATGCAATTTCTGGGGTGGT  611515

Query  61      AAGGACCAGTGCCACACTTGGGTTTGATTTTCCTCTCATCGAGTTTCGTGTGCGCATGTT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611516  AAGGACCAGTGCCACACTTGGGTTTGATTTTCCTCTCATCGAGTTTCGTGTGCGCATGTT  611575

Query  121     CGTCTCTCACATCGAGTTATACTCTCATCTTCTATACATTAGAAGGATGCATCAGCAGTT  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611576  CGTCTCTCACATCGAGTTATACTCTCATCTTCTATACATTAGAAGGATGCATCAGCAGTT  611635

Query  181     TGATCTGCTGAAAGAGTTCATACACCCAATTATTGTTTAAAGGCCTGGTGTTGGGTAGTA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611636  TGATCTGCTGAAAGAGTTCATACACCCAATTATTGTTTAAAGGCCTGGTGTTGGGTAGTA  611695

Query  241     TTTCTAACGGATTTTAGAAATGCTATGACAACAATACCTTTAGAATTATATTGTGTGGAT  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611696  TTTCTAACGGATTTTAGAAATGCTATGACAACAATACCTTTAGAATTATATTGTGTGGAT  611755

Query  301     ATTTACTTCTTGTTAAACAGACTGTGACATATCTCAATGAGAGGGGATTATTCTCGTTTT  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611756  ATTTACTTCTTGTTAAACAGACTGTGACATATCTCAATGAGAGGGGATTATTCTCGTTTT  611815

Query  361     TGGAGTTATTCTGATGCCTGTTGCTCTTGCTCCTACGCATAGAAGCATAGCATTGAACTC  420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611816  TGGAGTTATTCTGATGCCTGTTGCTCTTGCTCCTACGCATAGAAGCATAGCATTGAACTC  611875

Query  421     CATGGTGTGGTACTTCAAATCCGTACACCACATACCTAATCAAAACCGCCTCGCAACGGC  480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611876  CATGGTGTGGTACTTCAAATCCGTACACCACATACCTAATCAAAACCGCCTCGCAACGGC  611935

Query  481     TTCCATATTCTCGTCTGTATTCAATCGTGGATAGTGGTTTCAGCTCGACGTGGGTATGCT  540
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611936  TTCCATATTCTCGTCTGTATTCAATCGTGGATAGTGGTTTCAGCTCGACGTGGGTATGCT  611995

Query  541     AGTGACTCAGAGTTTGGATGTACTAGGTTTCATAAGGATACCCAACTGGAAATGTTGCGG  600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611996  AGTGACTCAGAGTTTGGATGTACTAGGTTTCATAAGGATACCCAACTGGAAATGTTGCGG  612055

Query  601     AAATATCACATTCGTCCTTGCTCCATTGTTAACTCAGTGTCACTTTAGGTCCTATGGGAA  660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612056  AAATATCACATTCGTCCTTGCTCCATTGTTAACTCAGTGTCACTTTAGGTCCTATGGGAA  612115

Query  661     ACAATGTTGAGCTGATGCATTTTTCCGTCAAGCCATTACCGTTCTTCGGGATGGCAAGGA  720
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612116  ACAATGTTGAGCTGATGCATTTTTCCGTCAAGCCATTACCGTTCTTCGGGATGGCAAGGA  612175

Query  721     TTAGCCCTTCCTATTACAGGCTTTATAATGGAAAACTCTTAAGATATATTTCTAGGTTTT  780
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612176  TTAGCCCTTCCTATTACAGGCTTTATAATGGAAAACTCTTAAGATATATTTCTAGGTTTT  612235

Query  781     TTTCCATGACAGAGAATTAAGCCTGTGGTTCATGTTGATATTCCAGAATACGCAACAATT  840
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612236  TTTCCATGACAGAGAATTAAGCCTGTGGTTCATGTTGATATTCCAGAATACGCAACAATT  612295

Query  841     GCTGCGTATTCGGTAGGTTTCTTTTTAGTGATTTTTCCAAACCCATTCTTCTCTTCGTTA  900
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612296  GCTGCGTATTCGGTAGGTTTCTTTTTAGTGATTTTTCCAAACCCATTCTTCTCTTCGTTA  612355

Query  901     GTATATTTGACTCGGTTCTATTTCAATGTGTCGCATTGAAATAGAAATCCTTTGTGCATA  960
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612356  GTATATTTGACTCGGTTCTATTTCAATGTGTCGCATTGAAATAGAAATCCTTTGTGCATA  612415

Query  961     AAATCATTTACCTCAACTTTCCTCACCAAGTATCTTTGAATGATTTTGCTCCCATCAAGA  1020
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612416  AAATCATTTACCTCAACTTTCCTCACCAAGTATCTTTGAATGATTTTGCTCCCATCAAGA  612475

Query  1021    AAGAAAGAACTTCTACTACAACGAGTCAATATGCTAGCATGGTGGAGGTACAGTTGTCCT  1080
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612476  AAGAAAGAACTTCTACTACAACGAGTCAATATGCTAGCATGGTGGAGGTACAGTTGTCCT  612535

Query  1081    ATGGTGGATCTTGAAAAGACCCTCGGAAGACAGGGCCACATCGACGATCAATATTTTGCC  1140
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612536  ATGGTGGATCTTGAAAAGACCCTCGGAAGACAGGGCCACATCGACGATCAATATTTTGCC  612595

Query  1141    TATCATCAACAAATTGTGACTGATTTTTCTCTCATCGTTTATGAGAGAACCCTCTTGTCT  1200
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612596  TATCATCAACAAATTGTGACTGATTTTTCTCTCATCGTTTATGAGAGAACCCTCTTGTCT  612655

Query  1201    CTTGTGATTGACGCTTATATGTCACCATGGCATGCAGCTGCTCCTTATAACCACTTTTTG  1260
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  612656  CTTGTGATTGACGCTTATATGTCACCATGGCATGCAGCTGCTCCTTATAACCACTTTTTG  612715

Query  1261    GTACATCT  1268
               ||||||||
Sbjct  612716  GTACATCT  612723


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  20   TCAAATCCGTACACCACATACCTAATCAAATCCG  53


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  45   TCAAATCCGTACACCACATACCTAATCAAATCCG  78


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  70   TCAAATCCGTACACCACATACCTAATCAAATCCG  103


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  95   TCAAATCCGTACACCACATACCTAATCAAATCCG  128


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  120  TCAAATCCGTACACCACATACCTAATCAAATCCG  153


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  145  TCAAATCCGTACACCACATACCTAATCAAATCCG  178


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  170  TCAAATCCGTACACCACATACCTAATCAAATCCG  203


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  195  TCAAATCCGTACACCACATACCTAATCAAATCCG  228


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  220  TCAAATCCGTACACCACATACCTAATCAAATCCG  253


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  245  TCAAATCCGTACACCACATACCTAATCAAATCCG  278


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  270  TCAAATCCGTACACCACATACCTAATCAAATCCG  303


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  295  TCAAATCCGTACACCACATACCTAATCAAATCCG  328


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  320  TCAAATCCGTACACCACATACCTAATCAAATCCG  353


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  345  TCAAATCCGTACACCACATACCTAATCAAATCCG  378


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  370  TCAAATCCGTACACCACATACCTAATCAAATCCG  403


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  395  TCAAATCCGTACACCACATACCTAATCAAATCCG  428


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  420  TCAAATCCGTACACCACATACCTAATCAAATCCG  453


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  445  TCAAATCCGTACACCACATACCTAATCAAATCCG  478


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  470  TCAAATCCGTACACCACATACCTAATCAAATCCG  503


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  495  TCAAATCCGTACACCACATACCTAATCAAATCCG  528


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  520  TCAAATCCGTACACCACATACCTAATCAAATCCG  553


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  545  TCAAATCCGTACACCACATACCTAATCAAATCCG  578


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  570  TCAAATCCGTACACCACATACCTAATCAAATCCG  603


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  595  TCAAATCCGTACACCACATACCTAATCAAATCCG  628


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 31/31 (100%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAA  465
            |||||||||||||||||||||||||||||||
Sbjct  620  TCAAATCCGTACACCACATACCTAATCAAAA  650


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320331  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320298


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320356  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320323


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320381  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320348


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320406  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320373


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320431  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320398


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320456  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320423


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320481  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320448


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320506  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320473


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320531  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320498


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320556  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320523


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320581  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320548


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320606  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320573


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320631  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320598


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320656  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320623


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320681  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320648


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320706  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320673


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320731  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320698


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320756  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320723


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320781  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320748


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320806  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320773


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1320831  TCAAATCCGTACACCACATACCTAATCAAATCCG  1320798


 Score = 53.6 bits (58),  Expect = 1e-06
 Identities = 29/29 (100%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  437  AAATCCGTACACCACATACCTAATCAAAA  465
            |||||||||||||||||||||||||||||
Sbjct  648  AAATCCGTACACCACATACCTAATCAAAA  676


 Score = 46.4 bits (50),  Expect = 1e-04
 Identities = 27/28 (97%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  441  CCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||| |||
Sbjct  1    CCGTACACCACATACCTAATCAAATCCG  28


 Score = 42.8 bits (46),  Expect = 0.002
 Identities = 28/31 (91%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  916     TTCTATTTCAATGTGTCGCATTGAAATAGAA  946
               ||||||||||||| | | |||||||||||||
Sbjct  612401  TTCTATTTCAATGCGACACATTGAAATAGAA  612371


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 60.8 bits (66),  Expect = 7e-09
 Identities = 33/33 (100%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACC  467
            |||||||||||||||||||||||||||||||||
Sbjct  326  TCAAATCCGTACACCACATACCTAATCAAAACC  358


 Score = 59.0 bits (64),  Expect = 2e-08
 Identities = 32/32 (100%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAAC  466
                ||||||||||||||||||||||||||||||||
Sbjct  1715243  TCAAATCCGTACACCACATACCTAATCAAAAC  1715212


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  1    TCAAATCCGTACACCACATACCTAATCAAATCCG  34


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  26   TCAAATCCGTACACCACATACCTAATCAAATCCG  59


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  51   TCAAATCCGTACACCACATACCTAATCAAATCCG  84


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  76   TCAAATCCGTACACCACATACCTAATCAAATCCG  109


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  101  TCAAATCCGTACACCACATACCTAATCAAATCCG  134


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  126  TCAAATCCGTACACCACATACCTAATCAAATCCG  159


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  151  TCAAATCCGTACACCACATACCTAATCAAATCCG  184


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  176  TCAAATCCGTACACCACATACCTAATCAAATCCG  209


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  201  TCAAATCCGTACACCACATACCTAATCAAATCCG  234


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  226  TCAAATCCGTACACCACATACCTAATCAAATCCG  259


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  251  TCAAATCCGTACACCACATACCTAATCAAATCCG  284


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  276  TCAAATCCGTACACCACATACCTAATCAAATCCG  309


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  301  TCAAATCCGTACACCACATACCTAATCAAATCCG  334


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  382  TCAAATCCGTACACCACATACCTAATCAAATCCG  415


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  407  TCAAATCCGTACACCACATACCTAATCAAATCCG  440


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  432  TCAAATCCGTACACCACATACCTAATCAAATCCG  465


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  457  TCAAATCCGTACACCACATACCTAATCAAATCCG  490


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  482  TCAAATCCGTACACCACATACCTAATCAAATCCG  515


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  507  TCAAATCCGTACACCACATACCTAATCAAATCCG  540


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  532  TCAAATCCGTACACCACATACCTAATCAAATCCG  565


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1714963  TCAAATCCGTACACCACATACCTAATCAAATCCG  1714930


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1714988  TCAAATCCGTACACCACATACCTAATCAAATCCG  1714955


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715013  TCAAATCCGTACACCACATACCTAATCAAATCCG  1714980


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715038  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715005


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715063  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715030


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715088  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715055


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715113  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715080


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715138  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715105


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715163  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715130


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715188  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715155


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715268  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715235


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715293  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715260


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715318  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715285


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715343  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715310


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715368  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715335


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715393  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715360


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715418  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715385


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715443  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715410


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715468  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715435


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1715493  TCAAATCCGTACACCACATACCTAATCAAATCCG  1715460


 Score = 55.4 bits (60),  Expect = 3e-07
 Identities = 32/33 (97%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  436  CAAATCCGTACACCACATACCTAATCAAAACCG  468
            ||||||||||||||||||||||||||||| |||
Sbjct  358  CAAATCCGTACACCACATACCTAATCAAATCCG  390


 Score = 55.4 bits (60),  Expect = 3e-07
 Identities = 32/33 (97%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  436      CAAATCCGTACACCACATACCTAATCAAAACCG  468
                ||||||||||||||||||||||||||||| |||
Sbjct  1715212  CAAATCCGTACACCACATACCTAATCAAATCCG  1715180


 Score = 33.7 bits (36),  Expect = 0.92
 Identities = 26/30 (87%), Gaps = 1/30 (3%)
 Strand=Plus/Minus

Query  879      AAACCCATTCTTCTCTTCGTTAGTATATTT  908
                |||||||||||| |||| | ||||| ||||
Sbjct  1186257  AAACCCATTCTTTTCTTGGGTAGTA-ATTT  1186229


 Score = 31.9 bits (34),  Expect = 3.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  936      TTGAAATAGAAATCCTTTGT  955
                |||||||||||||||| |||
Sbjct  1091940  TTGAAATAGAAATCCTCTGT  1091959


 Score = 31.9 bits (34),  Expect = 3.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  45       CAATTTCTGGGGTGGTA  61
                |||||||||||||||||
Sbjct  1627000  CAATTTCTGGGGTGGTA  1627016


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 60.8 bits (66),  Expect = 7e-09
 Identities = 33/33 (100%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACC  467
            |||||||||||||||||||||||||||||||||
Sbjct  385  TCAAATCCGTACACCACATACCTAATCAAAACC  417


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  35   TCAAATCCGTACACCACATACCTAATCAAATCCG  68


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  60   TCAAATCCGTACACCACATACCTAATCAAATCCG  93


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  85   TCAAATCCGTACACCACATACCTAATCAAATCCG  118


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  110  TCAAATCCGTACACCACATACCTAATCAAATCCG  143


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  135  TCAAATCCGTACACCACATACCTAATCAAATCCG  168


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  160  TCAAATCCGTACACCACATACCTAATCAAATCCG  193


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  185  TCAAATCCGTACACCACATACCTAATCAAATCCG  218


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  210  TCAAATCCGTACACCACATACCTAATCAAATCCG  243


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  235  TCAAATCCGTACACCACATACCTAATCAAATCCG  268


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  260  TCAAATCCGTACACCACATACCTAATCAAATCCG  293


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  285  TCAAATCCGTACACCACATACCTAATCAAATCCG  318


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  310  TCAAATCCGTACACCACATACCTAATCAAATCCG  343


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  335  TCAAATCCGTACACCACATACCTAATCAAATCCG  368


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  360  TCAAATCCGTACACCACATACCTAATCAAATCCG  393


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  441  TCAAATCCGTACACCACATACCTAATCAAATCCG  474


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  466  TCAAATCCGTACACCACATACCTAATCAAATCCG  499


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  491  TCAAATCCGTACACCACATACCTAATCAAATCCG  524


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  516  TCAAATCCGTACACCACATACCTAATCAAATCCG  549


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  541  TCAAATCCGTACACCACATACCTAATCAAATCCG  574


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  566  TCAAATCCGTACACCACATACCTAATCAAATCCG  599


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  591  TCAAATCCGTACACCACATACCTAATCAAATCCG  624


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062150  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062117


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062175  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062142


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062200  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062167


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062225  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062192


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062250  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062217


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062275  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062242


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062300  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062267


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062325  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062292


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062350  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062317


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062375  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062342


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062400  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062367


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062425  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062392


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062450  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062417


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062475  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062442


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062500  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062467


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062525  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062492


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1062550  TCAAATCCGTACACCACATACCTAATCAAATCCG  1062517


 Score = 55.4 bits (60),  Expect = 3e-07
 Identities = 32/33 (97%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  436  CAAATCCGTACACCACATACCTAATCAAAACCG  468
            ||||||||||||||||||||||||||||| |||
Sbjct  417  CAAATCCGTACACCACATACCTAATCAAATCCG  449


 Score = 55.4 bits (60),  Expect = 3e-07
 Identities = 33/35 (95%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  434      TTCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||| |||||||||||||||||||||| |||
Sbjct  1062576  TTCAAATCTGTACACCACATACCTAATCAAATCCG  1062542


 Score = 35.6 bits (38),  Expect = 0.26
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  447  ACCACATACCTAATCAAAACCG  468
            |||||||||||||||||| |||
Sbjct  22   ACCACATACCTAATCAAATCCG  43


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  16   TCAAATCCGTACACCACATACCTAATCAAATCCG  49


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  41   TCAAATCCGTACACCACATACCTAATCAAATCCG  74


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  66   TCAAATCCGTACACCACATACCTAATCAAATCCG  99


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  91   TCAAATCCGTACACCACATACCTAATCAAATCCG  124


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  116  TCAAATCCGTACACCACATACCTAATCAAATCCG  149


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  141  TCAAATCCGTACACCACATACCTAATCAAATCCG  174


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  166  TCAAATCCGTACACCACATACCTAATCAAATCCG  199


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  191  TCAAATCCGTACACCACATACCTAATCAAATCCG  224


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  216  TCAAATCCGTACACCACATACCTAATCAAATCCG  249


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  241  TCAAATCCGTACACCACATACCTAATCAAATCCG  274


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  266  TCAAATCCGTACACCACATACCTAATCAAATCCG  299


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601503  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601470


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601528  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601495


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601553  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601520


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601578  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601545


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601603  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601570


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601628  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601595


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601653  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601620


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601678  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601645


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601703  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601670


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601728  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601695


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601753  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601720


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601778  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601745


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601803  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601770


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601828  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601795


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601853  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601820


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601878  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601845


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601903  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601870


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2601928  TCAAATCCGTACACCACATACCTAATCAAATCCG  2601895


 Score = 42.8 bits (46),  Expect = 0.002
 Identities = 25/26 (97%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  443      GTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||| |||
Sbjct  2601945  GTACACCACATACCTAATCAAATCCG  2601920


 Score = 39.2 bits (42),  Expect = 0.022
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  445  ACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||| |||
Sbjct  1    ACACCACATACCTAATCAAATCCG  24


 Score = 33.7 bits (36),  Expect = 0.92
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  1188     AACCCTCTTGTCTCTTGT  1205
                ||||||||||||||||||
Sbjct  1262006  AACCCTCTTGTCTCTTGT  1262023


 Score = 31.9 bits (34),  Expect = 3.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  440     TCCGTACACCACATACC  456
               |||||||||||||||||
Sbjct  434100  TCCGTACACCACATACC  434084


 Score = 31.9 bits (34),  Expect = 3.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  856      GGTTTCTTTTTAGTGATTTT  875
                |||||||||||||||| |||
Sbjct  2330877  GGTTTCTTTTTAGTGAGTTT  2330896


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  24   TCAAATCCGTACACCACATACCTAATCAAATCCG  57


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  49   TCAAATCCGTACACCACATACCTAATCAAATCCG  82


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  74   TCAAATCCGTACACCACATACCTAATCAAATCCG  107


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  99   TCAAATCCGTACACCACATACCTAATCAAATCCG  132


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  124  TCAAATCCGTACACCACATACCTAATCAAATCCG  157


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  149  TCAAATCCGTACACCACATACCTAATCAAATCCG  182


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  174  TCAAATCCGTACACCACATACCTAATCAAATCCG  207


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  199  TCAAATCCGTACACCACATACCTAATCAAATCCG  232


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  224  TCAAATCCGTACACCACATACCTAATCAAATCCG  257


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  249  TCAAATCCGTACACCACATACCTAATCAAATCCG  282


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  274  TCAAATCCGTACACCACATACCTAATCAAATCCG  307


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  299  TCAAATCCGTACACCACATACCTAATCAAATCCG  332


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  324  TCAAATCCGTACACCACATACCTAATCAAATCCG  357


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  349  TCAAATCCGTACACCACATACCTAATCAAATCCG  382


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  374  TCAAATCCGTACACCACATACCTAATCAAATCCG  407


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  399  TCAAATCCGTACACCACATACCTAATCAAATCCG  432


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  424  TCAAATCCGTACACCACATACCTAATCAAATCCG  457


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  449  TCAAATCCGTACACCACATACCTAATCAAATCCG  482


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  474  TCAAATCCGTACACCACATACCTAATCAAATCCG  507


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233527  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233494


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233552  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233519


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233577  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233544


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233602  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233569


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233627  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233594


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233652  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233619


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233677  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233644


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233702  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233669


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233727  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233694


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233752  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233719


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233777  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233744


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233802  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233769


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 31/31 (100%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAA  465
                |||||||||||||||||||||||||||||||
Sbjct  2233853  TCAAATCCGTACACCACATACCTAATCAAAA  2233823


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233878  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233845


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233903  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233870


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233928  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233895


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233953  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233920


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2233978  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233945


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2234003  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233970


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2234028  TCAAATCCGTACACCACATACCTAATCAAATCCG  2233995


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  2234053  TCAAATCCGTACACCACATACCTAATCAAATCCG  2234020


 Score = 53.6 bits (58),  Expect = 1e-06
 Identities = 31/32 (97%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  437      AAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||| |||
Sbjct  2233825  AAATCCGTACACCACATACCTAATCAAATCCG  2233794


 Score = 46.4 bits (50),  Expect = 1e-04
 Identities = 27/28 (97%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  441      CCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||| |||
Sbjct  2234072  CCGTACACCACATACCTAATCAAATCCG  2234045


 Score = 31.9 bits (34),  Expect = 3.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  379      TGTTGCTCTTGCTCCTA  395
                |||||||||||||||||
Sbjct  1674561  TGTTGCTCTTGCTCCTA  1674545


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  18   TCAAATCCGTACACCACATACCTAATCAAATCCG  51


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  43   TCAAATCCGTACACCACATACCTAATCAAATCCG  76


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  68   TCAAATCCGTACACCACATACCTAATCAAATCCG  101


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  93   TCAAATCCGTACACCACATACCTAATCAAATCCG  126


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  118  TCAAATCCGTACACCACATACCTAATCAAATCCG  151


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  143  TCAAATCCGTACACCACATACCTAATCAAATCCG  176


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  168  TCAAATCCGTACACCACATACCTAATCAAATCCG  201


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  193  TCAAATCCGTACACCACATACCTAATCAAATCCG  226


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  218  TCAAATCCGTACACCACATACCTAATCAAATCCG  251


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  243  TCAAATCCGTACACCACATACCTAATCAAATCCG  276


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  268  TCAAATCCGTACACCACATACCTAATCAAATCCG  301


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  293  TCAAATCCGTACACCACATACCTAATCAAATCCG  326


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  318  TCAAATCCGTACACCACATACCTAATCAAATCCG  351


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  343  TCAAATCCGTACACCACATACCTAATCAAATCCG  376


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  368  TCAAATCCGTACACCACATACCTAATCAAATCCG  401


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  435  TCAAATCCGTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||||||||||| |||
Sbjct  393  TCAAATCCGTACACCACATACCTAATCAAATCCG  426


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753380  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753347


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753405  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753372


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753430  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753397


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753455  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753422


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753480  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753447


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753505  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753472


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753530  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753497


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753555  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753522


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753580  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753547


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753605  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753572


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753630  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753597


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753655  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753622


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753680  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753647


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753705  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753672


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753730  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753697


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753755  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753722


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753780  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753747


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753805  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753772


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753830  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753797


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753855  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753822


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753880  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753847


 Score = 57.2 bits (62),  Expect = 8e-08
 Identities = 33/34 (98%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  435      TCAAATCCGTACACCACATACCTAATCAAAACCG  468
                |||||||||||||||||||||||||||||| |||
Sbjct  1753905  TCAAATCCGTACACCACATACCTAATCAAATCCG  1753872


 Score = 42.8 bits (46),  Expect = 0.002
 Identities = 25/26 (97%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  443  GTACACCACATACCTAATCAAAACCG  468
            |||||||||||||||||||||| |||
Sbjct  1    GTACACCACATACCTAATCAAATCCG  26


 Score = 33.7 bits (36),  Expect = 0.92
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  1010     TCCCATCAAGAAAGAAAGAACTTCTACTACAAC  1042
                ||| | |||||||||||||| || || | ||||
Sbjct  1259069  TCCTAGCAAGAAAGAAAGAAATTTTAATCCAAC  1259037



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 13325747130


  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GAATATATGATGGGTGCGGAATCACGATCGGTATTTGTGTGATGCAATTTCTGGGGTGGTAAGGACCAGTGCCACACTTGGGTTTGATTTTCCTCTCATCGAGTTTCGTGTGCGCATGTTCGTCTCTCACATCGAGTTATACTCTCATCTTCTATACATTAGAAGGATGCATCAGCAGTTTGATCTGCTGAAAGAGTTCATACACCCAATTATTGTTTAAAGGCCTGGTGTTGGGTAGTATTTCTAACGGATTTTAGAAATGCTATGACAACAATACCTTTAGAATTATATTGTGTGGATATTTACTTCTTGTTAAACAGACTGTGACATATCTCAATGAGAGGGGATTATTCTCGTTTTTGGAGTTATTCTGATGCCTGTTGCTCTTGCTCCTACGCATAGAAGCATAGCATTGAACTCCATGGTGTGGTACTTCAAATCCGTACACCACATACCTAATCAAAACCGCCTCGCAACGGCTTCCATATTCTCGTCTGTATTCAATCGTGGATAGTGGTTTCAGCTCGACGTGGGTATGCTAGTGACTCAGAGTTTGGATGTACTAGGTTTCATAAGGATACCCAACTGGAAATGTTGCGGAAATATCACATTCGTCCTTGCTCCATTGTTAACTCAGTGTCACTTTAGGTCCTATGGGAAACAATGTTGAGCTGATGCATTTTTCCGTCAAGCCATTACCGTTCTTCGGGATGGCAAGGATTAGCCCTTCCTATTACAGGCTTTATAATGGAAAACTCTTAAGATATATTTCTAGGTTTTTTTCCATGACAGAGAATTAAGCCTGTGGTTCATGTTGATATTCCAGAATACGCAACAATTGCTGCGTATTCGGTAGGTTTCTTTTTAGTGATTTTTCCAAACCCATTCTTCTCTTCGTTAGTATATTTGACTCGGTTCTATTTCAATGTGTCGCATTGAAATAGAAATCCTTTGTGCATAAAATCATTTACCTCAACTTTCCTCACCAAGTATCTTTGAATGATTTTGCTCCCATCAAGAAAGAAAGAACTTCTACTACAACGAGTCAATATGCTAGCATGGTGGAGGTACAGTTGTCCTATGGTGGATCTTGAAAAGACCCTCGGAAGACAGGGCCACATCGACGATCAATATTTTGCCTATCATCAACAAATTGTGACTGATTTTTCTCTCATCGTTTATGAGAGAACCCTCTTGTCTCTTGTGATTGACGCTTATATGTCACCATGGCATGCAGCTGCTCCTTATAACCACTTTTTGGTACATCT
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)