blastn task: [no title]

Status
finished finished
Modified 2014-03-05T07:51:02Z
CPU time (s) 0.1
Size (bytes) 8816
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_lactis_Y-1140.fna' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces aestuarii ATCC
18862 AEAS00000000_1; Kluyveromyces wickerhamii UCD 54 210
AEAV00000000_1; Kluyveromyces lactis NRRL Y-1140
           854 sequences; 41,189,204 total letters



Query= query

Length=26
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  48.2    6e-07
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  48.2    6e-07
  gsASS001Lm                                                          26.5    2.1  
  AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283,...  26.5    2.1  
  AEAV01000410  Kluyveromyces wickerhamii UCD 54-210 contig00810,...  24.7    7.4  
  AEAV01000200  Kluyveromyces wickerhamii UCD 54-210 contig00208,...  24.7    7.4  
  AEAV01000156  Kluyveromyces wickerhamii UCD 54-210 contig00162,...  24.7    7.4  
  AEAV01000119  Kluyveromyces wickerhamii UCD 54-210 contig00125,...  24.7    7.4  
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  24.7    7.4  
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  24.7    7.4  
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  24.7    7.4  


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 48.2 bits (52),  Expect = 6e-07
 Identities = 26/26 (100%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  1       GTATACGTCTGATTAAGATGGATATA  26
               ||||||||||||||||||||||||||
Sbjct  280813  GTATACGTCTGATTAAGATGGATATA  280838


 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Minus

Query  13       TTAAGATGGATAT  25
                |||||||||||||
Sbjct  1012144  TTAAGATGGATAT  1012132


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 48.2 bits (52),  Expect = 6e-07
 Identities = 26/26 (100%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  1        GTATACGTCTGATTAAGATGGATATA  26
                ||||||||||||||||||||||||||
Sbjct  1279566  GTATACGTCTGATTAAGATGGATATA  1279591


 Score = 28.3 bits (30),  Expect = 0.61
 Identities = 18/20 (90%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  7       GTCTGATTAAGATGGATATA  26
               || ||||||||||| |||||
Sbjct  736363  GTATGATTAAGATGTATATA  736382


 Score = 26.5 bits (28),  Expect = 2.1
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Minus

Query  7       GTCTGATTAAGATG  20
               ||||||||||||||
Sbjct  532749  GTCTGATTAAGATG  532736


 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 16/18 (89%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  8      TCTGATTAAGATGGATAT  25
              ||||||||||| || |||
Sbjct  31489  TCTGATTAAGAAGGTTAT  31506


> gsASS001Lm
Length=10741898

 Score = 26.5 bits (28),  Expect = 2.1
 Identities = 20/24 (84%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  1         GTATACGTCTGATTAAGATGGATA  24
                 |||||  ||  |||||||||||||
Sbjct  10453563  GTATAAATCCCATTAAGATGGATA  10453586


 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 15/16 (94%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  11       GATTAAGATGGATATA  26
                ||| ||||||||||||
Sbjct  5441758  GATAAAGATGGATATA  5441743


> AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283, 
whole genome shotgun sequence
Length=32523

 Score = 26.5 bits (28),  Expect = 2.1
 Identities = 17/19 (90%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  4     TACGTCTGATTAAGATGGA  22
             |||||||||||||  ||||
Sbjct  2289  TACGTCTGATTAATCTGGA  2307


> AEAV01000410  Kluyveromyces wickerhamii UCD 54-210 contig00810, 
whole genome shotgun sequence
Length=49964

 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  8      TCTGATTAAGATG  20
              |||||||||||||
Sbjct  35610  TCTGATTAAGATG  35622


> AEAV01000200  Kluyveromyces wickerhamii UCD 54-210 contig00208, 
whole genome shotgun sequence
Length=27421

 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 16/18 (89%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  1      GTATACGTCTGATTAAGA  18
              |||||  |||||||||||
Sbjct  25969  GTATAGATCTGATTAAGA  25952


> AEAV01000156  Kluyveromyces wickerhamii UCD 54-210 contig00162, 
whole genome shotgun sequence
Length=71611

 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Minus

Query  11     GATTAAGATGGAT  23
              |||||||||||||
Sbjct  21493  GATTAAGATGGAT  21481


> AEAV01000119  Kluyveromyces wickerhamii UCD 54-210 contig00125, 
whole genome shotgun sequence
Length=23374

 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  2      TATACGTCTGATT  14
              |||||||||||||
Sbjct  11479  TATACGTCTGATT  11491


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 15/16 (94%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  10       TGATTAAGATGGATAT  25
                |||| |||||||||||
Sbjct  2308851  TGATGAAGATGGATAT  2308866


 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 15/16 (94%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  11       GATTAAGATGGATATA  26
                |||| |||||||||||
Sbjct  2493014  GATTCAGATGGATATA  2493029


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  11      GATTAAGATGGAT  23
               |||||||||||||
Sbjct  226926  GATTAAGATGGAT  226938


 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  12       ATTAAGATGGATA  24
                |||||||||||||
Sbjct  1410500  ATTAAGATGGATA  1410512


 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  14       TAAGATGGATATA  26
                |||||||||||||
Sbjct  1859919  TAAGATGGATATA  1859931


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 24.7 bits (26),  Expect = 7.4
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  13      TTAAGATGGATAT  25
               |||||||||||||
Sbjct  771126  TTAAGATGGATAT  771138



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 205856350


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
gtatacgtctgattaagatggatata
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)