blastn task: [no title]

Status
finished finished
Modified 2013-12-06T07:58:22Z
CPU time (s) 0.0
Size (bytes) 2182
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_lactis.ffn -num_alignments 250 -evalue 10.0 -task megablast
Error [none]
Output
BLASTN 2.2.25+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: Kluyveromyces lactis
           5,076 sequences; 7,394,976 total letters



Query= query

Length=1038


***** No hits found *****



Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.28    0.460    0.850 

Effective search space used: 7387401420


  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5
Query
>query
ATGTTCAGAAGAAAGCAAAAGGTTGAAGAAAAAGTTGACACTAGCAAATGGGTAAAGATCGAGGTTCCGATCGAATCACCTCCAGACGCAGTGAAACACCCTGAACCAATCGTTTTAGAAGACGAACAATTGAAGAAATATAACACTGTATTTTCACATTTCACTGATACTGATTTACTAATTCCAACTAAAGAGAAAAAAAATCATAGTGACAATGAGATGAAACCATTGACTGATTTGGAAAAAGCTTGGTTGAGTAGAGAATGTTTTATGAGATATTTAAGGGCCACCAAGTGGAATACGCAAGATTGTATCGATAGAATTGTACTCTCTCTTGCTTGGAGAAGAGAATTTGGAATAAGTAGTTTTGGAGAAGAAAATGGTGATTTGCTAACTGCTGACACTGTATCACCGGAGGCTCTGACTGGGAAGGAAGTTGTTTTGGGTTTCGATAACGATTCAAGGCCTATATTGTACTTAAAGCCTGGTAGGCAAAACACAGCAACCTCCCATAGACAAGTCCAGCACCTTGTATATATGCTTGAACGTGTTATTGATTTCATGCCTCCTGGGCAAGATTCATTGGCTTTGTTGATAGATTTCAAAGATTATCCTGATGTTCCAAAGGTTCAAGGTAACTCAAAGATTCCTCCTTTAGGGACCGGTAAAGAGGTTTTACACATTTTACAAACACATTATCCAGAAAGATTAGGGAAAGCATTATTAACTAATATCCCGTGGCTTGCGTGGACCTTTTTGAAGCTCATCCATCCTTTTATTGATCCGTTGACTCGTGAAAAATTGGTTTTTGATGAACCATTTCCAAATTATGTGCCACCTGATCAACTCGAGACGCTTTATGGTGGTAACCTCGACTTCAAATATAATCATGAAGCCTATTGGCCTGTCCTAACTCAAATTGCAGAGAAGAAGAGAAAGCATTATCTACAAAGATTTGAGAAGTTCGGAAAAAAAGTTGGACTGAGTGAATATGATTTAAGAGGTGACCACGATGAGTTGAAATTCCCAATCAACTAA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)