blastn task: [no title]

Status
finished finished
Modified 2016-05-16T13:29:34Z
CPU time (s) 0.0
Size (bytes) 12409
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
           510 sequences; 9,807,744 total letters



Query= query

Length=922
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAV01000084  Kluyveromyces wickerhamii UCD 54-210 contig00088,...   196    8e-50
  AEAV01000087  Kluyveromyces wickerhamii UCD 54-210 contig00091,...  33.7    0.61 
  AEAV01000232  Kluyveromyces wickerhamii UCD 54-210 contig00243,...  31.9    2.1  
  AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213,...  31.9    2.1  
  AEAV01000204  Kluyveromyces wickerhamii UCD 54-210 contig00212,...  31.9    2.1  
  AEAV01000483  Kluyveromyces wickerhamii UCD 54-210 contig00908,...  30.1    7.4  
  AEAV01000481  Kluyveromyces wickerhamii UCD 54-210 contig00906,...  30.1    7.4  
  AEAV01000479  Kluyveromyces wickerhamii UCD 54-210 contig00903,...  30.1    7.4  
  AEAV01000442  Kluyveromyces wickerhamii UCD 54-210 contig00846,...  30.1    7.4  
  AEAV01000248  Kluyveromyces wickerhamii UCD 54-210 contig00259,...  30.1    7.4  
  AEAV01000199  Kluyveromyces wickerhamii UCD 54-210 contig00207,...  30.1    7.4  
  AEAV01000193  Kluyveromyces wickerhamii UCD 54-210 contig00201,...  30.1    7.4  
  AEAV01000102  Kluyveromyces wickerhamii UCD 54-210 contig00106,...  30.1    7.4  
  AEAV01000101  Kluyveromyces wickerhamii UCD 54-210 contig00105,...  30.1    7.4  
  AEAV01000086  Kluyveromyces wickerhamii UCD 54-210 contig00090,...  30.1    7.4  
  AEAV01000071  Kluyveromyces wickerhamii UCD 54-210 contig00075,...  30.1    7.4  
  AEAV01000024  Kluyveromyces wickerhamii UCD 54-210 contig00025,...  30.1    7.4  


> AEAV01000084  Kluyveromyces wickerhamii UCD 54-210 contig00088, 
whole genome shotgun sequence
Length=61206

 Score =  196 bits (216),  Expect = 8e-50
 Identities = 463/691 (68%), Gaps = 19/691 (2%)
 Strand=Plus/Plus

Query  13     CAAGTAATTGACTTTAACAAGGTCTCCGACTTTCAACTT-CAACCGATCCCATTTTCAAA  71
              |||||  |||| || || |||  | | || | |||| || || | ||| || ||||||| 
Sbjct  24244  CAAGTGCTTGATTTCAATAAGAGCCCGGA-TATCAAGTTACAGCTGATTCCCTTTTCAAG  24302

Query  72     AAATATTTCTAGAACCGATTTCAACCAATGGTTGAAGGACCAGGAACGAGTTTCGTTTGA  131
              ||| ||  ||||||  || ||  || ||||| | | ||| ||||| |   | ||  | ||
Sbjct  24303  AAACATCACTAGAAATGACTTTGACAAATGGATAACGGAGCAGGAGCAGATCTCTGTCGA  24362

Query  132    ACGTATGTTCGATAATATTTGCAACGAAGAATCGTCAGGAAAATTCGACAACTGTTTCCC  191
                 ||| |||   ||||| ||  ||    ||| |   ||| | | || | ||        
Sbjct  24363  GAATATCTTCAGCAATATATGTGACTCTAAATTGCATGGAGATTGCGTCGAC--------  24414

Query  192    CGGTGTAGTTTTCGCATCTCCATCCAAGAGTAAA-CCGGATTACTTTTACCATTGGATTA  250
               ||||| || || || || || || ||||||| | ||||| ||||  ||||| ||||| |
Sbjct  24415  -GGTGTCGTATTTGCCTCGCCGTC-AAGAGTAGAGCCGGACTACTACTACCACTGGATCA  24472

Query  251    GAGATGGCGCCATTACCATTAACACTTTGATCAACACATATTCGGAGGTCGACA--AAGA  308
              |||| || || ||||| || ||||||||||||||||  | |    |||| |||   || |
Sbjct  24473  GAGACGGAGCTATTACAATCAACACTTTGATCAACAATTTTATTAAGGTGGACTCTAACA  24532

Query  309    ACGCACTTTGAAAACAGTCTTAAACTACGTGAATGCTTCTATCGACTTGCAACATAGGTC  368
              |   ||  |||  ||||| || ||||| || ||||  ||    |||||||| || | |||
Sbjct  24533  AG--ACCGTGAGCACAGTTTTGAACTATGTCAATGTGTCCTCGGACTTGCAGCACAAGTC  24590

Query  369    TAATCCAAGTGGTCCCGTTGATGACCCACTATTGAGAAACTTGGGAGAACCTAAATACCA  428
               || || || |||||   || |||  || | ||||||||||| || || || || |   |
Sbjct  24591  CAACCCGAGCGGTCCGTATGGTGATGCATTTTTGAGAAACTTAGGCGAGCCCAAGTGGTA  24650

Query  429    TGTTGACAATTCGCCATTTGAACAGGTTTGGGGTAGACCACAAAATGATGGACCTCCATT  488
               ||  | || ||  |||| |||  |   ||||| || ||||| || || || ||||||||
Sbjct  24651  CGTCAATAACTCTGCATTCGAAGTGAACTGGGGCAGGCCACAGAACGACGGGCCTCCATT  24710

Query  489    AAGAGCCATTGCCTTGTTGAATTTCTTGAACTCAATG-AATGTGTCCAGCAATAGCGATG  547
               ||||| || ||||||||||| || |||||| ||||| || | |  || |  |   |   
Sbjct  24711  GAGAGCAATGGCCTTGTTGAACTTTTTGAAC-CAATGCAACGAGGACACCGGTGTGGGGT  24769

Query  548    CCAACAGTGATTACCAATGGATCTTTGATGATTTAATTACATTGGACTTGAAGTTTGTCT  607
               | | | ||| |||   |||||||| || ||  | || |   | || ||| ||||| |||
Sbjct  24770  ACGAGACTGAATACAGCTGGATCTTCGACGAGGTTATCAAGCTAGATTTGCAGTTTATCT  24829

Query  608    TGTACAACTGGCACGTCTCAAGCTTCGATTTGTGGGAAGAAGTTGATGCGTACCATTTCT  667
              |||  || |||   | | | |  |||||  | |||||||| ||  |  ||| ||||||||
Sbjct  24830  TGTTAAATTGGAGGGCCACGACGTTCGACCTATGGGAAGAGGTCAACTCGTTCCATTTCT  24889

Query  668    TCACGAGTATGGTTCAATTGAAGGCTTTGGT  698
              |||| || ||||| ||| | ||||| |||||
Sbjct  24890  TCACAAGCATGGTACAACTAAAGGCATTGGT  24920


> AEAV01000087  Kluyveromyces wickerhamii UCD 54-210 contig00091, 
whole genome shotgun sequence
Length=75150

 Score = 33.7 bits (36),  Expect = 0.61
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  797    AGGTGGAATCCTTCATCAAGA  817
              || ||||||||||||||||||
Sbjct  20085  AGTTGGAATCCTTCATCAAGA  20105


> AEAV01000232  Kluyveromyces wickerhamii UCD 54-210 contig00243, 
whole genome shotgun sequence
Length=45488

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  158    AAGAATCGTCAGGAAAATTCGA  179
              ||||||||||||| |||| |||
Sbjct  37866  AAGAATCGTCAGGTAAATACGA  37845


> AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213, 
whole genome shotgun sequence
Length=85282

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  402    GAGAAACTTGGGAGAACCTAAA  423
              |||||||||||||||| || ||
Sbjct  59720  GAGAAACTTGGGAGAAGCTGAA  59699


> AEAV01000204  Kluyveromyces wickerhamii UCD 54-210 contig00212, 
whole genome shotgun sequence
Length=80973

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 25/29 (87%), Gaps = 2/29 (6%)
 Strand=Plus/Plus

Query  258    CGCCATTACCATTAACACTTTGATCAACA  286
              |||||||||||| ||| ||||  ||||||
Sbjct  48361  CGCCATTACCATCAACTCTTT--TCAACA  48387


> AEAV01000483  Kluyveromyces wickerhamii UCD 54-210 contig00908, 
whole genome shotgun sequence
Length=31509

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  589   TTGGACTTGAAGTTTGTCTTG  609
             ||||||||||| |||| ||||
Sbjct  3338  TTGGACTTGAATTTTGCCTTG  3318


> AEAV01000481  Kluyveromyces wickerhamii UCD 54-210 contig00906, 
whole genome shotgun sequence
Length=5567

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  729  TTCAAGCGGTATTACATTA  747
            |||||||||||||| ||||
Sbjct  901  TTCAAGCGGTATTAAATTA  919


> AEAV01000479  Kluyveromyces wickerhamii UCD 54-210 contig00903, 
whole genome shotgun sequence
Length=60100

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  30     CAAGGTCTCCGACTTTCAACT  50
              || ||||||||||||| ||||
Sbjct  33248  CATGGTCTCCGACTTTGAACT  33228


> AEAV01000442  Kluyveromyces wickerhamii UCD 54-210 contig00846, 
whole genome shotgun sequence
Length=51441

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  890    CTGGTTTAGATATCGC  905
              ||||||||||||||||
Sbjct  11916  CTGGTTTAGATATCGC  11931


> AEAV01000248  Kluyveromyces wickerhamii UCD 54-210 contig00259, 
whole genome shotgun sequence
Length=22154

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  856   ATTGTGGAGACACCAAGTAAC  876
             ||||| || ||||||||||||
Sbjct  4029  ATTGTTGATACACCAAGTAAC  4009


> AEAV01000199  Kluyveromyces wickerhamii UCD 54-210 contig00207, 
whole genome shotgun sequence
Length=97451

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  136    ATGTTCGATAATATTTGCA  154
              ||||||||||| |||||||
Sbjct  50970  ATGTTCGATAAAATTTGCA  50952


> AEAV01000193  Kluyveromyces wickerhamii UCD 54-210 contig00201, 
whole genome shotgun sequence
Length=75744

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  369    TAATCCAAGTGGTCCC  384
              ||||||||||||||||
Sbjct  30719  TAATCCAAGTGGTCCC  30704


> AEAV01000102  Kluyveromyces wickerhamii UCD 54-210 contig00106, 
whole genome shotgun sequence
Length=54017

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  210    TCCATCCAAGAGTAAA  225
              ||||||||||||||||
Sbjct  49671  TCCATCCAAGAGTAAA  49686


> AEAV01000101  Kluyveromyces wickerhamii UCD 54-210 contig00105, 
whole genome shotgun sequence
Length=23102

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  511    TTCTTGAACTCAATGA  526
              ||||||||||||||||
Sbjct  21717  TTCTTGAACTCAATGA  21732


> AEAV01000086  Kluyveromyces wickerhamii UCD 54-210 contig00090, 
whole genome shotgun sequence
Length=30197

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  8      ATATACAAGTAATTGACTT  26
              ||||||||||||||| |||
Sbjct  22444  ATATACAAGTAATTGCCTT  22462


> AEAV01000071  Kluyveromyces wickerhamii UCD 54-210 contig00075, 
whole genome shotgun sequence
Length=32292

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  709    GCATTCATACTGAAAAAAC  727
              |||| ||||||||||||||
Sbjct  22239  GCATGCATACTGAAAAAAC  22257


> AEAV01000024  Kluyveromyces wickerhamii UCD 54-210 contig00025, 
whole genome shotgun sequence
Length=37508

 Score = 30.1 bits (32),  Expect = 7.4
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  660    CCATTTCTTCACGAGTATG  678
              || ||||||||||||||||
Sbjct  14844  CCTTTTCTTCACGAGTATG  14862



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8775857664


  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GGTCAATATATACAAGTAATTGACTTTAACAAGGTCTCCGACTTTCAACTTCAACCGATCCCATTTTCAAAAAATATTTCTAGAACCGATTTCAACCAATGGTTGAAGGACCAGGAACGAGTTTCGTTTGAACGTATGTTCGATAATATTTGCAACGAAGAATCGTCAGGAAAATTCGACAACTGTTTCCCCGGTGTAGTTTTCGCATCTCCATCCAAGAGTAAACCGGATTACTTTTACCATTGGATTAGAGATGGCGCCATTACCATTAACACTTTGATCAACACATATTCGGAGGTCGACAAAGAACGCACTTTGAAAACAGTCTTAAACTACGTGAATGCTTCTATCGACTTGCAACATAGGTCTAATCCAAGTGGTCCCGTTGATGACCCACTATTGAGAAACTTGGGAGAACCTAAATACCATGTTGACAATTCGCCATTTGAACAGGTTTGGGGTAGACCACAAAATGATGGACCTCCATTAAGAGCCATTGCCTTGTTGAATTTCTTGAACTCAATGAATGTGTCCAGCAATAGCGATGCCAACAGTGATTACCAATGGATCTTTGATGATTTAATTACATTGGACTTGAAGTTTGTCTTGTACAACTGGCACGTCTCAAGCTTCGATTTGTGGGAAGAAGTTGATGCGTACCATTTCTTCACGAGTATGGTTCAATTGAAGGCTTTGGTCGATGGTAGAGCATTCATACTGAAAAAACTTTCAAGCGGTATTACATTAACTAGTGCGGAAGATGATCTCTTGAAAGATCTTGAGGCTGGTATCGATAAGGTGGAATCCTTCATCAAGAGTTCCAGTTCCGGATTTATTAACCATGAAAAGGGCTATATTGTGGAGACACCAAGTAACTTGGACCAAAGGTCTGGTTTAGATATCGCAGTCATTATGGCCAGTA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)