blastn task: ncRNA

Status
finished finished
Modified 2014-05-16T13:58:53Z
CPU time (s) 0.5
Size (bytes) 13936
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna' -num_alignments 250 -evalue 10.0 -task blastn-short
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis;
Kluyveromyces lactis NRRL Y-1140
           20,500 sequences; 70,111,562 total letters



Query= query

Length=345
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000106  Kluyveromyces aestuarii ATCC 18862 contig00111, w...  36.2    0.29 
  KLAEg220 KLAEg220 undefined product 469367:472660 reverse           36.2    0.29 
  AEAS01000004  Kluyveromyces aestuarii ATCC 18862 contig00005, w...  34.2    1.2  
  gsASS001Lm                                                          32.2    4.6  
  AEAV01000510  Kluyveromyces wickerhamii UCD 54-210 contig00953,...  32.2    4.6  
  AEAV01000089  Kluyveromyces wickerhamii UCD 54-210 contig00093,...  32.2    4.6  
  AEAV01000038  Kluyveromyces wickerhamii UCD 54-210 contig00041,...  32.2    4.6  
  KLWIg1644 KLWIg1644 undefined product 3339823:3344172 reverse       32.2    4.6  
  KLWIg1168 KLWIg1168 undefined product 2403802:2407521 reverse       32.2    4.6  
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  32.2    4.6  
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  32.2    4.6  
  AEAS01000004  Kluyveromyces aestuarii ATCC 18862 contig00005, w...  32.2    4.6  
  KLLA0F23419g KLLA0F23419g undefined product 10274345:10276066 r...  32.2    4.6  
  KLLA0F14487g KLLA0F14487g undefined product 9431257:9432165 for...  32.2    4.6  
  KLLA0F02211g KLLA0F02211g undefined product 8285091:8285915 rev...  32.2    4.6  
  AEAS01000328  Kluyveromyces aestuarii ATCC 18862 contig00668, w...  32.2    4.6  
  AEAS01000167  Kluyveromyces aestuarii ATCC 18862 contig00180, w...  32.2    4.6  
  AEAS01000159  Kluyveromyces aestuarii ATCC 18862 contig00170, w...  32.2    4.6  
  AEAS01000111  Kluyveromyces aestuarii ATCC 18862 contig00116, w...  32.2    4.6  
  AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, w...  32.2    4.6  
  AEAS01000098  Kluyveromyces aestuarii ATCC 18862 contig00103, w...  32.2    4.6  
  KLAEg1040 KLAEg1040 undefined product 2258434:2260800 forward       32.2    4.6  


> AEAS01000106  Kluyveromyces aestuarii ATCC 18862 contig00111, 
whole genome shotgun sequence
Length=37058

 Score = 36.2 bits (18),  Expect = 0.29
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  10    AGTGGGGAGTAAAGAATAAAGC  31
             |||||| |||||||||||||||
Sbjct  4538  AGTGGGTAGTAAAGAATAAAGC  4517


> KLAEg220 KLAEg220 undefined product 469367:472660 reverse
Length=3294

 Score = 36.2 bits (18),  Expect = 0.29
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  10    AGTGGGGAGTAAAGAATAAAGC  31
             |||||| |||||||||||||||
Sbjct  1707  AGTGGGTAGTAAAGAATAAAGC  1686


> AEAS01000004  Kluyveromyces aestuarii ATCC 18862 contig00005, 
whole genome shotgun sequence
Length=9249

 Score = 34.2 bits (17),  Expect = 1.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  253   TATATTCTTATATATTA  269
             |||||||||||||||||
Sbjct  2551  TATATTCTTATATATTA  2535


> gsASS001Lm
Length=10741898

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  257      TTCTTATATATTACAGGTGA  276
                ||||||||||||||| ||||
Sbjct  8605517  TTCTTATATATTACAAGTGA  8605498


 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  252       ATATATTCTTATATAT  267
                 ||||||||||||||||
Sbjct  10741502  ATATATTCTTATATAT  10741517


> AEAV01000510  Kluyveromyces wickerhamii UCD 54-210 contig00953, 
whole genome shotgun sequence
Length=21387

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  251    CATATATTCTTATATA  266
              ||||||||||||||||
Sbjct  15235  CATATATTCTTATATA  15220


> AEAV01000089  Kluyveromyces wickerhamii UCD 54-210 contig00093, 
whole genome shotgun sequence
Length=38774

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  235    AAGAAAATCAATAGCT  250
              ||||||||||||||||
Sbjct  15737  AAGAAAATCAATAGCT  15722


> AEAV01000038  Kluyveromyces wickerhamii UCD 54-210 contig00041, 
whole genome shotgun sequence
Length=63282

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  231    GTAGAAGAAAATCAAT  246
              ||||||||||||||||
Sbjct  33006  GTAGAAGAAAATCAAT  32991


> KLWIg1644 KLWIg1644 undefined product 3339823:3344172 reverse
Length=4350

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  231   GTAGAAGAAAATCAAT  246
             ||||||||||||||||
Sbjct  3199  GTAGAAGAAAATCAAT  3214


> KLWIg1168 KLWIg1168 undefined product 2403802:2407521 reverse
Length=3720

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  235   AAGAAAATCAATAGCT  250
             ||||||||||||||||
Sbjct  2349  AAGAAAATCAATAGCT  2364


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  285     TATGATTATGAATGGCTTTT  304
               |||||||||||||| |||||
Sbjct  198330  TATGATTATGAATGTCTTTT  198349


 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  190     CTGAATTTAGTTTTGA  205
               ||||||||||||||||
Sbjct  439953  CTGAATTTAGTTTTGA  439938


 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  290      TTATGAATGGCTTTTC  305
                ||||||||||||||||
Sbjct  1345206  TTATGAATGGCTTTTC  1345191


 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  231      GTAGAAGAAAATCAAT  246
                ||||||||||||||||
Sbjct  2188187  GTAGAAGAAAATCAAT  2188202


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  260      TTATATATTACAGGTG  275
                ||||||||||||||||
Sbjct  2195597  TTATATATTACAGGTG  2195612


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  198      AGTTTTGAAGAGTGAA  213
                ||||||||||||||||
Sbjct  1309543  AGTTTTGAAGAGTGAA  1309558


> KLLA0F23419g KLLA0F23419g undefined product 10274345:10276066 
reverse
Length=1722

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  231  GTAGAAGAAAATCAAT  246
            ||||||||||||||||
Sbjct  921  GTAGAAGAAAATCAAT  906


> KLLA0F14487g KLLA0F14487g undefined product 9431257:9432165 forward
Length=909

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  290  TTATGAATGGCTTTTC  305
            ||||||||||||||||
Sbjct  909  TTATGAATGGCTTTTC  894


> KLLA0F02211g KLLA0F02211g undefined product 8285091:8285915 reverse
Length=825

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  285  TATGATTATGAATGGCTTTT  304
            |||||||||||||| |||||
Sbjct  627  TATGATTATGAATGTCTTTT  608


> AEAS01000328  Kluyveromyces aestuarii ATCC 18862 contig00668, 
whole genome shotgun sequence
Length=8752

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  252   ATATATTCTTATATAT  267
             ||||||||||||||||
Sbjct  6928  ATATATTCTTATATAT  6913


> AEAS01000167  Kluyveromyces aestuarii ATCC 18862 contig00180, 
whole genome shotgun sequence
Length=98644

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  210    TGAAAACAACTAAATC  225
              ||||||||||||||||
Sbjct  13461  TGAAAACAACTAAATC  13476


> AEAS01000159  Kluyveromyces aestuarii ATCC 18862 contig00170, 
whole genome shotgun sequence
Length=111171

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  235    AAGAAAATCAATAGCT  250
              ||||||||||||||||
Sbjct  70658  AAGAAAATCAATAGCT  70673


> AEAS01000111  Kluyveromyces aestuarii ATCC 18862 contig00116, 
whole genome shotgun sequence
Length=90498

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  194    ATTTAGTTTTGAAGAGTGAA  213
              |||| |||||||||||||||
Sbjct  57358  ATTTGGTTTTGAAGAGTGAA  57339


> AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, 
whole genome shotgun sequence
Length=72341

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  319    TTTCATTTCTATATTA  334
              ||||||||||||||||
Sbjct  62800  TTTCATTTCTATATTA  62785


> AEAS01000098  Kluyveromyces aestuarii ATCC 18862 contig00103, 
whole genome shotgun sequence
Length=56028

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  212    AAAACAACTAAATCAGGCGG  231
              |||||| |||||||||||||
Sbjct  24068  AAAACAGCTAAATCAGGCGG  24049


> KLAEg1040 KLAEg1040 undefined product 2258434:2260800 forward
Length=2367

 Score = 32.2 bits (16),  Expect = 4.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  235  AAGAAAATCAATAGCT  250
            ||||||||||||||||
Sbjct  992  AAGAAAATCAATAGCT  977



Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 

Effective search space used: 22882284336


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 1 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
ttagggttgagtggggagtaaagaataaagcgaatcctattcgtgtaagccggtctacttattgataacaatattttacaggcggctatcatgtttcagcttacgcattcacagtcaggttggtgctctacatgaataccagcgtttactttcatttacagagtactagcacctccactgtcgctaatactgaatttagttttgaagagtgaaaacaactaaatcaggcggtagaagaaaatcaatagctcatatattcttatatattacaggtgatatttgtatatgattatgaatggcttttcgtagcccgtgatctttcatttctatattatgtgtagctaa
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)