blastn task: [no title]

Status
finished finished
Modified 2016-05-16T13:22:08Z
CPU time (s) 0.0
Size (bytes) 14260
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
           510 sequences; 9,807,744 total letters



Query= query

Length=886
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAV01000209  Kluyveromyces wickerhamii UCD 54-210 contig00217,...   738    0.0  
  AEAV01000406  Kluyveromyces wickerhamii UCD 54-210 contig00805,...  31.9    2.0  
  AEAV01000060  Kluyveromyces wickerhamii UCD 54-210 contig00063,...  31.9    2.0  
  AEAV01000487  Kluyveromyces wickerhamii UCD 54-210 contig00912,...  30.1    7.1  
  AEAV01000423  Kluyveromyces wickerhamii UCD 54-210 contig00826,...  30.1    7.1  
  AEAV01000420  Kluyveromyces wickerhamii UCD 54-210 contig00823,...  30.1    7.1  
  AEAV01000341  Kluyveromyces wickerhamii UCD 54-210 contig00353,...  30.1    7.1  
  AEAV01000292  Kluyveromyces wickerhamii UCD 54-210 contig00303,...  30.1    7.1  
  AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283,...  30.1    7.1  
  AEAV01000247  Kluyveromyces wickerhamii UCD 54-210 contig00258,...  30.1    7.1  
  AEAV01000214  Kluyveromyces wickerhamii UCD 54-210 contig00225,...  30.1    7.1  
  AEAV01000207  Kluyveromyces wickerhamii UCD 54-210 contig00215,...  30.1    7.1  
  AEAV01000206  Kluyveromyces wickerhamii UCD 54-210 contig00214,...  30.1    7.1  
  AEAV01000175  Kluyveromyces wickerhamii UCD 54-210 contig00182,...  30.1    7.1  
  AEAV01000172  Kluyveromyces wickerhamii UCD 54-210 contig00179,...  30.1    7.1  
  AEAV01000171  Kluyveromyces wickerhamii UCD 54-210 contig00178,...  30.1    7.1  
  AEAV01000149  Kluyveromyces wickerhamii UCD 54-210 contig00155,...  30.1    7.1  
  AEAV01000090  Kluyveromyces wickerhamii UCD 54-210 contig00094,...  30.1    7.1  
  AEAV01000084  Kluyveromyces wickerhamii UCD 54-210 contig00088,...  30.1    7.1  
  AEAV01000043  Kluyveromyces wickerhamii UCD 54-210 contig00046,...  30.1    7.1  


> AEAV01000209  Kluyveromyces wickerhamii UCD 54-210 contig00217, 
whole genome shotgun sequence
Length=63898

 Score =  738 bits (818),  Expect = 0.0
 Identities = 686/870 (79%), Gaps = 3/870 (0%)
 Strand=Plus/Plus

Query  2     CCTCATAACGGCACAAAGACAGAAATCCCAACTTCCCTTGAAGAATTGTTGAAACCAAGC  61
             |||||||| ||||| ||||||||||| ||||||    | || || || ||||| ||||| 
Sbjct  8322  CCTCATAATGGCACCAAGACAGAAATACCAACTAGTTTGGATGAGTTATTGAAGCCAAGT  8381

Query  62    GACAAGGTCCTATTGAAGAAACGTGTGTTTGCATTGCGTAGGCCAGAGGGAACCCTACCC  121
             |||||||| |||||||| |||||||| || ||||||||||| || || || || || |||
Sbjct  8382  GACAAGGTGCTATTGAAAAAACGTGTATTCGCATTGCGTAGACCTGAAGGGACTCTCCCC  8441

Query  122   CCAATCGTGACCCACAACATGGTGGACGACGCTACGGATCCCGTCTTGAACCAAATCAGA  181
             ||||| || ||||| || ||| | || || ||||| |||||  | ||||| |||||||| 
Sbjct  8442  CCAATTGTTACCCATAATATGATCGATGATGCTACTGATCCAATTTTGAATCAAATCAGG  8501

Query  182   CGTGTCCAATTGTTCAACAACTCGTACGATCGTGTCAAGATCATTTTCCATCCAGAGTTC  241
             ||||| ||| | ||||||||||| ||||||||||| || || ||||||||||| ||||||
Sbjct  8502  CGTGTACAACTCTTCAACAACTCATACGATCGTGTAAAAATTATTTTCCATCCTGAGTTC  8561

Query  242   TTGAACGCCAATAACCCAATCTTATCTCTAGATTACGACGAGTTCGTCAGAGGTTGCCAT  301
             ||||| || || || || ||  || |  ||||||| || || || ||  | ||||| |||
Sbjct  8562  TTGAATGCTAACAATCCTATTCTACCAATAGATTATGATGAATTTGTTCGCGGTTGTCAT  8621

Query  302   TTGGGTGTGTTCCCTTCGTATTACGAGCCATGGGGTTACACCCCAGCAGAGTGTACCGTC  361
             |||||||| ||||| || || ||||| || ||||| ||||| || ||||| |||||||||
Sbjct  8622  TTGGGTGTCTTCCCATCATACTACGAACCTTGGGGCTACACACCTGCAGAATGTACCGTC  8681

Query  362   ATGGGTATCCCATCCATCACAACCAACTTGTCCGGTTTTGGTGCATACATGGAGGATTTG  421
             ||||| || ||||| |||||||| || || || || |||||||| || ||||| ||||| 
Sbjct  8682  ATGGGAATTCCATCAATCACAACTAATTTATCTGGGTTTGGTGCTTATATGGAAGATTTA  8741

Query  422   ATAGAGAAGGATCAGGCTAAGGATTACGGTATCTACATCGTAGACCGTCGTTTCAAAAAC  481
             || || ||| |||| || |||||||||||||| ||||||||||| ||||||||||| || 
Sbjct  8742  ATTGAAAAGAATCAAGCAAAGGATTACGGTATTTACATCGTAGATCGTCGTTTCAAGAAT  8801

Query  482   CCAGACGAGTCTGTCAACCAGCTTGTCGACTACATGGAGGAGTTCGTCCTCAAGACCCGT  541
             |||||||| || ||  | ||||| ||||| || |||||||| || ||   ||||||||||
Sbjct  8802  CCAGACGAATCCGTAGAACAGCTAGTCGATTATATGGAGGAATTTGTGAACAAGACCCGT  8861

Query  542   AGACAAAGAATCAACCAAAGAAACAGAACTGAACGTTTATCCGATCTATTGGACTGGAGA  601
             || ||||||||||||||||| || |||||||| || ||||| ||  |  | || ||||||
Sbjct  8862  AGGCAAAGAATCAACCAAAGGAATAGAACTGAGCGCTTATCTGACTTGCTAGATTGGAGA  8921

Query  602   CGTATGGGTTTAGAATACGTCAAGGCTCGTCAACTTGCCTTGCGTAGAGCGTACCCAGAT  661
             ||||||||||| ||||| || |||||  | ||| | || || || ||||| ||||| || 
Sbjct  8922  CGTATGGGTTTGGAATATGTTAAGGCAAGACAATTGGCTTTACGCAGAGCCTACCCCGAA  8981

Query  662   GAGTTCAAAGAATTGACAGGCGGAAACGAACTCGATGACTCCAACATGGATTCAATGGCA  721
             |||||||| ||  | ||||| |||   ||| | || ||||| |||||||| ||  | |||
Sbjct  8982  GAGTTCAAGGAGCTAACAGGAGGAGCAGAATTGGACGACTCTAACATGGACTCCTTAGCA  9041

Query  722   GGTAAAAAACAAAAAATCAAGGTCGCAAGACCTTTGAGTGTCCCTGGCTCTCCAAAGGAC  781
             ||   ||| |  ||  ||||||| || |||||||| || || ||||| ||||| ||||| 
Sbjct  9042  GG---AAACCCTAAGGTCAAGGTTGCTAGACCTTTAAGCGTTCCTGGTTCTCCTAAGGAT  9098

Query  782   TCTAGAGCAAGCAGCGTTGGCGCCGTAATGATGACTCCCGGCGATTTCGGGACTCTACAA  841
             || ||||| || || || ||||| || |||||||| || || || || || ||| |||||
Sbjct  9099  TCAAGAGCTAGTAGTGTGGGCGCAGTCATGATGACCCCTGGTGACTTGGGAACTTTACAA  9158

Query  842   GACGCTAACAACGCAGATGACTATTTCCAT  871
             || || || || ||||| ||||||||||||
Sbjct  9159  GATGCAAATAATGCAGACGACTATTTCCAT  9188


> AEAV01000406  Kluyveromyces wickerhamii UCD 54-210 contig00805, 
whole genome shotgun sequence
Length=7254

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  131   ACCCACAACATGGTGGACGACG  152
             || ||||||| |||||||||||
Sbjct  2553  ACTCACAACACGGTGGACGACG  2574


> AEAV01000060  Kluyveromyces wickerhamii UCD 54-210 contig00063, 
whole genome shotgun sequence
Length=37999

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  547   AAGAATCAACCAAAGAAACAGA  568
             || ||||||| |||||||||||
Sbjct  3112  AATAATCAACTAAAGAAACAGA  3133


> AEAV01000487  Kluyveromyces wickerhamii UCD 54-210 contig00912, 
whole genome shotgun sequence
Length=15512

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  12    GCACAAAGACAGAAAT  27
             ||||||||||||||||
Sbjct  3971  GCACAAAGACAGAAAT  3986


> AEAV01000423  Kluyveromyces wickerhamii UCD 54-210 contig00826, 
whole genome shotgun sequence
Length=18702

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  55     ACCAAGCGACAAGGTC  70
              ||||||||||||||||
Sbjct  17667  ACCAAGCGACAAGGTC  17682


> AEAV01000420  Kluyveromyces wickerhamii UCD 54-210 contig00823, 
whole genome shotgun sequence
Length=45284

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  586    TCTATTGGACTGGAGACGT  604
              |||| ||||||||||||||
Sbjct  11948  TCTAGTGGACTGGAGACGT  11966


> AEAV01000341  Kluyveromyces wickerhamii UCD 54-210 contig00353, 
whole genome shotgun sequence
Length=5241

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  214   TGTCAAGATCATTTTC  229
             ||||||||||||||||
Sbjct  2175  TGTCAAGATCATTTTC  2160


> AEAV01000292  Kluyveromyces wickerhamii UCD 54-210 contig00303, 
whole genome shotgun sequence
Length=30525

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  549    GAATCAACCAAAGAAACAGAACTGAA  574
              ||||| |  |||||||||||| ||||
Sbjct  29877  GAATCGAAGAAAGAAACAGAAATGAA  29902


> AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283, 
whole genome shotgun sequence
Length=32523

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  713    TCAATGGCAGGTAAAAAACAA  733
              |||||  ||||||||||||||
Sbjct  25547  TCAATCTCAGGTAAAAAACAA  25567


> AEAV01000247  Kluyveromyces wickerhamii UCD 54-210 contig00258, 
whole genome shotgun sequence
Length=37525

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  184   TGTCCAATTGTTCAAC  199
             ||||||||||||||||
Sbjct  4159  TGTCCAATTGTTCAAC  4144


> AEAV01000214  Kluyveromyces wickerhamii UCD 54-210 contig00225, 
whole genome shotgun sequence
Length=94528

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  413    GAGGATTTGATAGAGA  428
              ||||||||||||||||
Sbjct  81534  GAGGATTTGATAGAGA  81519


> AEAV01000207  Kluyveromyces wickerhamii UCD 54-210 contig00215, 
whole genome shotgun sequence
Length=53405

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  186   TCCAATTGTTCAACAACTCGT  206
             || ||||||||||||||| ||
Sbjct  6008  TCAAATTGTTCAACAACTTGT  6028


> AEAV01000206  Kluyveromyces wickerhamii UCD 54-210 contig00214, 
whole genome shotgun sequence
Length=12080

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  729  AACAAAAAATCAAGGT  744
            ||||||||||||||||
Sbjct  817  AACAAAAAATCAAGGT  802


> AEAV01000175  Kluyveromyces wickerhamii UCD 54-210 contig00182, 
whole genome shotgun sequence
Length=11686

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  195   TCAACAACTCGTACGATCGTG  215
             ||||||| | |||||||||||
Sbjct  3620  TCAACAAGTGGTACGATCGTG  3600


> AEAV01000172  Kluyveromyces wickerhamii UCD 54-210 contig00179, 
whole genome shotgun sequence
Length=68566

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  540    GTAGACAAAGAATCAA  555
              ||||||||||||||||
Sbjct  59740  GTAGACAAAGAATCAA  59725


> AEAV01000171  Kluyveromyces wickerhamii UCD 54-210 contig00178, 
whole genome shotgun sequence
Length=30427

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  765    CTGGCTCTCCAAAGGACTCTA  785
              ||| |||| ||||||||||||
Sbjct  21101  CTGCCTCTGCAAAGGACTCTA  21081


> AEAV01000149  Kluyveromyces wickerhamii UCD 54-210 contig00155, 
whole genome shotgun sequence
Length=33844

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  680    GGCGGAAACGAACTCGATG  698
              |||||||||||||||| ||
Sbjct  12791  GGCGGAAACGAACTCGCTG  12773


> AEAV01000090  Kluyveromyces wickerhamii UCD 54-210 contig00094, 
whole genome shotgun sequence
Length=34916

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  127    CGTGACCCACAACATGGTGGACGA  150
              ||||| |||  |||||||||||||
Sbjct  21080  CGTGATCCAGTACATGGTGGACGA  21057


> AEAV01000084  Kluyveromyces wickerhamii UCD 54-210 contig00088, 
whole genome shotgun sequence
Length=61206

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  273    ATTACGACGAGTTCGT  288
              ||||||||||||||||
Sbjct  41602  ATTACGACGAGTTCGT  41617


> AEAV01000043  Kluyveromyces wickerhamii UCD 54-210 contig00046, 
whole genome shotgun sequence
Length=7446

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  620  GTCAAGGCTCGTCAACTTG  638
            ||||||||||||||| |||
Sbjct  638  GTCAAGGCTCGTCAAGTTG  620



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8423256240


  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
CCCTCATAACGGCACAAAGACAGAAATCCCAACTTCCCTTGAAGAATTGTTGAAACCAAGCGACAAGGTCCTATTGAAGAAACGTGTGTTTGCATTGCGTAGGCCAGAGGGAACCCTACCCCCAATCGTGACCCACAACATGGTGGACGACGCTACGGATCCCGTCTTGAACCAAATCAGACGTGTCCAATTGTTCAACAACTCGTACGATCGTGTCAAGATCATTTTCCATCCAGAGTTCTTGAACGCCAATAACCCAATCTTATCTCTAGATTACGACGAGTTCGTCAGAGGTTGCCATTTGGGTGTGTTCCCTTCGTATTACGAGCCATGGGGTTACACCCCAGCAGAGTGTACCGTCATGGGTATCCCATCCATCACAACCAACTTGTCCGGTTTTGGTGCATACATGGAGGATTTGATAGAGAAGGATCAGGCTAAGGATTACGGTATCTACATCGTAGACCGTCGTTTCAAAAACCCAGACGAGTCTGTCAACCAGCTTGTCGACTACATGGAGGAGTTCGTCCTCAAGACCCGTAGACAAAGAATCAACCAAAGAAACAGAACTGAACGTTTATCCGATCTATTGGACTGGAGACGTATGGGTTTAGAATACGTCAAGGCTCGTCAACTTGCCTTGCGTAGAGCGTACCCAGATGAGTTCAAAGAATTGACAGGCGGAAACGAACTCGATGACTCCAACATGGATTCAATGGCAGGTAAAAAACAAAAAATCAAGGTCGCAAGACCTTTGAGTGTCCCTGGCTCTCCAAAGGACTCTAGAGCAAGCAGCGTTGGCGCCGTAATGATGACTCCCGGCGATTTCGGGACTCTACAAGACGCTAACAACGCAGATGACTATTTCCATCTTGCCATGGATGAC
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)