blastn task: pKlFBP1

Status
finished finished
Modified 2013-11-07T10:11:15Z
CPU time (s) 0.1
Size (bytes) 26227
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_lactis_Y-1140.fna' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces aestuarii ATCC
18862 AEAS00000000_1; Kluyveromyces wickerhamii UCD 54 210
AEAV00000000_1; Kluyveromyces lactis NRRL Y-1140
           854 sequences; 41,189,204 total letters



Query= query

Length=1000
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  1804    0.0  
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    0.23 
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    0.80 
  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    0.80 
  gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    0.80 
  AEAS01000131  Kluyveromyces aestuarii ATCC 18862 contig00137, w...  35.6    0.80 
  gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 c...  33.7    2.8  
  AEAV01000483  Kluyveromyces wickerhamii UCD 54-210 contig00908,...  33.7    2.8  
  AEAS01000272  Kluyveromyces aestuarii ATCC 18862 contig00584, w...  33.7    2.8  
  AEAS01000148  Kluyveromyces aestuarii ATCC 18862 contig00157, w...  33.7    2.8  
  AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, w...  33.7    2.8  
  AEAS01000072  Kluyveromyces aestuarii ATCC 18862 contig00076, w...  33.7    2.8  
  AEAV01000497  Kluyveromyces wickerhamii UCD 54-210 contig00933,...  31.9    9.7  
  AEAV01000223  Kluyveromyces wickerhamii UCD 54-210 contig00234,...  31.9    9.7  
  AEAV01000172  Kluyveromyces wickerhamii UCD 54-210 contig00179,...  31.9    9.7  
  AEAV01000091  Kluyveromyces wickerhamii UCD 54-210 contig00095,...  31.9    9.7  
  AEAV01000086  Kluyveromyces wickerhamii UCD 54-210 contig00090,...  31.9    9.7  
  AEAV01000066  Kluyveromyces wickerhamii UCD 54-210 contig00069,...  31.9    9.7  
  AEAV01000060  Kluyveromyces wickerhamii UCD 54-210 contig00063,...  31.9    9.7  
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    9.7  
  AEAS01000184  Kluyveromyces aestuarii ATCC 18862 contig00197, w...  31.9    9.7  
  AEAS01000152  Kluyveromyces aestuarii ATCC 18862 contig00161, w...  31.9    9.7  
  AEAS01000102  Kluyveromyces aestuarii ATCC 18862 contig00107, w...  31.9    9.7  
  AEAS01000100  Kluyveromyces aestuarii ATCC 18862 contig00105, w...  31.9    9.7  
  AEAS01000099  Kluyveromyces aestuarii ATCC 18862 contig00104, w...  31.9    9.7  
  AEAS01000078  Kluyveromyces aestuarii ATCC 18862 contig00082, w...  31.9    9.7  
  AEAS01000063  Kluyveromyces aestuarii ATCC 18862 contig00067, w...  31.9    9.7  
  AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, w...  31.9    9.7  


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 1804 bits (2000),  Expect = 0.0
 Identities = 1000/1000 (100%), Gaps = 0/1000 (0%)
 Strand=Plus/Plus

Query  1       GAAAAGTACGTTACCAGACGGCGAAAGAGAGATCCTATGGAAATACAATCGTGTACACAA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125280  GAAAAGTACGTTACCAGACGGCGAAAGAGAGATCCTATGGAAATACAATCGTGTACACAA  125339

Query  61      GGAACGATTTGATGGAGCTTACTTCCGCTCTACCTTGACGATTGTTACAACTGATCAAAG  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125340  GGAACGATTTGATGGAGCTTACTTCCGCTCTACCTTGACGATTGTTACAACTGATCAAAG  125399

Query  121     GAATATGCCGAAATCGCTTCTTCATGTTAGATTTTCTTATTGCAGTAGACCAGAACACGT  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125400  GAATATGCCGAAATCGCTTCTTCATGTTAGATTTTCTTATTGCAGTAGACCAGAACACGT  125459

Query  181     GACCCGAATTTTTGGACGGATCTCAGTTACTTTTCACGAGATATCCGGGTAATATCACGG  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125460  GACCCGAATTTTTGGACGGATCTCAGTTACTTTTCACGAGATATCCGGGTAATATCACGG  125519

Query  241     TATTTAAATCTACTTGTCAAACACCCATCAACCACACATACATAAATTCTCCCGGTCGCC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125520  TATTTAAATCTACTTGTCAAACACCCATCAACCACACATACATAAATTCTCCCGGTCGCC  125579

Query  301     CCTCTGGTTCCCCCCCACTACCGATACAGCACTGGCAGAAATTGGAAAACCAAAGACGAA  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125580  CCTCTGGTTCCCCCCCACTACCGATACAGCACTGGCAGAAATTGGAAAACCAAAGACGAA  125639

Query  361     AACATGTTCCCGGAGCTCCAATGAACCCACACATCACGATATATGACCCCAGATTCATTT  420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125640  AACATGTTCCCGGAGCTCCAATGAACCCACACATCACGATATATGACCCCAGATTCATTT  125699

Query  421     AATTTGAAGATCAATAAAACCTTTTTTTTTATTTTCCCTCTCAGTGTTATGAGCAAAATC  480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125700  AATTTGAAGATCAATAAAACCTTTTTTTTTATTTTCCCTCTCAGTGTTATGAGCAAAATC  125759

Query  481     ACCTTAAATCGCTACAGAAAACACATAATCAAATAGTACTTGCAAATCATGTTCTGTTTC  540
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125760  ACCTTAAATCGCTACAGAAAACACATAATCAAATAGTACTTGCAAATCATGTTCTGTTTC  125819

Query  541     AAGTGACTAGGAAATGCCTTAGCACACTACGTGCCATACTGCGTCCATAGCGAGCTTTTC  600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125820  AAGTGACTAGGAAATGCCTTAGCACACTACGTGCCATACTGCGTCCATAGCGAGCTTTTC  125879

Query  601     TCATTCTGTTTTTCTTTTGTTTCCTTCGCGCCAGAAATGGTGCGGTTCTTGCGATTTTTC  660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125880  TCATTCTGTTTTTCTTTTGTTTCCTTCGCGCCAGAAATGGTGCGGTTCTTGCGATTTTTC  125939

Query  661     AAAGCTAGAAGAAATTCAGAGACCAGATAATCGATATCAGACAGAGTAATGAACTGGCTT  720
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  125940  AAAGCTAGAAGAAATTCAGAGACCAGATAATCGATATCAGACAGAGTAATGAACTGGCTT  125999

Query  721     CGTTGGTTTCTTCGGGGGTAGAATTTTCCGAATTAATCCGTTGCGTTGTCCGCTACTTGC  780
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  126000  CGTTGGTTTCTTCGGGGGTAGAATTTTCCGAATTAATCCGTTGCGTTGTCCGCTACTTGC  126059

Query  781     GTATGGATGTAAGTCGTGTATATTGTCTGTTTGATCCTTATTTTAGTGTATATAAATTGG  840
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  126060  GTATGGATGTAAGTCGTGTATATTGTCTGTTTGATCCTTATTTTAGTGTATATAAATTGG  126119

Query  841     ATTCAAACCAGTTTTATGATTTCGATCCTCTTCAGCACTTTATGACTTATTATTGGATTC  900
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  126120  ATTCAAACCAGTTTTATGATTTCGATCCTCTTCAGCACTTTATGACTTATTATTGGATTC  126179

Query  901     GAGCATTAGTTTCAAATTAAAGGCATAATCAAGTAGAAAGAAGACTATTCAATTCATTTC  960
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  126180  GAGCATTAGTTTCAAATTAAAGGCATAATCAAGTAGAAAGAAGACTATTCAATTCATTTC  126239

Query  961     CCTTCCGAAGCTTCGCATATCCCGATTAAATAATTAATAA  1000
               ||||||||||||||||||||||||||||||||||||||||
Sbjct  126240  CCTTCCGAAGCTTCGCATATCCCGATTAAATAATTAATAA  126279


 Score = 35.6 bits (38),  Expect = 0.80
 Identities = 37/46 (81%), Gaps = 2/46 (4%)
 Strand=Plus/Plus

Query  411     AGAT-TCATTTAATTTGAAGATCAATAAAACCTTTTTTTTTATTTT  455
               |||| ||||||| | || |||||||   |  |||||||||||||||
Sbjct  164853  AGATGTCATTTA-TATGTAGATCAAGTTACGCTTTTTTTTTATTTT  164897


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  966     CGAAGCTTCGCATATCCCGATT  987
               |||| ||||||||||| |||||
Sbjct  138532  CGAATCTTCGCATATCTCGATT  138511


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 37.4 bits (40),  Expect = 0.23
 Identities = 27/30 (90%), Gaps = 1/30 (3%)
 Strand=Plus/Minus

Query  594     GCTTTTC-TCATTCTGTTTTTCTTTTGTTT  622
               ||||||| ||||| | ||||||||||||||
Sbjct  854323  GCTTTTCATCATTTTTTTTTTCTTTTGTTT  854294


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  320     ACCGATACAGCACTGGC  336
               |||||||||||||||||
Sbjct  126504  ACCGATACAGCACTGGC  126488


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 35.6 bits (38),  Expect = 0.80
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  518      ACTTGCAAATCATGTTCTGTTTCAAGTGA  546
                |||||||||||||  ||| |||||| |||
Sbjct  2179368  ACTTGCAAATCATTATCTATTTCAACTGA  2179396


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  216    ACGAGATATCCGGGTAATAT  235
              ||| ||||||||||||||||
Sbjct  65675  ACGTGATATCCGGGTAATAT  65656


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  439     ACCTTTTTTTTTATTTTCCC  458
               ||||||||||||||||| ||
Sbjct  674940  ACCTTTTTTTTTATTTTTCC  674921


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 35.6 bits (38),  Expect = 0.80
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  657     TTTCAAAGCTAGAAGAAATTCAGA  680
               |||||||| ||||||||||| |||
Sbjct  789808  TTTCAAAGTTAGAAGAAATTAAGA  789831


 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  599    TCTCATTCTGTTTTTCTTTTGTTTCCTT  626
              |||||| |||  ||| ||||||||||||
Sbjct  82039  TCTCATACTGCCTTTTTTTTGTTTCCTT  82012


 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 26/30 (87%), Gaps = 1/30 (3%)
 Strand=Plus/Plus

Query  205     AGTTACTTTTCACGAGATATCCGGGTAATA  234
               ||| |||| | | |||||||||||||||||
Sbjct  700830  AGTAACTTAT-AGGAGATATCCGGGTAATA  700858


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  176      CACGTGACCCGAATTTT  192
                |||||||||||||||||
Sbjct  1166968  CACGTGACCCGAATTTT  1166984


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  925      ATAATCAAGTAGAAAGAAGACT  946
                ||||||||||||||| || |||
Sbjct  1283908  ATAATCAAGTAGAAAAAAAACT  1283887


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 35.6 bits (38),  Expect = 0.80
 Identities = 27/32 (85%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  595     CTTTTCTCATTCTGTTTTTCTTTTGTTTCCTT  626
               ||||| |  |||| | ||||||||||||||||
Sbjct  794509  CTTTTTTGTTTCTTTGTTTCTTTTGTTTCCTT  794540


> AEAS01000131  Kluyveromyces aestuarii ATCC 18862 contig00137, 
whole genome shotgun sequence
Length=95076

 Score = 35.6 bits (38),  Expect = 0.80
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  604    TTCTGTTTTTCTTTTGTTTCCTTC  627
              |||| |||||||||||||| ||||
Sbjct  13555  TTCTTTTTTTCTTTTGTTTTCTTC  13532


> gsASS001Lm
Length=10741898

 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  171      CAGAACACGTGACCCGAATTTTT  193
                |||||||||||||| ||||| ||
Sbjct  8343114  CAGAACACGTGACCTGAATTCTT  8343136


 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  739      TAGAATTTTCCGAATTAATCC  759
                ||||||||||||||| |||||
Sbjct  8607814  TAGAATTTTCCGAATAAATCC  8607794


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  527     TCATGTTCTGTTTCAAGTGACTAGGAA  553
               ||||||||||||| ||| | ||| |||
Sbjct  815423  TCATGTTCTGTTTAAAGAGGCTAAGAA  815449


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  934      TAGAAAGAAGACTATTC  950
                |||||||||||||||||
Sbjct  1825187  TAGAAAGAAGACTATTC  1825203


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  370      CCGGAGCTCCAATGAACCCA  389
                ||| ||||||||||||||||
Sbjct  2665389  CCGAAGCTCCAATGAACCCA  2665370


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  186      GAATTTTTGGACGGATCTCAGTTAC  210
                |||||||||||| | |||||| |||
Sbjct  3197910  GAATTTTTGGACCGGTCTCAGCTAC  3197934


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  654      ATTTTTCAAAGCTAGAA  670
                |||||||||||||||||
Sbjct  3606779  ATTTTTCAAAGCTAGAA  3606763


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  500      AACACATAATCAAATAGTACTT  521
                |||||||| | |||||||||||
Sbjct  5707579  AACACATAGTAAAATAGTACTT  5707558


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  589      AGCGAGCTTTTCTCATTCTGTTTTTCT  615
                ||||| || |||  |||||||||||||
Sbjct  6566108  AGCGATCTCTTCAAATTCTGTTTTTCT  6566082


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  236      CACGGTATTTAAATCTACTT  255
                |||||| |||||||||||||
Sbjct  6792816  CACGGTTTTTAAATCTACTT  6792835


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 27/32 (85%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  334      GGCAGAA-ATTGGAAAACCAAAGACGAAAACA  364
                || |||| || ||||||||||| || ||||||
Sbjct  8709805  GGTAGAACATAGGAAAACCAAAAACAAAAACA  8709836


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  713      ACTGGCTTCGTTGGTTTCTT  732
                ||||||| ||||||||||||
Sbjct  9230261  ACTGGCTACGTTGGTTTCTT  9230242


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  437      AAACCTTTTTTTTTATTTTCCCTCTCA  463
                |||||| | || || ||||||||||||
Sbjct  9784605  AAACCTCTGTTCTTTTTTTCCCTCTCA  9784631


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  411       AGATTCATTTAATTTGA  427
                 |||||||||||||||||
Sbjct  10517996  AGATTCATTTAATTTGA  10517980


> AEAV01000483  Kluyveromyces wickerhamii UCD 54-210 contig00908, 
whole genome shotgun sequence
Length=31509

 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  528    CATGTTCTGTTTCAAGTG  545
              ||||||||||||||||||
Sbjct  28292  CATGTTCTGTTTCAAGTG  28309


> AEAS01000272  Kluyveromyces aestuarii ATCC 18862 contig00584, 
whole genome shotgun sequence
Length=75083

 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  434    ATAAAACCTTTTTTTTTATTTTC  456
              || || |||||||||||||||||
Sbjct  69257  ATGAATCCTTTTTTTTTATTTTC  69235


> AEAS01000148  Kluyveromyces aestuarii ATCC 18862 contig00157, 
whole genome shotgun sequence
Length=5982

 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  596   TTTTCTCATTCTGTTTTTCTTTT  618
             || ||||||||||||||| ||||
Sbjct  4142  TTGTCTCATTCTGTTTTTTTTTT  4164


> AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, 
whole genome shotgun sequence
Length=165313

 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  435    TAAAACCTTTTTTTTTATTTT  455
              ||||||||||||||||| |||
Sbjct  84495  TAAAACCTTTTTTTTTAATTT  84475


> AEAS01000072  Kluyveromyces aestuarii ATCC 18862 contig00076, 
whole genome shotgun sequence
Length=90370

 Score = 33.7 bits (36),  Expect = 2.8
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  127    GCCGAAATCGCTTCTTCA  144
              ||||||||||||||||||
Sbjct  68906  GCCGAAATCGCTTCTTCA  68923


> AEAV01000497  Kluyveromyces wickerhamii UCD 54-210 contig00933, 
whole genome shotgun sequence
Length=10107

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  494   ACAGAAAACACATAATCAAATA  515
             ||||||||||| ||| ||||||
Sbjct  4879  ACAGAAAACACTTAAACAAATA  4858


> AEAV01000223  Kluyveromyces wickerhamii UCD 54-210 contig00234, 
whole genome shotgun sequence
Length=15380

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  437   AAACCTTTTTTTTTATT  453
             |||||||||||||||||
Sbjct  1815  AAACCTTTTTTTTTATT  1799


> AEAV01000172  Kluyveromyces wickerhamii UCD 54-210 contig00179, 
whole genome shotgun sequence
Length=68566

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  337   AGAAATTGGAAAACCAA  353
             |||||||||||||||||
Sbjct  9966  AGAAATTGGAAAACCAA  9950


> AEAV01000091  Kluyveromyces wickerhamii UCD 54-210 contig00095, 
whole genome shotgun sequence
Length=131328

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  419     TTAATTTGAAGATCAATAAAACCTTTT  445
               ||||  | ||||||||||||| |||||
Sbjct  119347  TTAAAGTCAAGATCAATAAAAACTTTT  119373


> AEAV01000086  Kluyveromyces wickerhamii UCD 54-210 contig00090, 
whole genome shotgun sequence
Length=30197

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  137  CTTCTTCATGTTAGATTTTCTT  158
            |||||||||||| || ||||||
Sbjct  732  CTTCTTCATGTTGGAGTTTCTT  711


> AEAV01000066  Kluyveromyces wickerhamii UCD 54-210 contig00069, 
whole genome shotgun sequence
Length=11635

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  419   TTAATTTGAAGATCAATAAAAC  440
             ||||||||||||| ||||| ||
Sbjct  6436  TTAATTTGAAGATTAATAATAC  6415


> AEAV01000060  Kluyveromyces wickerhamii UCD 54-210 contig00063, 
whole genome shotgun sequence
Length=37999

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  683   CCAGATAATCGATATCA  699
             |||||||||||||||||
Sbjct  6274  CCAGATAATCGATATCA  6290


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  370     CCGGAGCTCCAATGAACCCA  389
               ||| ||||||||||||||||
Sbjct  462822  CCGAAGCTCCAATGAACCCA  462841


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  52      TGTACACAAGGAACGATTTGATGGA  76
               ||||  ||||||||||||||| |||
Sbjct  624624  TGTAATCAAGGAACGATTTGAAGGA  624600


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  4       AAGTACGTTACCAGACGGCGAAAGA  28
               |||||| || || ||||||||||||
Sbjct  970356  AAGTACTTTGCCTGACGGCGAAAGA  970332


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  176      CACGTGACCCGAATTTTTGGAC  197
                ||||||||  ||||||||||||
Sbjct  1553592  CACGTGACGAGAATTTTTGGAC  1553613


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 26/32 (82%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  425      TGAAGATCAATAAAACCTTTTTTTTTATTTTC  456
                |||| |||  | | |||||||||||| |||||
Sbjct  1656909  TGAACATCCTTCATACCTTTTTTTTTTTTTTC  1656940


> AEAS01000184  Kluyveromyces aestuarii ATCC 18862 contig00197, 
whole genome shotgun sequence
Length=44776

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  442    TTTTTTTTTATTTTCCC  458
              |||||||||||||||||
Sbjct  29512  TTTTTTTTTATTTTCCC  29528


> AEAS01000152  Kluyveromyces aestuarii ATCC 18862 contig00161, 
whole genome shotgun sequence
Length=51814

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  907    TAGTTTCAAATTAAAGG  923
              |||||||||||||||||
Sbjct  10254  TAGTTTCAAATTAAAGG  10270


> AEAS01000102  Kluyveromyces aestuarii ATCC 18862 contig00107, 
whole genome shotgun sequence
Length=23800

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  543   GTGACTAGGAAATGCCTTAGCA  564
             |||| | |||||||||||||||
Sbjct  2925  GTGATTTGGAAATGCCTTAGCA  2946


> AEAS01000100  Kluyveromyces aestuarii ATCC 18862 contig00105, 
whole genome shotgun sequence
Length=126791

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  827    TGTATATAAATTGGATTCAAACCAGTT  853
              |||||  ||||||||||||||  ||||
Sbjct  35253  TGTATCGAAATTGGATTCAAAGAAGTT  35279


> AEAS01000099  Kluyveromyces aestuarii ATCC 18862 contig00104, 
whole genome shotgun sequence
Length=68330

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  854    TTATGATTTCGATCCTCTTCAG  875
              ||| | ||||||||||||||||
Sbjct  20559  TTAAGCTTTCGATCCTCTTCAG  20538


> AEAS01000078  Kluyveromyces aestuarii ATCC 18862 contig00082, 
whole genome shotgun sequence
Length=30524

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  421    AATTTGAAGATCAATAAAAC  440
              |||||||||||| |||||||
Sbjct  29049  AATTTGAAGATCGATAAAAC  29030


> AEAS01000063  Kluyveromyces aestuarii ATCC 18862 contig00067, 
whole genome shotgun sequence
Length=28045

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  657    TTTCAAAGCTAGAAGAA  673
              |||||||||||||||||
Sbjct  12379  TTTCAAAGCTAGAAGAA  12363


> AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, 
whole genome shotgun sequence
Length=106698

 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  433   AATAAAACCTTTTTTTTTATTT  454
             || ||||||||||||||| |||
Sbjct  8865  AACAAAACCTTTTTTTTTCTTT  8886


 Score = 31.9 bits (34),  Expect = 9.7
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  879    TTTATGACTTATTATTGGATTC  900
              || ||||||||||| |||||||
Sbjct  93603  TTAATGACTTATTAATGGATTC  93582



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 40012663824


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GAAAAGTACGTTACCAGACGGCGAAAGAGAGATCCTATGGAAATACAATCGTGTACACAAGGAACGATTTGATGGAGCTTACTTCCGCTCTACCTTGACGATTGTTACAACTGATCAAAGGAATATGCCGAAATCGCTTCTTCATGTTAGATTTTCTTATTGCAGTAGACCAGAACACGTGACCCGAATTTTTGGACGGATCTCAGTTACTTTTCACGAGATATCCGGGTAATATCACGGTATTTAAATCTACTTGTCAAACACCCATCAACCACACATACATAAATTCTCCCGGTCGCCCCTCTGGTTCCCCCCCACTACCGATACAGCACTGGCAGAAATTGGAAAACCAAAGACGAAAACATGTTCCCGGAGCTCCAATGAACCCACACATCACGATATATGACCCCAGATTCATTTAATTTGAAGATCAATAAAACCTTTTTTTTTATTTTCCCTCTCAGTGTTATGAGCAAAATCACCTTAAATCGCTACAGAAAACACATAATCAAATAGTACTTGCAAATCATGTTCTGTTTCAAGTGACTAGGAAATGCCTTAGCACACTACGTGCCATACTGCGTCCATAGCGAGCTTTTCTCATTCTGTTTTTCTTTTGTTTCCTTCGCGCCAGAAATGGTGCGGTTCTTGCGATTTTTCAAAGCTAGAAGAAATTCAGAGACCAGATAATCGATATCAGACAGAGTAATGAACTGGCTTCGTTGGTTTCTTCGGGGGTAGAATTTTCCGAATTAATCCGTTGCGTTGTCCGCTACTTGCGTATGGATGTAAGTCGTGTATATTGTCTGTTTGATCCTTATTTTAGTGTATATAAATTGGATTCAAACCAGTTTTATGATTTCGATCCTCTTCAGCACTTTATGACTTATTATTGGATTCGAGCATTAGTTTCAAATTAAAGGCATAATCAAGTAGAAAGAAGACTATTCAATTCATTTCCCTTCCGAAGCTTCGCATATCCCGATTAAATAATTAATAA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)