blastn task: ncRNA

Status
finished finished
Modified 2014-05-16T13:57:54Z
CPU time (s) 0.1
Size (bytes) 11930
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis;
Kluyveromyces lactis NRRL Y-1140
           20,500 sequences; 70,111,562 total letters



Query= query

Length=345
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000098  Kluyveromyces aestuarii ATCC 18862 contig00103, w...  39.2    0.036
  AEAS01000106  Kluyveromyces aestuarii ATCC 18862 contig00111, w...  35.6    0.44 
  KLAEg220 KLAEg220 undefined product 469367:472660 reverse           35.6    0.44 
  gsASS001Lm                                                          33.7    1.5  
  AEAV01000173  Kluyveromyces wickerhamii UCD 54-210 contig00180,...  31.9    5.4  
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    5.4  
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    5.4  
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    5.4  
  KLLA0F02211g KLLA0F02211g undefined product 8285091:8285915 rev...  31.9    5.4  
  KLLA0E19141g KLLA0E19141g undefined product 7556353:7558299 for...  31.9    5.4  
  KLLA0E09131g KLLA0E09131g undefined product 6668393:6669520 rev...  31.9    5.4  
  AEAS01000243  Kluyveromyces aestuarii ATCC 18862 contig00544, w...  31.9    5.4  
  AEAS01000111  Kluyveromyces aestuarii ATCC 18862 contig00116, w...  31.9    5.4  
  AEAS01000024  Kluyveromyces aestuarii ATCC 18862 contig00026, w...  31.9    5.4  
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    5.4  
  KLAEg4237 KLAEg4237 undefined product 8994096:8994851 forward       31.9    5.4  


> AEAS01000098  Kluyveromyces aestuarii ATCC 18862 contig00103, 
whole genome shotgun sequence
Length=56028

 Score = 39.2 bits (42),  Expect = 0.036
 Identities = 32/38 (85%), Gaps = 1/38 (2%)
 Strand=Plus/Minus

Query  204    GAAGAG-TGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
              |||||| | |||||| ||||||||||||| | || |||
Sbjct  24077  GAAGAGATTAAAACAGCTAAATCAGGCGGAATAATAAA  24040


> AEAS01000106  Kluyveromyces aestuarii ATCC 18862 contig00111, 
whole genome shotgun sequence
Length=37058

 Score = 35.6 bits (38),  Expect = 0.44
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  10    AGTGGGGAGTAAAGAATAAAGC  31
             |||||| |||||||||||||||
Sbjct  4538  AGTGGGTAGTAAAGAATAAAGC  4517


> KLAEg220 KLAEg220 undefined product 469367:472660 reverse
Length=3294

 Score = 35.6 bits (38),  Expect = 0.44
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  10    AGTGGGGAGTAAAGAATAAAGC  31
             |||||| |||||||||||||||
Sbjct  1707  AGTGGGTAGTAAAGAATAAAGC  1686


> gsASS001Lm
Length=10741898

 Score = 33.7 bits (36),  Expect = 1.5
 Identities = 26/31 (84%), Gaps = 4/31 (12%)
 Strand=Plus/Minus

Query  267     TTACAGGTGATATTTGTATATGATTATGAAT  297
               |||||||||||    ||||||||||||| ||
Sbjct  634222  TTACAGGTGAT----GTATATGATTATGTAT  634196


 Score = 33.7 bits (36),  Expect = 1.5
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  317       TCTTTCATTTCTATATTATGTGTAGC  342
                 |||||||||||| |||||| | ||||
Sbjct  10476089  TCTTTCATTTCTTTATTATATATAGC  10476114


 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  257      TTCTTATATATTACAGGTGA  276
                ||||||||||||||| ||||
Sbjct  8605517  TTCTTATATATTACAAGTGA  8605498


> AEAV01000173  Kluyveromyces wickerhamii UCD 54-210 contig00180, 
whole genome shotgun sequence
Length=74992

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  277    TATTTGTATATGATTATGAATGGCT  301
              |||| |||||||||||| |||| ||
Sbjct  55597  TATTAGTATATGATTATAAATGACT  55621


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  285     TATGATTATGAATGGCTTTT  304
               |||||||||||||| |||||
Sbjct  198330  TATGATTATGAATGTCTTTT  198349


 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  286      ATGATTATGAATGGCTTTTC  305
                ||| ||||||||||||||||
Sbjct  1345210  ATGTTTATGAATGGCTTTTC  1345191


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 23/26 (89%), Gaps = 2/26 (7%)
 Strand=Plus/Plus

Query  281     TGTATATGATTATGAATGGCTTTTCG  306
               ||||||||||| ||||||  ||||||
Sbjct  816199  TGTATATGATTTTGAATG--TTTTCG  816222


 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  201      TTTGAAGAGTGAAAACAACTAA  222
                ||||||||||| |||| |||||
Sbjct  1704564  TTTGAAGAGTGTAAACTACTAA  1704585


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 26/31 (84%), Gaps = 2/31 (6%)
 Strand=Plus/Minus

Query  252      ATATATTCTTATATATTACAGG--TGATATT  280
                |||||||  ||||||||||| |  |||||||
Sbjct  1473674  ATATATTTATATATATTACATGTATGATATT  1473644


> KLLA0F02211g KLLA0F02211g undefined product 8285091:8285915 reverse
Length=825

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  285  TATGATTATGAATGGCTTTT  304
            |||||||||||||| |||||
Sbjct  627  TATGATTATGAATGTCTTTT  608


> KLLA0E19141g KLLA0E19141g undefined product 7556353:7558299 forward
Length=1947

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  201   TTTGAAGAGTGAAAACAACTAA  222
             ||||||||||| |||| |||||
Sbjct  1099  TTTGAAGAGTGTAAACTACTAA  1120


> KLLA0E09131g KLLA0E09131g undefined product 6668393:6669520 reverse
Length=1128

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 23/26 (89%), Gaps = 2/26 (7%)
 Strand=Plus/Minus

Query  281  TGTATATGATTATGAATGGCTTTTCG  306
            ||||||||||| ||||||  ||||||
Sbjct  435  TGTATATGATTTTGAATG--TTTTCG  412


> AEAS01000243  Kluyveromyces aestuarii ATCC 18862 contig00544, 
whole genome shotgun sequence
Length=16353

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 26/32 (82%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  260    TTATATATTACAGGTGATATTTGTATATGATT  291
              |||||||||||   | |||||| ||||| |||
Sbjct  15402  TTATATATTACTAATTATATTTATATATAATT  15433


> AEAS01000111  Kluyveromyces aestuarii ATCC 18862 contig00116, 
whole genome shotgun sequence
Length=90498

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  194    ATTTAGTTTTGAAGAGTGAA  213
              |||| |||||||||||||||
Sbjct  57358  ATTTGGTTTTGAAGAGTGAA  57339


> AEAS01000024  Kluyveromyces aestuarii ATCC 18862 contig00026, 
whole genome shotgun sequence
Length=52539

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 26/32 (82%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  216    CAACTAAATCAGGCGGTAGAAGAAAATCAATA  247
              ||||||||||||| |  |||| ||| ||| ||
Sbjct  16716  CAACTAAATCAGGAGAGAGAAAAAATTCAGTA  16747


> AEAS01000004  Kluyveromyces aestuarii ATCC 18862 contig00005, 
whole genome shotgun sequence
Length=9249

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  253   TATATTCTTATATATTA  269
             |||||||||||||||||
Sbjct  2551  TATATTCTTATATATTA  2535


> KLAEg4237 KLAEg4237 undefined product 8994096:8994851 forward
Length=756

 Score = 31.9 bits (34),  Expect = 5.4
 Identities = 26/32 (82%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  216  CAACTAAATCAGGCGGTAGAAGAAAATCAATA  247
            ||||||||||||| |  |||| ||| ||| ||
Sbjct  92   CAACTAAATCAGGAGAGAGAAAAAATTCAGTA  123



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 22119463716


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
ttagggttgagtggggagtaaagaataaagcgaatcctattcgtgtaagccggtctacttattgataacaatattttacaggcggctatcatgtttcagcttacgcattcacagtcaggttggtgctctacatgaataccagcgtttactttcatttacagagtactagcacctccactgtcgctaatactgaatttagttttgaagagtgaaaacaactaaatcaggcggtagaagaaaatcaatagctcatatattcttatatattacaggtgatatttgtatatgattatgaatggcttttcgtagcccgtgatctttcatttctatattatgtgtagctaa
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)