blastn task: [no title]

Status
finished finished
Modified 2013-12-24T06:48:24Z
CPU time (s) 0.0
Size (bytes) 12419
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_lactis_Y-1140.fna -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces lactis NRRL Y-1140
           7 sequences; 10,729,447 total letters



Query= query

Length=20
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    2e-04
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    2e-04
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    2e-04
  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    2e-04
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    2e-04
  gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    2e-04


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  1    GAAAGAGGAAATCCGTTTCG  20
            ||||||||||||||||||||
Sbjct  511  GAAAGAGGAAATCCGTTTCG  492


 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  1        GAAAGAGGAAATCCGTTTCG  20
                ||||||||||||||||||||
Sbjct  2601246  GAAAGAGGAAATCCGTTTCG  2601265


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Minus

Query  3    AAGAGGAAATCCGT  16
            ||||||||||||||
Sbjct  434  AAGAGGAAATCCGT  421


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Plus

Query  3        AAGAGGAAATCCGT  16
                ||||||||||||||
Sbjct  2601323  AAGAGGAAATCCGT  2601336


 Score = 24.7 bits (26),  Expect = 1.2
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Minus

Query  1       GAAAGAGGAAATC  13
               |||||||||||||
Sbjct  809645  GAAAGAGGAAATC  809633


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  3       AAGAGGAAATCC  14
               ||||||||||||
Sbjct  373609  AAGAGGAAATCC  373598


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  1       GAAAGAGGAAAT  12
               ||||||||||||
Sbjct  381019  GAAAGAGGAAAT  381008


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Plus

Query  2        AAAGAGGAAATC  13
                ||||||||||||
Sbjct  1217506  AAAGAGGAAATC  1217517


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  8        GAAATCCGTTTC  19
                ||||||||||||
Sbjct  2281463  GAAATCCGTTTC  2281452


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 15/17 (89%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  3        AAGAGGAAATCCGTTTC  19
                ||||  |||||||||||
Sbjct  2539883  AAGAATAAATCCGTTTC  2539867


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  1    GAAAGAGGAAATCCGTTTCG  20
            ||||||||||||||||||||
Sbjct  719  GAAAGAGGAAATCCGTTTCG  700


 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  1        GAAAGAGGAAATCCGTTTCG  20
                ||||||||||||||||||||
Sbjct  2233308  GAAAGAGGAAATCCGTTTCG  2233327


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Minus

Query  3    AAGAGGAAATCCGT  16
            ||||||||||||||
Sbjct  642  AAGAGGAAATCCGT  629


 Score = 24.7 bits (26),  Expect = 1.2
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  7        GGAAATCCGTTTC  19
                |||||||||||||
Sbjct  1638322  GGAAATCCGTTTC  1638334


 Score = 24.7 bits (26),  Expect = 1.2
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  2        AAAGAGGAAATCC  14
                |||||||||||||
Sbjct  1806025  AAAGAGGAAATCC  1806037


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Plus

Query  2       AAAGAGGAAATC  13
               ||||||||||||
Sbjct  228577  AAAGAGGAAATC  228588


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  1       GAAAGAGGAAAT  12
               ||||||||||||
Sbjct  591464  GAAAGAGGAAAT  591453


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  2       AAAGAGGAAATC  13
               ||||||||||||
Sbjct  614837  AAAGAGGAAATC  614826


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  2       AAAGAGGAAATC  13
               ||||||||||||
Sbjct  805324  AAAGAGGAAATC  805313


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  8        GAAATCCGTTTC  19
                ||||||||||||
Sbjct  1171101  GAAATCCGTTTC  1171090


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  3        AAGAGGAAATCC  14
                ||||||||||||
Sbjct  1338277  AAGAGGAAATCC  1338266


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Plus

Query  2        AAAGAGGAAATC  13
                ||||||||||||
Sbjct  1529718  AAAGAGGAAATC  1529729


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  8        GAAATCCGTTTC  19
                ||||||||||||
Sbjct  1858782  GAAATCCGTTTC  1858771


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  1    GAAAGAGGAAATCCGTTTCG  20
            ||||||||||||||||||||
Sbjct  767  GAAAGAGGAAATCCGTTTCG  748


 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  1        GAAAGAGGAAATCCGTTTCG  20
                ||||||||||||||||||||
Sbjct  1714736  GAAAGAGGAAATCCGTTTCG  1714755


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Minus

Query  3    AAGAGGAAATCCGT  16
            ||||||||||||||
Sbjct  690  AAGAGGAAATCCGT  677


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Plus

Query  3        AAGAGGAAATCCGT  16
                ||||||||||||||
Sbjct  1714813  AAGAGGAAATCCGT  1714826


 Score = 24.7 bits (26),  Expect = 1.2
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  1       GAAAGAGGAAATC  13
               |||||||||||||
Sbjct  429689  GAAAGAGGAAATC  429701


 Score = 24.7 bits (26),  Expect = 1.2
 Identities = 15/16 (94%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  3        AAGAGGAAATCCGTTT  18
                ||||||||||| ||||
Sbjct  1469989  AAGAGGAAATCGGTTT  1469974


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Plus

Query  2       AAAGAGGAAATC  13
               ||||||||||||
Sbjct  232616  AAAGAGGAAATC  232627


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  8       GAAATCCGTTTC  19
               ||||||||||||
Sbjct  457436  GAAATCCGTTTC  457425


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  1        GAAAGAGGAAAT  12
                ||||||||||||
Sbjct  1371541  GAAAGAGGAAAT  1371530


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  1    GAAAGAGGAAATCCGTTTCG  20
            ||||||||||||||||||||
Sbjct  638  GAAAGAGGAAATCCGTTTCG  619


 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  1        GAAAGAGGAAATCCGTTTCG  20
                ||||||||||||||||||||
Sbjct  1753135  GAAAGAGGAAATCCGTTTCG  1753154


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Minus

Query  3    AAGAGGAAATCCGT  16
            ||||||||||||||
Sbjct  561  AAGAGGAAATCCGT  548


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Plus

Query  3        AAGAGGAAATCCGT  16
                ||||||||||||||
Sbjct  1753212  AAGAGGAAATCCGT  1753225


 Score = 24.7 bits (26),  Expect = 1.2
 Identities = 13/13 (100%), Gaps = 0/13 (0%)
 Strand=Plus/Plus

Query  1       GAAAGAGGAAATC  13
               |||||||||||||
Sbjct  180820  GAAAGAGGAAATC  180832


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  1    GAAAGAGGAAATCCGTTTCG  20
            ||||||||||||||||||||
Sbjct  892  GAAAGAGGAAATCCGTTTCG  873


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Minus

Query  3    AAGAGGAAATCCGT  16
            ||||||||||||||
Sbjct  815  AAGAGGAAATCCGT  802


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  1    GAAAGAGGAAATCCGTTTCG  20
            ||||||||||||||||||||
Sbjct  826  GAAAGAGGAAATCCGTTTCG  807


 Score = 37.4 bits (40),  Expect = 2e-04
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  1        GAAAGAGGAAATCCGTTTCG  20
                ||||||||||||||||||||
Sbjct  1061978  GAAAGAGGAAATCCGTTTCG  1061997


 Score = 26.5 bits (28),  Expect = 0.33
 Identities = 14/14 (100%), Gaps = 0/14 (0%)
 Strand=Plus/Minus

Query  3    AAGAGGAAATCCGT  16
            ||||||||||||||
Sbjct  749  AAGAGGAAATCCGT  736


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  2       AAAGAGGAAATC  13
               ||||||||||||
Sbjct  456937  AAAGAGGAAATC  456926


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  3       AAGAGGAAATCC  14
               ||||||||||||
Sbjct  887742  AAGAGGAAATCC  887731


 Score = 22.9 bits (24),  Expect = 4.0
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Plus

Query  1       GAAAGAGGAAAT  12
               ||||||||||||
Sbjct  958841  GAAAGAGGAAAT  958852



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 32187984


  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GAAAGAGGAAATCCGTTTCG
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)