blastn task: [no title]

Status
finished finished
Modified 2013-12-06T07:59:44Z
CPU time (s) 0.1
Size (bytes) 8050
Command blastn -num_descriptions 500 -outfmt 0 -dust yes -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_lactis_Y-1140.fna' -num_alignments 250 -evalue 10.0 -task megablast
Error [none]
Output
BLASTN 2.2.25+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces aestuarii ATCC
18862 AEAS00000000_1; Kluyveromyces wickerhamii UCD 54 210
AEAV00000000_1; Kluyveromyces lactis NRRL Y-1140
           854 sequences; 41,189,204 total letters



Query= query

Length=1038
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  1910    0.0  


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 1910 bits (1034),  Expect = 0.0
 Identities = 1037/1038 (99%), Gaps = 1/1038 (0%)
 Strand=Plus/Plus

Query  1        ATGTTCAGAAGAAAGCAAAAGGTTGAAGAAAAAGTTGACACTAGCAAATGGGTAAAGATC  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1658882  ATGTTCAGAAGAAAGCAAAAGGTTGAAGAAAAAGTTGACACTAGCAAATGGGTAAAGATC  1658941

Query  61       GAGGTTCCGATCGAATCACCTCCAGACGCAGTGAAACACCCTGAACCAATCGTTTTAGAA  120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1658942  GAGGTTCCGATCGAATCACCTCCAGACGCAGTGAAACACCCTGAACCAATCGTTTTAGAA  1659001

Query  121      GACGAACAATTGAAGAAATATAACACTGTATTTTCACATTTCACTGATACTGATTTACTA  180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659002  GACGAACAATTGAAGAAATATAACACTGTATTTTCACATTTCACTGATACTGATTTACTA  1659061

Query  181      ATTCCAACTAAAGAGaaaaaaaaTCATAGTGACAATGAGATGAAACCATTGACTGATTTG  240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659062  ATTCCAACTAAAGAGAAAAAAAATCATAGTGACAATGAGATGAAACCATTGACTGATTTG  1659121

Query  241      GAAAAAGCTTGGTTGAGTAGAGAATGTTTTATGAGATATTTAAGGGCCACCAAGTGGAAT  300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659122  GAAAAAGCTTGGTTGAGTAGAGAATGTTTTATGAGATATTTAAGGGCCACCAAGTGGAAT  1659181

Query  301      ACGCAAGATTGTATCGATAGAATTGTACTCTCTCTTGCTTGGAGAAGAGAATTTGGAATA  360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659182  ACGCAAGATTGTATCGATAGAATTGTACTCTCTCTTGCTTGGAGAAGAGAATTTGGAATA  1659241

Query  361      AGTAGTTTTGGAGAAGAAAATGGTGATTTGCTAACTGCTGACACTGTATCACCGGAGGCT  420
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct  1659242  AGTAGTTTTGGAGAAGAAAATGGTGATTTG-TAACTGCTGACACTGTATCACCGGAGGCT  1659300

Query  421      CTGACTGGGAAGGAAGTTGTTTTGGGTTTCGATAACGATTCAAGGCCTATATTGTACTTA  480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659301  CTGACTGGGAAGGAAGTTGTTTTGGGTTTCGATAACGATTCAAGGCCTATATTGTACTTA  1659360

Query  481      AAGCCTGGTAGGCAAAACACAGCAACCTCCCATAGACAAGTCCAGCACCTTGTATATATG  540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659361  AAGCCTGGTAGGCAAAACACAGCAACCTCCCATAGACAAGTCCAGCACCTTGTATATATG  1659420

Query  541      CTTGAACGTGTTATTGATTTCATGCCTCCTGGGCAAGATTCATTGGCTTTGTTGATAGAT  600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659421  CTTGAACGTGTTATTGATTTCATGCCTCCTGGGCAAGATTCATTGGCTTTGTTGATAGAT  1659480

Query  601      TTCAAAGATTATCCTGATGTTCCAAAGGTTCAAGGTAACTCAAAGATTCCTCCTTTAGGG  660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659481  TTCAAAGATTATCCTGATGTTCCAAAGGTTCAAGGTAACTCAAAGATTCCTCCTTTAGGG  1659540

Query  661      ACCGGTAAAGAGGTTTTACACATTTTACAAACACATTATCCAGAAAGATTAGGGAAAGCA  720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659541  ACCGGTAAAGAGGTTTTACACATTTTACAAACACATTATCCAGAAAGATTAGGGAAAGCA  1659600

Query  721      TTATTAACTAATATCCCGTGGCTTGCGTGGACCTTTTTGAAGCTCATCCATCCTTTTATT  780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659601  TTATTAACTAATATCCCGTGGCTTGCGTGGACCTTTTTGAAGCTCATCCATCCTTTTATT  1659660

Query  781      GATCCGTTGACTCGTGAAAAATTGGTTTTTGATGAACCATTTCCAAATTATGTGCCACCT  840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659661  GATCCGTTGACTCGTGAAAAATTGGTTTTTGATGAACCATTTCCAAATTATGTGCCACCT  1659720

Query  841      GATCAACTCGAGACGCTTTATGGTGGTAACCTCGACTTCAAATATAATCATGAAGCCTAT  900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659721  GATCAACTCGAGACGCTTTATGGTGGTAACCTCGACTTCAAATATAATCATGAAGCCTAT  1659780

Query  901      TGGCCTGTCCTAACTCAAATTGCAGAGAAGAAGAGAAAGCATTATCTACAAAGATTTGAG  960
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659781  TGGCCTGTCCTAACTCAAATTGCAGAGAAGAAGAGAAAGCATTATCTACAAAGATTTGAG  1659840

Query  961      AAGTTCGGaaaaaaaGTTGGACTGAGTGAATATGATTTAAGAGGTGACCACGATGAGTTG  1020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659841  AAGTTCGGAAAAAAAGTTGGACTGAGTGAATATGATTTAAGAGGTGACCACGATGAGTTG  1659900

Query  1021     AAATTCCCAATCAACTAA  1038
                ||||||||||||||||||
Sbjct  1659901  AAATTCCCAATCAACTAA  1659918



Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.28    0.460    0.850 

Effective search space used: 41703036102


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5
Query
>query
ATGTTCAGAAGAAAGCAAAAGGTTGAAGAAAAAGTTGACACTAGCAAATGGGTAAAGATCGAGGTTCCGATCGAATCACCTCCAGACGCAGTGAAACACCCTGAACCAATCGTTTTAGAAGACGAACAATTGAAGAAATATAACACTGTATTTTCACATTTCACTGATACTGATTTACTAATTCCAACTAAAGAGAAAAAAAATCATAGTGACAATGAGATGAAACCATTGACTGATTTGGAAAAAGCTTGGTTGAGTAGAGAATGTTTTATGAGATATTTAAGGGCCACCAAGTGGAATACGCAAGATTGTATCGATAGAATTGTACTCTCTCTTGCTTGGAGAAGAGAATTTGGAATAAGTAGTTTTGGAGAAGAAAATGGTGATTTGCTAACTGCTGACACTGTATCACCGGAGGCTCTGACTGGGAAGGAAGTTGTTTTGGGTTTCGATAACGATTCAAGGCCTATATTGTACTTAAAGCCTGGTAGGCAAAACACAGCAACCTCCCATAGACAAGTCCAGCACCTTGTATATATGCTTGAACGTGTTATTGATTTCATGCCTCCTGGGCAAGATTCATTGGCTTTGTTGATAGATTTCAAAGATTATCCTGATGTTCCAAAGGTTCAAGGTAACTCAAAGATTCCTCCTTTAGGGACCGGTAAAGAGGTTTTACACATTTTACAAACACATTATCCAGAAAGATTAGGGAAAGCATTATTAACTAATATCCCGTGGCTTGCGTGGACCTTTTTGAAGCTCATCCATCCTTTTATTGATCCGTTGACTCGTGAAAAATTGGTTTTTGATGAACCATTTCCAAATTATGTGCCACCTGATCAACTCGAGACGCTTTATGGTGGTAACCTCGACTTCAAATATAATCATGAAGCCTATTGGCCTGTCCTAACTCAAATTGCAGAGAAGAAGAGAAAGCATTATCTACAAAGATTTGAGAAGTTCGGAAAAAAAGTTGGACTGAGTGAATATGATTTAAGAGGTGACCACGATGAGTTGAAATTCCCAATCAACTAA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)