blastn task: ncRNA

Status
finished finished
Modified 2014-05-16T13:18:46Z
CPU time (s) 189.1
Size (bytes) 11691
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna yeast.nt nt' -num_alignments 250 -evalue 10.0 -task dc-megablast
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis;
Kluyveromyces lactis NRRL Y-1140; Saccharomyces cerevisiae; All
GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental
samples or phase 0, 1 or 2 HTGS sequences)
           15,120,236 sequences; 39,156,405,517 total letters



Query= query

Length=345
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

tpg|BK006937.2|  TPA: TPA_inf: Saccharomyces cerevisiae S288c chr...   623    3e-175
emb|FN393062.1|  Saccharomyces cerevisiae EC1118 chromosome III, ...   623    3e-175
emb|X59720.2|  S.cerevisiae chromosome III complete DNA sequence       623    3e-175
  gi|6319780|ref|NC_001135.1| Saccharomyces cerevisiae chromosome...   614    1e-172


>tpg|BK006937.2| TPA_inf: Saccharomyces cerevisiae S288c chromosome III, complete 
sequence
Length=316620

 Score =  623 bits (690),  Expect = 3e-175
 Identities = 345/345 (100%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176946  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  176887

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176886  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  176827

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176826  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  176767

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176766  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  176707

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176706  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  176647

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176646  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  176602


>emb|FN393062.1| Saccharomyces cerevisiae EC1118 chromosome III, EC1118_1C17 genomic 
scaffold, whole genome shotgun sequence
Length=291998

 Score =  623 bits (690),  Expect = 3e-175
 Identities = 345/345 (100%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  164001  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  163942

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163941  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  163882

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163881  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  163822

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163821  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  163762

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163761  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  163702

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163701  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  163657


>emb|X59720.2| S.cerevisiae chromosome III complete DNA sequence
Length=316613

 Score =  623 bits (690),  Expect = 3e-175
 Identities = 345/345 (100%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176938  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  176879

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176878  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  176819

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176818  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  176759

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176758  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  176699

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176698  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  176639

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176638  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  176594


> gi|6319780|ref|NC_001135.1| Saccharomyces cerevisiae chromosome 
III, complete chromosome sequence
Length=315339

 Score =  614 bits (680),  Expect = 1e-172
 Identities = 343/345 (99%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175671  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  175612

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
Sbjct  175611  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCACGTTACGCATTCACAGTCAGGT  175552

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175551  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  175492

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175491  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  175432

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175431  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  175372

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175371  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  175327



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 11974431149670


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7

  Database: Saccharomyces cerevisiae
    Posted date:  Jul 14, 2011  9:42 PM
  Number of letters in database: 12,155,026
  Number of sequences in database:  17

  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Nov 30, 2011  4:13 AM
  Number of letters in database: 39,074,138,929
  Number of sequences in database:  15,099,719



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Window for multiple hits: 40
Query
>query
ttagggttgagtggggagtaaagaataaagcgaatcctattcgtgtaagccggtctacttattgataacaatattttacaggcggctatcatgtttcagcttacgcattcacagtcaggttggtgctctacatgaataccagcgtttactttcatttacagagtactagcacctccactgtcgctaatactgaatttagttttgaagagtgaaaacaactaaatcaggcggtagaagaaaatcaatagctcatatattcttatatattacaggtgatatttgtatatgattatgaatggcttttcgtagcccgtgatctttcatttctatattatgtgtagctaa
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)