blastn task: [no title]

Status
finished finished
Modified 2013-11-14T12:44:28Z
CPU time (s) 0.1
Size (bytes) 14166
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_lactis_Y-1140.fna' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces aestuarii ATCC
18862 AEAS00000000_1; Kluyveromyces wickerhamii UCD 54 210
AEAV00000000_1; Kluyveromyces lactis NRRL Y-1140
           854 sequences; 41,189,204 total letters



Query= query

Length=386
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...   697    0.0  
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...   697    0.0  
  gsASS001Lm                                                          98.7    3e-20
  AEAV01000312  Kluyveromyces wickerhamii UCD 54-210 contig00323,...  35.6    0.29 
  AEAS01000008  Kluyveromyces aestuarii ATCC 18862 contig00009, w...  35.6    0.29 
  AEAV01000091  Kluyveromyces wickerhamii UCD 54-210 contig00095,...  33.7    1.0  
  gsASS001Lm                                                          33.7    1.0  
  AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, w...  33.7    1.0  
  AEAV01000084  Kluyveromyces wickerhamii UCD 54-210 contig00088,...  31.9    3.6  
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    3.6  
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    3.6  
  AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, w...  31.9    3.6  
  AEAS01000157  Kluyveromyces aestuarii ATCC 18862 contig00168, w...  31.9    3.6  
  AEAS01000107  Kluyveromyces aestuarii ATCC 18862 contig00112, w...  31.9    3.6  
  AEAS01000070  Kluyveromyces aestuarii ATCC 18862 contig00074, w...  31.9    3.6  


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score =  697 bits (772),  Expect = 0.0
 Identities = 386/386 (100%), Gaps = 0/386 (0%)
 Strand=Plus/Minus

Query  1       GTATACATCAAAATTCAGTGAATTTAATTCTGTCGTTTGAAACCAGTTTAGGTGAAATTG  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  281198  GTATACATCAAAATTCAGTGAATTTAATTCTGTCGTTTGAAACCAGTTTAGGTGAAATTG  281139

Query  61      GATTAGGTGGTGAATTGATACATAGTAAATAATTACTGGTCCATAATTTTTGTGAATATT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  281138  GATTAGGTGGTGAATTGATACATAGTAAATAATTACTGGTCCATAATTTTTGTGAATATT  281079

Query  121     TATGCTCTTTATACTATGTAGTTTTTATCCTGAATATTAACGATTGCTCACCTAAATTTC  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  281078  TATGCTCTTTATACTATGTAGTTTTTATCCTGAATATTAACGATTGCTCACCTAAATTTC  281019

Query  181     TCGTTTAAAATCCCTATAATGTGAATGGTTTTAGATGATTCATGGTGTTTTTATTAGTGA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  281018  TCGTTTAAAATCCCTATAATGTGAATGGTTTTAGATGATTCATGGTGTTTTTATTAGTGA  280959

Query  241     CCGAAATGTTTAGTTTTGGATACTTGATGATAGAATAAAGAGAAGTGTTATGTAAAAAGT  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  280958  CCGAAATGTTTAGTTTTGGATACTTGATGATAGAATAAAGAGAAGTGTTATGTAAAAAGT  280899

Query  301     GTTAATTCATGTTAAATTCACTACCTTCTTGAGATTCAATTCACACCATTTGATGGTGAA  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  280898  GTTAATTCATGTTAAATTCACTACCTTCTTGAGATTCAATTCACACCATTTGATGGTGAA  280839

Query  361     TATATCCATCTTAATCAGACGTATAC  386
               ||||||||||||||||||||||||||
Sbjct  280838  TATATCCATCTTAATCAGACGTATAC  280813


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score =  697 bits (772),  Expect = 0.0
 Identities = 386/386 (100%), Gaps = 0/386 (0%)
 Strand=Plus/Minus

Query  1        GTATACATCAAAATTCAGTGAATTTAATTCTGTCGTTTGAAACCAGTTTAGGTGAAATTG  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1279951  GTATACATCAAAATTCAGTGAATTTAATTCTGTCGTTTGAAACCAGTTTAGGTGAAATTG  1279892

Query  61       GATTAGGTGGTGAATTGATACATAGTAAATAATTACTGGTCCATAATTTTTGTGAATATT  120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1279891  GATTAGGTGGTGAATTGATACATAGTAAATAATTACTGGTCCATAATTTTTGTGAATATT  1279832

Query  121      TATGCTCTTTATACTATGTAGTTTTTATCCTGAATATTAACGATTGCTCACCTAAATTTC  180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1279831  TATGCTCTTTATACTATGTAGTTTTTATCCTGAATATTAACGATTGCTCACCTAAATTTC  1279772

Query  181      TCGTTTAAAATCCCTATAATGTGAATGGTTTTAGATGATTCATGGTGTTTTTATTAGTGA  240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1279771  TCGTTTAAAATCCCTATAATGTGAATGGTTTTAGATGATTCATGGTGTTTTTATTAGTGA  1279712

Query  241      CCGAAATGTTTAGTTTTGGATACTTGATGATAGAATAAAGAGAAGTGTTATGTAAAAAGT  300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1279711  CCGAAATGTTTAGTTTTGGATACTTGATGATAGAATAAAGAGAAGTGTTATGTAAAAAGT  1279652

Query  301      GTTAATTCATGTTAAATTCACTACCTTCTTGAGATTCAATTCACACCATTTGATGGTGAA  360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1279651  GTTAATTCATGTTAAATTCACTACCTTCTTGAGATTCAATTCACACCATTTGATGGTGAA  1279592

Query  361      TATATCCATCTTAATCAGACGTATAC  386
                ||||||||||||||||||||||||||
Sbjct  1279591  TATATCCATCTTAATCAGACGTATAC  1279566


 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  356     GTGAATATATCCATCTTAATCAGAC  380
               ||| |||||| ||||||||||| ||
Sbjct  736387  GTGTATATATACATCTTAATCATAC  736363


> gsASS001Lm
Length=10741898

 Score = 98.7 bits (108),  Expect = 3e-20
 Identities = 77/92 (84%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  295      AAAAGTGTTAATTCATGTTAAATTCACTACCTTCTTGAGATTCAATTCACACCATTTGAT  354
                ||||||||||||||  ||  ||||||| | |||||||||| |||||||||  || |||| 
Sbjct  2404625  AAAAGTGTTAATTCTGGTAGAATTCACCAACTTCTTGAGAGTCAATTCACTACAATTGAA  2404566

Query  355      GGTGAATATATCCATCTTAATCAGACGTATAC  386
                |||||||| ||||| || ||||||| ||||||
Sbjct  2404565  GGTGAATACATCCACCTAAATCAGATGTATAC  2404534


 Score = 33.7 bits (36),  Expect = 1.0
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  209      TTTTAGATGATTCATGGTGTTTT  231
                ||||||||||||  |||||||||
Sbjct  2928745  TTTTAGATGATTATTGGTGTTTT  2928767


 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  47       TTTAGGTGAAATTGGATTAGGTGGT  71
                ||| |||| ||||||||||||| ||
Sbjct  4472718  TTTCGGTGTAATTGGATTAGGTAGT  4472694


 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  296      AAAGTGTTAATTCATGTTAAAT  317
                |||||||||||||||| || ||
Sbjct  5613956  AAAGTGTTAATTCATGATATAT  5613935


 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  14        TTCAGTGAATTTAATTC  30
                 |||||||||||||||||
Sbjct  10687026  TTCAGTGAATTTAATTC  10687010


> AEAV01000312  Kluyveromyces wickerhamii UCD 54-210 contig00323, 
whole genome shotgun sequence
Length=9620

 Score = 35.6 bits (38),  Expect = 0.29
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  243   GAAATGTTTAGTTTTGGAT  261
             |||||||||||||||||||
Sbjct  1547  GAAATGTTTAGTTTTGGAT  1565


> AEAS01000008  Kluyveromyces aestuarii ATCC 18862 contig00009, 
whole genome shotgun sequence
Length=24386

 Score = 35.6 bits (38),  Expect = 0.29
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  15     TCAGTGAATTTAATTCTGTCGTTT  38
              ||||| |||||| |||||||||||
Sbjct  23629  TCAGTAAATTTATTTCTGTCGTTT  23606


> AEAV01000091  Kluyveromyces wickerhamii UCD 54-210 contig00095, 
whole genome shotgun sequence
Length=131328

 Score = 33.7 bits (36),  Expect = 1.0
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  213    AGATGATTCATGGTGTTT  230
              ||||||||||||||||||
Sbjct  29345  AGATGATTCATGGTGTTT  29362


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 33.7 bits (36),  Expect = 1.0
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  338    AATTCACACCATTTGATGGTGAA  360
              ||||||||||| |||||||| ||
Sbjct  61795  AATTCACACCAGTTGATGGTAAA  61773


> AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, 
whole genome shotgun sequence
Length=148475

 Score = 33.7 bits (36),  Expect = 1.0
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  103     ATAATTTTTGTGAATATT  120
               ||||||||||||||||||
Sbjct  136955  ATAATTTTTGTGAATATT  136938


> AEAV01000084  Kluyveromyces wickerhamii UCD 54-210 contig00088, 
whole genome shotgun sequence
Length=61206

 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  210    TTTAGATGATTCATGGTGTT  229
              ||||||||||||||| ||||
Sbjct  30822  TTTAGATGATTCATGCTGTT  30841


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  267     ATGATAGAATAAAGAGA  283
               |||||||||||||||||
Sbjct  362382  ATGATAGAATAAAGAGA  362398


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  276      TAAAGAGAAGTGTTATGTAAAA  297
                |||||| |||||||||||| ||
Sbjct  1458544  TAAAGATAAGTGTTATGTATAA  1458523


> AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, 
whole genome shotgun sequence
Length=84350

 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  263    CTTGATGATAGAATAAA  279
              |||||||||||||||||
Sbjct  59849  CTTGATGATAGAATAAA  59833


> AEAS01000157  Kluyveromyces aestuarii ATCC 18862 contig00168, 
whole genome shotgun sequence
Length=59600

 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  132    TACTATGTAGTTTTTATCCTGAATA  156
              ||||| |||||||||||  ||||||
Sbjct  12253  TACTACGTAGTTTTTATAATGAATA  12277


> AEAS01000107  Kluyveromyces aestuarii ATCC 18862 contig00112, 
whole genome shotgun sequence
Length=30873

 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  102   CATAATTTTTGTGAATATTT  121
             ||||||||||||| ||||||
Sbjct  2034  CATAATTTTTGTGTATATTT  2053


> AEAS01000070  Kluyveromyces aestuarii ATCC 18862 contig00074, 
whole genome shotgun sequence
Length=47226

 Score = 31.9 bits (34),  Expect = 3.6
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  102   CATAATTTTTGTGAATA  118
             |||||||||||||||||
Sbjct  9789  CATAATTTTTGTGAATA  9805



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 14820120000


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GTATACATCAAAATTCAGTGAATTTAATT
                                                                       CTGTCGTTTGAAACCAGTTTAGGTGAAATTGGATTAGGTGGTGAATTGATACATAGTAAA
                                                                       TAATTACTGGTCCATAATTTTTGTGAATATTTATGCTCTTTATACTATGTAGTTTTTATC
                                                                       CTGAATATTAACGATTGCTCACCTAAATTTCTCGTTTAAAATCCCTATAATGTGAATGGT
                                                                       TTTAGATGATTCATGGTGTTTTTATTAGTGACCGAAATGTTTAGTTTTGGATACTTGATG
                                                                       ATAGAATAAAGAGAAGTGTTATGTAAAAAGTGTTAATTCATGTTAAATTCACTACCTTCT
                                                                       TGAGATTCAATTCACACCATTTGATGGTGAATATATCCATCTTAATCAGACGTATAC
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)