blastn task: [no title]

Status
finished finished
Modified 2016-05-16T11:35:26Z
CPU time (s) 0.2
Size (bytes) 59272
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna yeast.nt' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis;
Kluyveromyces lactis NRRL Y-1140; Saccharomyces cerevisiae
           20,517 sequences; 82,266,588 total letters



Query= 
Length=864
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gsASS001Lm                                                          1153    0.0  
  KLDOg3120                                                           1151    0.0  
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  1117    0.0  
  KLLA0E17667g KLLA0E17667g undefined product 7422137:7423120 rev...  1117    0.0  
  AEAV01000156  Kluyveromyces wickerhamii UCD 54-210 contig00162,...   946    0.0  
  KLWIg3182 KLWIg3182 undefined product 6446439:6447299 reverse        940    0.0  
  AEAS01000027  Kluyveromyces aestuarii ATCC 18862 contig00029, w...   879    0.0  
  KLAEg1509 KLAEg1509 undefined product 3190149:3191006 reverse        877    0.0  
  gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome...   854    0.0  
  KLLA0E11089g KLLA0E11089g undefined product 6827961:6828854 rev...  95.1    2e-18
  gi|6323501|ref|NC_001145.1| Saccharomyces cerevisiae chromosome...  87.8    2e-16
  AEAS01000044  Kluyveromyces aestuarii ATCC 18862 contig00046, w...  53.6    5e-06
  KLAEg2681.t2 KLAEg2681.t2 undefined product 5657667:5661585 rev...  53.6    5e-06
  KLAEg2681.t1 KLAEg2681.t1 undefined product 5657667:5661585 rev...  53.6    5e-06
  gi|6322960|ref|NC_001144.1| Saccharomyces cerevisiae chromosome...  37.4    0.39 
  AEAV01000047  Kluyveromyces wickerhamii UCD 54-210 contig00050,...  35.6    1.4  
  KLWIg9 KLWIg9 undefined product 17111:18739 reverse                 35.6    1.4  
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    1.4  
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    1.4  
  KLLA0D07579g KLLA0D07579g undefined product 4789299:4789592 for...  35.6    1.4  
  AEAS01000097  Kluyveromyces aestuarii ATCC 18862 contig00102, w...  35.6    1.4  
  gi|6322623|ref|NC_001143.1| Saccharomyces cerevisiae chromosome...  33.7    4.7  
  gi|6322016|ref|NC_001141.1| Saccharomyces cerevisiae chromosome...  33.7    4.7  
  KLWIg9 KLWIg9 undefined product 17111:18739 reverse                 33.7    4.7  
  gi|6319247|ref|NC_001133.1| Saccharomyces cerevisiae chromosome...  33.7    4.7  
  AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213,...  33.7    4.7  
  KLWIg455 KLWIg455 undefined product 948663:958466 forward           33.7    4.7  
  gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome...  33.7    4.7  
  KLLA0E20857g KLLA0E20857g undefined product 7713404:7715536 for...  33.7    4.7  
  KLLA0C05588g KLLA0C05588g undefined product 2884046:2885602 for...  33.7    4.7  
  KLLA0C01386g KLLA0C01386g undefined product 2489236:2490123 for...  33.7    4.7  


> gsASS001Lm
Length=10741898

 Score = 1153 bits (1278),  Expect = 0.0
 Identities = 770/857 (90%), Gaps = 0/857 (0%)
 Strand=Plus/Minus

Query  6        TTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAA  65
                ||||||  |||||||| | ||||| |||||||| ||||||||||  ||||||||||||||
Sbjct  6794805  TTACACAGCCAGACAAGTTGGTGCTAAGAACACTTTGGACTACAGGGTTTTCATCGAAAA  6794746

Query  66       GGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGG  125
                |||||| |||||||| ||||| |||||||||||||||||||||||||| || ||||| ||
Sbjct  6794745  GGATGGTAAGCCAGTTTCTGCTTTCCACGACATCCCATTGTACGCTGATGAGGCCAACGG  6794686

Query  126      TATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAA  185
                 |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct  6794685  GATCTTCAACATGGTCGTTGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAA  6794626

Query  186      GGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAG  245
                ||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct  6794625  GGAGGAGAAATTGAACCCAATTATCCAGGACACCAAGAAGGGTAAGCTAAGATTTGTGAG  6794566

Query  246      AAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGA  305
                |||||||||||||||||| |||||||| |||||||||||||| ||||| || ||||||||
Sbjct  6794565  AAACTGTTTCCCACACCATGGTTACATTCACAACTACGGTGCTTTCCCTCAGACCTGGGA  6794506

Query  306      AGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
                ||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct  6794505  AGACCCTAACGAGGCTCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGACGT  6794446

Query  366      GTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
                ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||
Sbjct  6794445  GTTGGAAATCGGTGAGCAAGTTGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  6794386

Query  426      TGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAA  485
                ||||||||| |||||||||||||| ||||||||||||||||||||||  |||||||||||
Sbjct  6794385  TGTGATGGCTTTGTTGGACGAAGGGGAGACCGACTGGAAGGTGATTGCCATCGACATCAA  6794326

Query  486      CGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTT  545
                ||| |||||||| || |||||||||||||| || |||||||| |||||| ||||||||||
Sbjct  6794325  CGACCCATTGGCTCCTAAGTTGAACGACATCGAAGATGTCGAAAAGCACCTGCCAGGTTT  6794266

Query  546      GCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAA  605
                | | |||||||| |||||||||||||||||||||||||| || |||||||||||||| ||
Sbjct  6794265  GTTGAGAGCCACCAACGAATGGTTCAGAATCTACAAGATCCCTGACGGTAAGCCAGAGAA  6794206

Query  606      CCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGA  665
                 |||||||| ||||| ||||| |||||||||||||||||| || | ||||| ||||| ||
Sbjct  6794205  TCAATTTGCTTTCTCCGGTGAGGCCAAGAACAAGAAGTACACTTTGGAAGTCATCAGAGA  6794146

Query  666      GTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGA  725
                |   |||||||| |||||||||||||| ||||| ||| || | ||||| |||||||||||
Sbjct  6794145  GACCAACGAAGCCTGGAAGAAGTTGATCTCCGGCAAGGCTTCCGACGCCAAGAAGATCGA  6794086

Query  726      TTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGT  785
                ||||||||||||||| |||| ||| ||  | ||||||||||| || || ||  |||||||
Sbjct  6794085  TTTGACCAACACCACTTTGGCCGAGACCCCAACTTACTCTGCTGAAGCTGCCTCTGCTGT  6794026

Query  786      TCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
                |||| | ||  ||||||||||||||||  |||||||||||||||| ||||||||||||||
Sbjct  6794025  TCCAGCTGCTAACGTCTTGCCAGACGAAGCAATCGACAAGTCCATCGACAAGTGGTTCTT  6793966

Query  846      CATCTCCGGTTCTGCTT  862
                |||||| ||||| ||||
Sbjct  6793965  CATCTCTGGTTCCGCTT  6793949


> KLDOg3120
Length=861

 Score = 1151 bits (1276),  Expect = 0.0
 Identities = 769/856 (90%), Gaps = 0/856 (0%)
 Strand=Plus/Plus

Query  6    TTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAA  65
            ||||||  |||||||| | ||||| |||||||| ||||||||||  ||||||||||||||
Sbjct  6    TTACACAGCCAGACAAGTTGGTGCTAAGAACACTTTGGACTACAGGGTTTTCATCGAAAA  65

Query  66   GGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGG  125
            |||||| |||||||| ||||| |||||||||||||||||||||||||| || ||||| ||
Sbjct  66   GGATGGTAAGCCAGTTTCTGCTTTCCACGACATCCCATTGTACGCTGATGAGGCCAACGG  125

Query  126  TATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAA  185
             |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct  126  GATCTTCAACATGGTCGTTGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAA  185

Query  186  GGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAG  245
            ||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct  186  GGAGGAGAAATTGAACCCAATTATCCAGGACACCAAGAAGGGTAAGCTAAGATTTGTGAG  245

Query  246  AAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGA  305
            |||||||||||||||||| |||||||| |||||||||||||| ||||| || ||||||||
Sbjct  246  AAACTGTTTCCCACACCATGGTTACATTCACAACTACGGTGCTTTCCCTCAGACCTGGGA  305

Query  306  AGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
            ||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct  306  AGACCCTAACGAGGCTCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGACGT  365

Query  366  GTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
            ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||
Sbjct  366  GTTGGAAATCGGTGAGCAAGTTGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425

Query  426  TGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAA  485
            ||||||||| |||||||||||||| ||||||||||||||||||||||  |||||||||||
Sbjct  426  TGTGATGGCTTTGTTGGACGAAGGGGAGACCGACTGGAAGGTGATTGCCATCGACATCAA  485

Query  486  CGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTT  545
            ||| |||||||| || |||||||||||||| || |||||||| |||||| ||||||||||
Sbjct  486  CGACCCATTGGCTCCTAAGTTGAACGACATCGAAGATGTCGAAAAGCACCTGCCAGGTTT  545

Query  546  GCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAA  605
            | | |||||||| |||||||||||||||||||||||||| || |||||||||||||| ||
Sbjct  546  GTTGAGAGCCACCAACGAATGGTTCAGAATCTACAAGATCCCTGACGGTAAGCCAGAGAA  605

Query  606  CCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGA  665
             |||||||| ||||| ||||| |||||||||||||||||| || | ||||| ||||| ||
Sbjct  606  TCAATTTGCTTTCTCCGGTGAGGCCAAGAACAAGAAGTACACTTTGGAAGTCATCAGAGA  665

Query  666  GTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGA  725
            |   |||||||| |||||||||||||| ||||| ||| || | ||||| |||||||||||
Sbjct  666  GACCAACGAAGCCTGGAAGAAGTTGATCTCCGGCAAGGCTTCCGACGCCAAGAAGATCGA  725

Query  726  TTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGT  785
            ||||||||||||||| |||| ||| ||  | ||||||||||| || || ||  |||||||
Sbjct  726  TTTGACCAACACCACTTTGGCCGAGACCCCAACTTACTCTGCTGAAGCTGCCTCTGCTGT  785

Query  786  TCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
            |||| | ||  ||||||||||||||||  |||||||||||||||| ||||||||||||||
Sbjct  786  TCCAGCTGCTAACGTCTTGCCAGACGAAGCAATCGACAAGTCCATCGACAAGTGGTTCTT  845

Query  846  CATCTCCGGTTCTGCT  861
            |||||| ||||| |||
Sbjct  846  CATCTCTGGTTCCGCT  861


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 1117 bits (1238),  Expect = 0.0
 Identities = 762/857 (89%), Gaps = 0/857 (0%)
 Strand=Plus/Minus

Query  6        TTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAA  65
                ||||||||| |||||| | |||||||||||  ||||||| ||||| |||| ||| |||||
Sbjct  1570108  TTACACTACTAGACAAGTTGGTGCCAAGAATTCCTTGGATTACAAGGTTTACATTGAAAA  1570049

Query  66       GGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGG  125
                |||||| |||||| | ||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct  1570048  GGATGGTAAGCCAATTTCTGCTTTCCACGACATCCCATTGTATGCTGATGAAGCCAATGG  1569989

Query  126      TATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAA  185
                |||||||||||||||||| ||||| |||||||||||||| |||||||||||||| |||||
Sbjct  1569988  TATCTTCAACATGGTTGTTGAAATTCCACGTTGGACCAATGCCAAGTTGGAAATTACCAA  1569929

Query  186      GGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAG  245
                ||| |||   ||||||||||| || ||||||||||||||||||||| |||||||||| ||
Sbjct  1569928  GGAAGAGCCATTGAACCCAATTATTCAAGACACCAAGAAGGGTAAGTTAAGATTTGTTAG  1569869

Query  246      AAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGA  305
                ||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||
Sbjct  1569868  AAACTGTTTCCCACATCACGGTTACATTCACAACTACGGTGCCTTCCCACAAACATGGGA  1569809

Query  306      AGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
                |||||| ||||| || |||||||| || ||||||||||||||||||||||||||||||||
Sbjct  1569808  AGATCCAAACGAATCTCACCCAGAGACTAAGGCTGTTGGTGACAACGATCCATTGGATGT  1569749

Query  366      GTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
                 |||||||||||||| ||||| || ||||||||||||||||| |||||||||||||||||
Sbjct  1569748  CTTGGAAATCGGTGAGCAAGTTGCTTACACTGGTCAAGTGAAACAAGTCAAGGTTCTTGG  1569689

Query  426      TGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAA  485
                ||| ||||| ||||||||||||||||| || ||||||||||| ||||  ||||| || ||
Sbjct  1569688  TGTTATGGCATTGTTGGACGAAGGTGAAACTGACTGGAAGGTCATTGCCATCGATATTAA  1569629

Query  486      CGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTT  545
                |||||||||||| || |||||||||||||| || ||||| || ||||| || ||||||||
Sbjct  1569628  CGATCCATTGGCTCCTAAGTTGAACGACATCGAAGATGTTGAAAAGCATTTACCAGGTTT  1569569

Query  546      GCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAA  605
                | | |||||||| || ||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct  1569568  GTTGAGAGCCACCAATGAATGGTTCAGAATCTACAAGATCCCAGATGGTAAGCCAGAAAA  1569509

Query  606      CCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGA  665
                ||||||||||||||| |||||||||||||||||||||||| |  | || || ||||| ||
Sbjct  1569508  CCAATTTGCCTTCTCCGGTGAAGCCAAGAACAAGAAGTACACCTTGGACGTCATCAGAGA  1569449

Query  666      GTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGA  725
                 ||||||||||| ||||||||||||||||| |||||||||||||| || |||||||||||
Sbjct  1569448  ATGTAACGAAGCCTGGAAGAAGTTGATTTCTGGTAAGTCTGCTGATGCCAAGAAGATCGA  1569389

Query  726      TTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGT  785
                 ||||| |||||||| |||   |||||||| |||||||| ||||| || ||  |||||||
Sbjct  1569388  CTTGACTAACACCACTTTGTCTGACACTGCTACTTACTCAGCCGAAGCTGCCTCTGCTGT  1569329

Query  786      TCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
                |||| | ||  ||||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct  1569328  TCCAGCTGCTAACGTCTTGCCAGATGAACCAATCGACAAGTCCATTGACAAATGGTTCTT  1569269

Query  846      CATCTCCGGTTCTGCTT  862
                |||||||||||||||||
Sbjct  1569268  CATCTCCGGTTCTGCTT  1569252


 Score = 95.1 bits (104),  Expect = 2e-18
 Identities = 310/468 (67%), Gaps = 29/468 (6%)
 Strand=Plus/Minus

Query  133     AACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAG  192
               |||||| | || ||  | ||||||||||  || |  ||||| |||||||  |||   || 
Sbjct  975769  AACATGATCGTAGAGGTTCCACGTTGGAGTAATGGGAAGTTTGAAATCAGTAAGACCGAA  975710

Query  193     AAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAACTGT  252
                  || ||||| ||||  || ||||  ||||| || |||| | ||||||| |  |||  |
Sbjct  975709  CCATTTAACCCCATCACACAGGACATAAAGAAAGGCAAGCCACGATTTGTCAATAACATT  975650

Query  253     TTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCC-  311
               |||||  |||| || ||||| || ||||| || ||  ||||||| || |||||| | || 
Sbjct  975649  TTCCCTTACCATGGATACATTCATAACTATGGGGCTATCCCACAGACATGGGAACAGCCA  975590

Query  312     --TAACGA-GTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTGTT  368
                 ||  || ||    ||| |   | ||||      |||| || || ||||||||  ||||
Sbjct  975589  CTTATTGAAGTATTGCCCGGTTTC-AAGG------GTGATAATGACCCATTGGAC-TGTT  975538

Query  369     G-GAAATCGGTGAACAAG--TCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
               | ||||| |||   | ||  ||||  | |  ||  |  | ||  |||| ||| |||| ||
Sbjct  975537  GTGAAATTGGTT--CCAGCATCGCCAAAATGGGAGATATCAAAAAAGTAAAGCTTCTAGG  975480

Query  426     TGTGATG-GCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCA  484
                || ||  ||| |  | ||||| || ||   ||| ||||| || |||   ||||||||  
Sbjct  975479  -GTCATTAGCCCTCATTGACGATGGAGAACTCGATTGGAAAGTCATTTGTATCGACATTG  975421

Query  485     ACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACT----TGCCA  540
               | |||||  | ||   ||| |||||| |  | |  ||||| ||    ||||    |||| 
Sbjct  975420  AAGATCCCATTGCTATAAAATTGAACAAGTTGGCAGATGTAGA----CACTGTTATGCCT  975365

Query  541     GGTTTGCTAAGA-GCCACTAACGAATGGTTCAGAATCTACAAGATTCC  587
               ||| | ||  || || ||||    ||||||||||   |||||||||||
Sbjct  975364  GGTCT-CTTGGATGCAACTAGAACATGGTTCAGAGATTACAAGATTCC  975318


 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  766      GCCGAGGCAGCTGCTGCTGTT  786
                || ||||||||||||||||||
Sbjct  1860677  GCAGAGGCAGCTGCTGCTGTT  1860657


> KLLA0E17667g KLLA0E17667g undefined product 7422137:7423120 reverse
Length=984

 Score = 1117 bits (1238),  Expect = 0.0
 Identities = 762/857 (89%), Gaps = 0/857 (0%)
 Strand=Plus/Plus

Query  6    TTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAA  65
            ||||||||| |||||| | |||||||||||  ||||||| ||||| |||| ||| |||||
Sbjct  126  TTACACTACTAGACAAGTTGGTGCCAAGAATTCCTTGGATTACAAGGTTTACATTGAAAA  185

Query  66   GGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGG  125
            |||||| |||||| | ||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct  186  GGATGGTAAGCCAATTTCTGCTTTCCACGACATCCCATTGTATGCTGATGAAGCCAATGG  245

Query  126  TATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAA  185
            |||||||||||||||||| ||||| |||||||||||||| |||||||||||||| |||||
Sbjct  246  TATCTTCAACATGGTTGTTGAAATTCCACGTTGGACCAATGCCAAGTTGGAAATTACCAA  305

Query  186  GGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAG  245
            ||| |||   ||||||||||| || ||||||||||||||||||||| |||||||||| ||
Sbjct  306  GGAAGAGCCATTGAACCCAATTATTCAAGACACCAAGAAGGGTAAGTTAAGATTTGTTAG  365

Query  246  AAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGA  305
            ||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||
Sbjct  366  AAACTGTTTCCCACATCACGGTTACATTCACAACTACGGTGCCTTCCCACAAACATGGGA  425

Query  306  AGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
            |||||| ||||| || |||||||| || ||||||||||||||||||||||||||||||||
Sbjct  426  AGATCCAAACGAATCTCACCCAGAGACTAAGGCTGTTGGTGACAACGATCCATTGGATGT  485

Query  366  GTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
             |||||||||||||| ||||| || ||||||||||||||||| |||||||||||||||||
Sbjct  486  CTTGGAAATCGGTGAGCAAGTTGCTTACACTGGTCAAGTGAAACAAGTCAAGGTTCTTGG  545

Query  426  TGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAA  485
            ||| ||||| ||||||||||||||||| || ||||||||||| ||||  ||||| || ||
Sbjct  546  TGTTATGGCATTGTTGGACGAAGGTGAAACTGACTGGAAGGTCATTGCCATCGATATTAA  605

Query  486  CGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTT  545
            |||||||||||| || |||||||||||||| || ||||| || ||||| || ||||||||
Sbjct  606  CGATCCATTGGCTCCTAAGTTGAACGACATCGAAGATGTTGAAAAGCATTTACCAGGTTT  665

Query  546  GCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAA  605
            | | |||||||| || ||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct  666  GTTGAGAGCCACCAATGAATGGTTCAGAATCTACAAGATCCCAGATGGTAAGCCAGAAAA  725

Query  606  CCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGA  665
            ||||||||||||||| |||||||||||||||||||||||| |  | || || ||||| ||
Sbjct  726  CCAATTTGCCTTCTCCGGTGAAGCCAAGAACAAGAAGTACACCTTGGACGTCATCAGAGA  785

Query  666  GTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGA  725
             ||||||||||| ||||||||||||||||| |||||||||||||| || |||||||||||
Sbjct  786  ATGTAACGAAGCCTGGAAGAAGTTGATTTCTGGTAAGTCTGCTGATGCCAAGAAGATCGA  845

Query  726  TTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGT  785
             ||||| |||||||| |||   |||||||| |||||||| ||||| || ||  |||||||
Sbjct  846  CTTGACTAACACCACTTTGTCTGACACTGCTACTTACTCAGCCGAAGCTGCCTCTGCTGT  905

Query  786  TCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
            |||| | ||  ||||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct  906  TCCAGCTGCTAACGTCTTGCCAGATGAACCAATCGACAAGTCCATTGACAAATGGTTCTT  965

Query  846  CATCTCCGGTTCTGCTT  862
            |||||||||||||||||
Sbjct  966  CATCTCCGGTTCTGCTT  982


> AEAV01000156  Kluyveromyces wickerhamii UCD 54-210 contig00162, 
whole genome shotgun sequence
Length=71611

 Score =  946 bits (1048),  Expect = 0.0
 Identities = 728/864 (85%), Gaps = 0/864 (0%)
 Strand=Plus/Plus

Query  1      ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATC  60
              ||||||||  ||||||||||| | ||||||||||||||| | ||||||||||||||||||
Sbjct  69476  ATGTCTTATTCTACCAGACAAGTTGGTGCCAAGAACACCCTAGACTACAAAGTTTTCATC  69535

Query  61     GAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCC  120
              || |||||||| ||||| || || || ||||||||| | |||||||| |||||||| |||
Sbjct  69536  GAGAAGGATGGTAAGCCTGTTTCCGCTTTCCACGACGTTCCATTGTATGCTGACGAGGCC  69595

Query  121    AATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATC  180
              || || |||||||||||| |||| || || || ||||||||||| |||||||||||||| 
Sbjct  69596  AACGGGATCTTCAACATGATTGTAGAGATTCCTCGTTGGACCAATGCCAAGTTGGAAATT  69655

Query  181    ACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTT  240
              |||||||| || |  |||||||| |||||||| |||||||||||||| ||  | ||||| 
Sbjct  69656  ACCAAGGAAGAAACTTTGAACCCTATCATCCAGGACACCAAGAAGGGGAAATTGAGATTC  69715

Query  241    GTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACC  300
              ||||||||||||||||| |||||||| ||||| |||||||||||||| ||||| || || 
Sbjct  69716  GTGAGAAACTGTTTCCCTCACCACGGGTACATTCACAACTACGGTGCGTTCCCTCAGACA  69775

Query  301    TGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTG  360
              ||||| || ||||||||| | ||||| || || ||||| || || |||||||||||||||
Sbjct  69776  TGGGAGGACCCTAACGAGGCTCACCCGGAGACTAAGGCAGTCGGAGACAACGATCCATTG  69835

Query  361    GATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTT  420
              ||||||||||| |||||||| || || || ||||| || ||||| ||||| || || || 
Sbjct  69836  GATGTGTTGGAGATCGGTGAGCAGGTTGCGTACACCGGCCAAGTCAAGCAGGTGAAAGTG  69895

Query  421    CTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGAC  480
               | ||||||||||| ||||||||||| || ||||| |||||||||||||| | |||||||
Sbjct  69896  TTGGGTGTGATGGCATTGTTGGACGAGGGCGAGACTGACTGGAAGGTGATCGCGATCGAC  69955

Query  481    ATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCA  540
              ||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||
Sbjct  69956  ATCAACGATCCATTGGCGCCCAAGTTGAACGACATCGAGGATGTCGAGAAGCACTTGCCA  70015

Query  541    GGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCA  600
              || ||| | |||||||| |||||||||||||||||||||||||| || ||||| ||||| 
Sbjct  70016  GGCTTGTTGAGAGCCACGAACGAATGGTTCAGAATCTACAAGATCCCTGACGGCAAGCCG  70075

Query  601    GAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATC  660
              || ||||| || || || || || || |||||||||||||||||| |  | || || |||
Sbjct  70076  GAGAACCAGTTCGCGTTTTCAGGCGAGGCCAAGAACAAGAAGTACACCTTGGAGGTCATC  70135

Query  661    AGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAG  720
              || ||||||||||| || ||||||||| |||| || || |||||||| ||||| ||||||
Sbjct  70136  AGAGAGTGTAACGAGGCGTGGAAGAAGCTGATCTCGGGCAAGTCTGCGGACGCCAAGAAG  70195

Query  721    ATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCT  780
              ||||| ||||||||||| ||||||  ||||||  | || | |||||  |  || || || 
Sbjct  70196  ATCGACTTGACCAACACGACGTTGAGCGACACGCCAACGTTCTCTGTGGCCGCGGCCGCG  70255

Query  781    GCTGTTCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGG  840
              || || ||| | ||  |||| ||||| |||||||| ||||||||||| || |||||||||
Sbjct  70256  GCCGTGCCAGCTGCCAACGTGTTGCCCGACGAGCCGATCGACAAGTCGATCGACAAGTGG  70315

Query  841    TTCTTCATCTCCGGTTCTGCTTGA  864
              ||||| |||||||| |||||||||
Sbjct  70316  TTCTTTATCTCCGGCTCTGCTTGA  70339


> KLWIg3182 KLWIg3182 undefined product 6446439:6447299 reverse
Length=861

 Score =  940 bits (1042),  Expect = 0.0
 Identities = 725/861 (85%), Gaps = 0/861 (0%)
 Strand=Plus/Plus

Query  1    ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATC  60
            ||||||||  ||||||||||| | ||||||||||||||| | ||||||||||||||||||
Sbjct  1    ATGTCTTATTCTACCAGACAAGTTGGTGCCAAGAACACCCTAGACTACAAAGTTTTCATC  60

Query  61   GAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCC  120
            || |||||||| ||||| || || || ||||||||| | |||||||| |||||||| |||
Sbjct  61   GAGAAGGATGGTAAGCCTGTTTCCGCTTTCCACGACGTTCCATTGTATGCTGACGAGGCC  120

Query  121  AATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATC  180
            || || |||||||||||| |||| || || || ||||||||||| |||||||||||||| 
Sbjct  121  AACGGGATCTTCAACATGATTGTAGAGATTCCTCGTTGGACCAATGCCAAGTTGGAAATT  180

Query  181  ACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTT  240
            |||||||| || |  |||||||| |||||||| |||||||||||||| ||  | ||||| 
Sbjct  181  ACCAAGGAAGAAACTTTGAACCCTATCATCCAGGACACCAAGAAGGGGAAATTGAGATTC  240

Query  241  GTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACC  300
            ||||||||||||||||| |||||||| ||||| |||||||||||||| ||||| || || 
Sbjct  241  GTGAGAAACTGTTTCCCTCACCACGGGTACATTCACAACTACGGTGCGTTCCCTCAGACA  300

Query  301  TGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTG  360
            ||||| || ||||||||| | ||||| || || ||||| || || |||||||||||||||
Sbjct  301  TGGGAGGACCCTAACGAGGCTCACCCGGAGACTAAGGCAGTCGGAGACAACGATCCATTG  360

Query  361  GATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTT  420
            ||||||||||| |||||||| || || || ||||| || ||||| ||||| || || || 
Sbjct  361  GATGTGTTGGAGATCGGTGAGCAGGTTGCGTACACCGGCCAAGTCAAGCAGGTGAAAGTG  420

Query  421  CTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGAC  480
             | ||||||||||| ||||||||||| || ||||| |||||||||||||| | |||||||
Sbjct  421  TTGGGTGTGATGGCATTGTTGGACGAGGGCGAGACTGACTGGAAGGTGATCGCGATCGAC  480

Query  481  ATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCA  540
            ||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||
Sbjct  481  ATCAACGATCCATTGGCGCCCAAGTTGAACGACATCGAGGATGTCGAGAAGCACTTGCCA  540

Query  541  GGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCA  600
            || ||| | |||||||| |||||||||||||||||||||||||| || ||||| ||||| 
Sbjct  541  GGCTTGTTGAGAGCCACGAACGAATGGTTCAGAATCTACAAGATCCCTGACGGCAAGCCG  600

Query  601  GAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATC  660
            || ||||| || || || || || || |||||||||||||||||| |  | || || |||
Sbjct  601  GAGAACCAGTTCGCGTTTTCAGGCGAGGCCAAGAACAAGAAGTACACCTTGGAGGTCATC  660

Query  661  AGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAG  720
            || ||||||||||| || ||||||||| |||| || || |||||||| ||||| ||||||
Sbjct  661  AGAGAGTGTAACGAGGCGTGGAAGAAGCTGATCTCGGGCAAGTCTGCGGACGCCAAGAAG  720

Query  721  ATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCT  780
            ||||| ||||||||||| ||||||  ||||||  | || | |||||  |  || || || 
Sbjct  721  ATCGACTTGACCAACACGACGTTGAGCGACACGCCAACGTTCTCTGTGGCCGCGGCCGCG  780

Query  781  GCTGTTCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGG  840
            || || ||| | ||  |||| ||||| |||||||| ||||||||||| || |||||||||
Sbjct  781  GCCGTGCCAGCTGCCAACGTGTTGCCCGACGAGCCGATCGACAAGTCGATCGACAAGTGG  840

Query  841  TTCTTCATCTCCGGTTCTGCT  861
            ||||| |||||||| ||||||
Sbjct  841  TTCTTTATCTCCGGCTCTGCT  861


> AEAS01000027  Kluyveromyces aestuarii ATCC 18862 contig00029, 
whole genome shotgun sequence
Length=33180

 Score =  879 bits (974),  Expect = 0.0
 Identities = 711/857 (83%), Gaps = 5/857 (0%)
 Strand=Plus/Plus

Query  7      TACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAAG  66
              ||||| || |||||||| ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct  26567  TACACCACTAGACAAATTGGTGCTAAGAACACTTTGGACTACAAGGTCTTCATTGAAAAG  26626

Query  67     GATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGGT  126
              |||||||||   || ||| | ||||| ||||| ||||||||||| || || |||||||||
Sbjct  26627  GATGGCAAGGTTGTTTCTCCATTCCATGACATTCCATTGTACGCAGATGAGGCCAATGGT  26686

Query  127    ATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAG  186
              || || ||||||||||| ||||||||||||||||| || || ||||| |||||  | |||
Sbjct  26687  ATTTTTAACATGGTTGTTGAAATCCCACGTTGGACTAATGCTAAGTTAGAAATTTCTAAG  26746

Query  187    GAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGA  246
              || || |  ||||| || || || ||||||||||||||||||||| | ||||  || |||
Sbjct  26747  GAAGAAAGTTTGAATCCTATTATTCAAGACACCAAGAAGGGTAAGTTGAGATACGTCAGA  26806

Query  247    AACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAA  306
              ||||||||||| |||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct  26807  AACTGTTTCCCTCACCACGGTTACATTCACAACTACGGTGCTTTCCCACAAACTTGGGAA  26866

Query  307    GATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTG  366
              |||||||||||  | ||||||||||| ||||| | ||||||  |||||||| | ||||| 
Sbjct  26867  GATCCTAACGAAGCTCACCCAGAAACTAAGGCAGCTGGTGATGACGATCCACTAGATGTT  26926

Query  367    TTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGGT  426
              || ||||| ||||||||||| || |||||||||||| | || ||||| |||||| | |||
Sbjct  26927  TTAGAAATTGGTGAACAAGTTGCTTACACTGGTCAAATCAAACAAGTTAAGGTTTTGGGT  26986

Query  427    GTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAAC  486
              || ||||| |||||||| |||||||| || |||||||| || ||||| |||||  |||| 
Sbjct  26987  GTTATGGCTTTGTTGGATGAAGGTGAAACTGACTGGAAAGTTATTGTTATCGATGTCAAT  27046

Query  487    GATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTTG  546
              ||||||||||| |||||||||||||||||||| ||||| || ||||||||||||||||||
Sbjct  27047  GATCCATTGGCTCCAAAGTTGAACGACATTGAAGATGTGGAAAAGCACTTGCCAGGTTTG  27106

Query  547    CTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAAC  606
               | ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct  27107  TTGAGAGCTACCAACGAATGGTTCAGAATCTACAAGATTCCTGACGGTAAGCCAGAAAAC  27166

Query  607    CAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGAG  666
              |||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |||
Sbjct  27167  CAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTTTGGAAGTTATCAGAGAG  27226

Query  667    TGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGAT  726
              |||||||||||||||||| | ||||||   ||||||   | ||| |||||| | |    |
Sbjct  27227  TGTAACGAAGCTTGGAAGCAATTGATTGGTGGTAAG---GTTGATGCTAAGGACACTAGT  27283

Query  727    TTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGTT  786
              ||||||||||| ||  |    || |||||  |||| ||||  || ||  |  || | |||
Sbjct  27284  TTGACCAACACTACCCTAACTGAAACTGCTGCTTATTCTGATGAAGCCTCCACTTCAGTT  27343

Query  787    CCACCAGCACACGTC-TTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
              ||  | ||  || || |||  ||| |  ||| | ||||||||  ||||||| ||||||||
Sbjct  27344  CCTGCTGC-TACCTCTTTGGAAGATGCTCCAGTTGACAAGTCAGTTGACAAATGGTTCTT  27402

Query  846    CATCTCCGGTTCTGCTT  862
              |||||| ||||| ||||
Sbjct  27403  CATCTCTGGTTCCGCTT  27419


> KLAEg1509 KLAEg1509 undefined product 3190149:3191006 reverse
Length=858

 Score =  877 bits (972),  Expect = 0.0
 Identities = 710/856 (83%), Gaps = 5/856 (0%)
 Strand=Plus/Plus

Query  7    TACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAAG  66
            ||||| || |||||||| ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct  7    TACACCACTAGACAAATTGGTGCTAAGAACACTTTGGACTACAAGGTCTTCATTGAAAAG  66

Query  67   GATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGGT  126
            |||||||||   || ||| | ||||| ||||| ||||||||||| || || |||||||||
Sbjct  67   GATGGCAAGGTTGTTTCTCCATTCCATGACATTCCATTGTACGCAGATGAGGCCAATGGT  126

Query  127  ATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAG  186
            || || ||||||||||| ||||||||||||||||| || || ||||| |||||  | |||
Sbjct  127  ATTTTTAACATGGTTGTTGAAATCCCACGTTGGACTAATGCTAAGTTAGAAATTTCTAAG  186

Query  187  GAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGA  246
            || || |  ||||| || || || ||||||||||||||||||||| | ||||  || |||
Sbjct  187  GAAGAAAGTTTGAATCCTATTATTCAAGACACCAAGAAGGGTAAGTTGAGATACGTCAGA  246

Query  247  AACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAA  306
            ||||||||||| |||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct  247  AACTGTTTCCCTCACCACGGTTACATTCACAACTACGGTGCTTTCCCACAAACTTGGGAA  306

Query  307  GATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTG  366
            |||||||||||  | ||||||||||| ||||| | ||||||  |||||||| | ||||| 
Sbjct  307  GATCCTAACGAAGCTCACCCAGAAACTAAGGCAGCTGGTGATGACGATCCACTAGATGTT  366

Query  367  TTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGGT  426
            || ||||| ||||||||||| || |||||||||||| | || ||||| |||||| | |||
Sbjct  367  TTAGAAATTGGTGAACAAGTTGCTTACACTGGTCAAATCAAACAAGTTAAGGTTTTGGGT  426

Query  427  GTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAAC  486
            || ||||| |||||||| |||||||| || |||||||| || ||||| |||||  |||| 
Sbjct  427  GTTATGGCTTTGTTGGATGAAGGTGAAACTGACTGGAAAGTTATTGTTATCGATGTCAAT  486

Query  487  GATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTTG  546
            ||||||||||| |||||||||||||||||||| ||||| || ||||||||||||||||||
Sbjct  487  GATCCATTGGCTCCAAAGTTGAACGACATTGAAGATGTGGAAAAGCACTTGCCAGGTTTG  546

Query  547  CTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAAC  606
             | ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct  547  TTGAGAGCTACCAACGAATGGTTCAGAATCTACAAGATTCCTGACGGTAAGCCAGAAAAC  606

Query  607  CAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGAG  666
            |||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |||
Sbjct  607  CAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTTTGGAAGTTATCAGAGAG  666

Query  667  TGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGAT  726
            |||||||||||||||||| | ||||||   ||||||   | ||| |||||| | |    |
Sbjct  667  TGTAACGAAGCTTGGAAGCAATTGATTGGTGGTAAG---GTTGATGCTAAGGACACTAGT  723

Query  727  TTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGTT  786
            ||||||||||| ||  |    || |||||  |||| ||||  || ||  |  || | |||
Sbjct  724  TTGACCAACACTACCCTAACTGAAACTGCTGCTTATTCTGATGAAGCCTCCACTTCAGTT  783

Query  787  CCACCAGCACACGTC-TTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
            ||  | ||  || || |||  ||| |  ||| | ||||||||  ||||||| ||||||||
Sbjct  784  CCTGCTGC-TACCTCTTTGGAAGATGCTCCAGTTGACAAGTCAGTTGACAAATGGTTCTT  842

Query  846  CATCTCCGGTTCTGCT  861
            |||||| ||||| |||
Sbjct  843  CATCTCTGGTTCCGCT  858


> gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome 
II, complete chromosome sequence
Length=813140

 Score =  854 bits (946),  Expect = 0.0
 Identities = 712/869 (82%), Gaps = 14/869 (1%)
 Strand=Plus/Minus

Query  1       ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATC  60
               ||| | ||||||||||||||||| |||||||||||||||||||| ||||||||||  |||
Sbjct  257933  ATGACCTACACTACCAGACAAATTGGTGCCAAGAACACCTTGGAATACAAAGTTTATATC  257874

Query  61      GAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCC  120
               ||||||||||| |||||||| ||||||||||||||||| || |||||||||||| | |  
Sbjct  257873  GAAAAGGATGGTAAGCCAGTTTCTGCCTTCCACGACATTCCCTTGTACGCTGACAAGGAA  257814

Query  121     AATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATC  180
               ||    || |||||||||||||| ||||| ||||||||||||||||||||||| ||||||
Sbjct  257813  AACAACATTTTCAACATGGTTGTTGAAATTCCACGTTGGACCAACGCCAAGTTAGAAATC  257754

Query  181     ACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTT  240
               |||||||| || |  |||||||||||||||||||||||||||||||| ||| | ||||||
Sbjct  257753  ACCAAGGAAGAAACTTTGAACCCAATCATCCAAGACACCAAGAAGGGCAAGTTGAGATTT  257694

Query  241     GTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACC  300
               || |||||||||||||| ||||| |||||||| |||||||| ||||| ||||||||||| 
Sbjct  257693  GTTAGAAACTGTTTCCCTCACCATGGTTACATTCACAACTATGGTGCTTTCCCACAAACT  257634

Query  301     TGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTG  360
               |||||||| || ||||    |||||||||||| ||||| |||||||||||||||||| | 
Sbjct  257633  TGGGAAGACCCAAACGTAAGCCACCCAGAAACTAAGGCAGTTGGTGACAACGATCCAATT  257574

Query  361     GATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTT  420
               |||||||||||||| ||||||    | || |||||||||||||| |||||||| |||| |
Sbjct  257573  GATGTGTTGGAAATTGGTGAAACTATTGCTTACACTGGTCAAGTCAAGCAAGTTAAGGCT  257514

Query  421     CTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGAC  480
               || ||| | ||||| || ||||| |||||||||||||| ||||| || ||||  || || 
Sbjct  257513  CTAGGTATCATGGCTTTATTGGATGAAGGTGAGACCGATTGGAAAGTTATTGCCATTGAT  257454

Query  481     ATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCA  540
               || ||||||||||| |||||||| |||||||||||||||||||| |||||  |||| |||
Sbjct  257453  ATTAACGATCCATTAGCCCCAAAATTGAACGACATTGAGGATGTTGAGAAATACTTCCCA  257394

Query  541     GGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCA  600
               ||| || | || || |||||||||||||||||||| ||||| || ||||| |||||||||
Sbjct  257393  GGTCTGTTGAGGGCTACTAACGAATGGTTCAGAATTTACAAAATCCCAGATGGTAAGCCA  257334

Query  601     GAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATC  660
               |||||||||||||||||||| |||||||| |||||||||||||||||| | ||  | |||
Sbjct  257333  GAAAACCAATTTGCCTTCTCCGGTGAAGCTAAGAACAAGAAGTACGCTTTGGATATCATC  257274

Query  661     AGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAG  720
               | |||     | ||  | |||||  | || ||| | ||||||||| |||||   |||   
Sbjct  257273  AAGGAAACACATGACTCCTGGAAACAATTAATTGCTGGTAAGTCTTCTGACAGCAAGGGT  257214

Query  721     ATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAG---CT  777
               || |||||||||||    || |||   |||||  | || ||||   || |||| |   ||
Sbjct  257213  ATTGATTTGACCAATGTTACTTTGCCTGACACCCCAACCTACT---CCAAGGCTGCCTCT  257157

Query  778     GCTGCTGTTCCACCAGCACACGTCT----TGCCAGACGAGCCAATCGACAAGTCCATTGA  833
               | |||  | |||||||    | |||     | |||| |  ||||| |||||||| |||||
Sbjct  257156  GATGCCATCCCACCAG----CTTCTCCAAAGGCAGATGCTCCAATTGACAAGTCTATTGA  257101

Query  834     CAAGTGGTTCTTCATCTCCGGTTCTGCTT  862
               |||||||||||||||||||||||||| ||
Sbjct  257100  CAAGTGGTTCTTCATCTCCGGTTCTGTTT  257072


> KLLA0E11089g KLLA0E11089g undefined product 6827961:6828854 reverse
Length=894

 Score = 95.1 bits (104),  Expect = 2e-18
 Identities = 310/468 (67%), Gaps = 29/468 (6%)
 Strand=Plus/Plus

Query  133  AACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAG  192
            |||||| | || ||  | ||||||||||  || |  ||||| |||||||  |||   || 
Sbjct  199  AACATGATCGTAGAGGTTCCACGTTGGAGTAATGGGAAGTTTGAAATCAGTAAGACCGAA  258

Query  193  AAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAACTGT  252
               || ||||| ||||  || ||||  ||||| || |||| | ||||||| |  |||  |
Sbjct  259  CCATTTAACCCCATCACACAGGACATAAAGAAAGGCAAGCCACGATTTGTCAATAACATT  318

Query  253  TTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCC-  311
            |||||  |||| || ||||| || ||||| || ||  ||||||| || |||||| | || 
Sbjct  319  TTCCCTTACCATGGATACATTCATAACTATGGGGCTATCCCACAGACATGGGAACAGCCA  378

Query  312  --TAACGA-GTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTGTT  368
              ||  || ||    ||| |   | ||||      |||| || || ||||||||  ||||
Sbjct  379  CTTATTGAAGTATTGCCCGGTTTC-AAGG------GTGATAATGACCCATTGGAC-TGTT  430

Query  369  G-GAAATCGGTGAACAAG--TCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
            | ||||| |||   | ||  ||||  | |  ||  |  | ||  |||| ||| |||| ||
Sbjct  431  GTGAAATTGGTT--CCAGCATCGCCAAAATGGGAGATATCAAAAAAGTAAAGCTTCTAGG  488

Query  426  TGTGATG-GCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCA  484
             || ||  ||| |  | ||||| || ||   ||| ||||| || |||   ||||||||  
Sbjct  489  -GTCATTAGCCCTCATTGACGATGGAGAACTCGATTGGAAAGTCATTTGTATCGACATTG  547

Query  485  ACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACT----TGCCA  540
            | |||||  | ||   ||| |||||| |  | |  ||||| ||    ||||    |||| 
Sbjct  548  AAGATCCCATTGCTATAAAATTGAACAAGTTGGCAGATGTAGA----CACTGTTATGCCT  603

Query  541  GGTTTGCTAAGA-GCCACTAACGAATGGTTCAGAATCTACAAGATTCC  587
            ||| | ||  || || ||||    ||||||||||   |||||||||||
Sbjct  604  GGTCT-CTTGGATGCAACTAGAACATGGTTCAGAGATTACAAGATTCC  650


> gi|6323501|ref|NC_001145.1| Saccharomyces cerevisiae chromosome 
XIII, complete chromosome sequence
Length=924430

 Score = 87.8 bits (96),  Expect = 2e-16
 Identities = 129/180 (72%), Gaps = 2/180 (1%)
 Strand=Plus/Plus

Query  133     AACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAG  192
               || ||| |||| ||| | ||| | ||||| |  |  || || |||||  |||| ||    
Sbjct  801999  AATATGATTGTTGAAGTACCAAGATGGACAACTGGAAAATTTGAAATATCCAAAGAACTT  802058

Query  193     AAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAAC-TG  251
               | ||| || || ||| | ||||| || ||||| || ||||| || || ||||  ||  | 
Sbjct  802059  AGGTTCAATCCGATCGTTCAAGATACGAAGAATGGCAAGCTTAGGTTCGTGAACAATATC  802118

Query  252     TTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCC  311
               ||||||  | ||||| || || |||||||| |||||  | || ||||| |||||||||||
Sbjct  802119  TTTCCCT-ATCACGGCTATATACACAACTATGGTGCTATTCCCCAAACATGGGAAGATCC  802177


 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  248     ACTGTTTCCCACACCACGGTTACATCCACAACTACGGT  285
               ||||||||||| ||  |||  ||| |||| | ||||||
Sbjct  760917  ACTGTTTCCCAAACTGCGGCGACACCCACCATTACGGT  760880


> AEAS01000044  Kluyveromyces aestuarii ATCC 18862 contig00046, 
whole genome shotgun sequence
Length=33514

 Score = 53.6 bits (58),  Expect = 5e-06
 Identities = 327/513 (64%), Gaps = 22/513 (4%)
 Strand=Plus/Plus

Query  132    CAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGA--G  189
              |||||||||||| ||| | || || ||||| || |  || || || || |  | | |   
Sbjct  24183  CAACATGGTTGTTGAAGTTCCTCGCTGGACAAATGGTAAATTCGAGATAA--ATGTATCC  24240

Query  190    GAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAAC  249
              |||||  | || || || |  || || |  |||||||| |  |  |||||  | |  || 
Sbjct  24241  GAGAAACTTAATCCTATAACACAGGATATAAAGAAGGGAACCCCCAGATTCATTAATAAT  24300

Query  250    TGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGAT  309
                ||||||  | || || || || || || || || ||  |||| ||||| |||||| | 
Sbjct  24301  ATTTTCCCTTATCATGGCTATATTCATAATTATGGAGCAATCCCTCAAACTTGGGAACAA  24360

Query  310    CCTAACG----AGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
              || ||||    |||     | || |  ||||      ||||| || ||||| || ||| |
Sbjct  24361  CCGAACGTGGAAGT-TTTGCAAGGACTCAAG------GGTGATAATGATCCCTTAGAT-T  24412

Query  366    GTTG-GAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTG  424
              |||| ||||| ||   |   || ||    |  ||| |  | ||   ||| ||  || || 
Sbjct  24413  GTTGTGAAATTGGATCAGCCGTGGCTGGAATGGGTGATATTAAAACAGTAAAAATT-TTA  24471

Query  425    GTGTGA-TGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATC  483
              | || | | ||  || | ||||| || |||   || ||||| ||||||   || || |||
Sbjct  24472  GGGTCACTAGCTCTGATCGACGATGGGGAGTTAGATTGGAAAGTGATTTGTATTGATATC  24531

Query  484    AACGATCCATTGGCCCCAAAGTTGAACGACATT-GAGGATGTCGAGAAGCACTTGCCAGG  542
              || || ||||||||||   |  | ||| || || |  ||||| || |  ||  |||| ||
Sbjct  24532  AATGACCCATTGGCCCATGAAATAAAC-ACTTTGGTAGATGTAGACACTCATATGCCGGG  24590

Query  543    TTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGA  602
               ||  ||   || || |   | ||||| |||  |||||| |||||    || ||||| | 
Sbjct  24591  CTTATTAGAGGCTACCAGAAATTGGTTTAGAGACTACAAAATTCCTACAGGCAAGCCTGC  24650

Query  603    AAACCAATTTGCCTTCTCTGGTGAA-GCCAAGA  634
              |||    ||||||||   |||||||  ||||||
Sbjct  24651  AAATTCCTTTGCCTTTGATGGTGAATACCAAGA  24683


> KLAEg2681.t2 KLAEg2681.t2 undefined product 5657667:5661585 reverse
Length=3336

 Score = 53.6 bits (58),  Expect = 5e-06
 Identities = 327/513 (64%), Gaps = 22/513 (4%)
 Strand=Plus/Plus

Query  132   CAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGA--G  189
             |||||||||||| ||| | || || ||||| || |  || || || || |  | | |   
Sbjct  2652  CAACATGGTTGTTGAAGTTCCTCGCTGGACAAATGGTAAATTCGAGATAA--ATGTATCC  2709

Query  190   GAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAAC  249
             |||||  | || || || |  || || |  |||||||| |  |  |||||  | |  || 
Sbjct  2710  GAGAAACTTAATCCTATAACACAGGATATAAAGAAGGGAACCCCCAGATTCATTAATAAT  2769

Query  250   TGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGAT  309
               ||||||  | || || || || || || || || ||  |||| ||||| |||||| | 
Sbjct  2770  ATTTTCCCTTATCATGGCTATATTCATAATTATGGAGCAATCCCTCAAACTTGGGAACAA  2829

Query  310   CCTAACG----AGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
             || ||||    |||     | || |  ||||      ||||| || ||||| || ||| |
Sbjct  2830  CCGAACGTGGAAGT-TTTGCAAGGACTCAAG------GGTGATAATGATCCCTTAGAT-T  2881

Query  366   GTTG-GAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTG  424
             |||| ||||| ||   |   || ||    |  ||| |  | ||   ||| ||  || || 
Sbjct  2882  GTTGTGAAATTGGATCAGCCGTGGCTGGAATGGGTGATATTAAAACAGTAAAAATT-TTA  2940

Query  425   GTGTGA-TGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATC  483
             | || | | ||  || | ||||| || |||   || ||||| ||||||   || || |||
Sbjct  2941  GGGTCACTAGCTCTGATCGACGATGGGGAGTTAGATTGGAAAGTGATTTGTATTGATATC  3000

Query  484   AACGATCCATTGGCCCCAAAGTTGAACGACATT-GAGGATGTCGAGAAGCACTTGCCAGG  542
             || || ||||||||||   |  | ||| || || |  ||||| || |  ||  |||| ||
Sbjct  3001  AATGACCCATTGGCCCATGAAATAAAC-ACTTTGGTAGATGTAGACACTCATATGCCGGG  3059

Query  543   TTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGA  602
              ||  ||   || || |   | ||||| |||  |||||| |||||    || ||||| | 
Sbjct  3060  CTTATTAGAGGCTACCAGAAATTGGTTTAGAGACTACAAAATTCCTACAGGCAAGCCTGC  3119

Query  603   AAACCAATTTGCCTTCTCTGGTGAA-GCCAAGA  634
             |||    ||||||||   |||||||  ||||||
Sbjct  3120  AAATTCCTTTGCCTTTGATGGTGAATACCAAGA  3152


> KLAEg2681.t1 KLAEg2681.t1 undefined product 5657667:5661585 reverse
Length=3351

 Score = 53.6 bits (58),  Expect = 5e-06
 Identities = 327/513 (64%), Gaps = 22/513 (4%)
 Strand=Plus/Plus

Query  132   CAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGA--G  189
             |||||||||||| ||| | || || ||||| || |  || || || || |  | | |   
Sbjct  2667  CAACATGGTTGTTGAAGTTCCTCGCTGGACAAATGGTAAATTCGAGATAA--ATGTATCC  2724

Query  190   GAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAAC  249
             |||||  | || || || |  || || |  |||||||| |  |  |||||  | |  || 
Sbjct  2725  GAGAAACTTAATCCTATAACACAGGATATAAAGAAGGGAACCCCCAGATTCATTAATAAT  2784

Query  250   TGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGAT  309
               ||||||  | || || || || || || || || ||  |||| ||||| |||||| | 
Sbjct  2785  ATTTTCCCTTATCATGGCTATATTCATAATTATGGAGCAATCCCTCAAACTTGGGAACAA  2844

Query  310   CCTAACG----AGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
             || ||||    |||     | || |  ||||      ||||| || ||||| || ||| |
Sbjct  2845  CCGAACGTGGAAGT-TTTGCAAGGACTCAAG------GGTGATAATGATCCCTTAGAT-T  2896

Query  366   GTTG-GAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTG  424
             |||| ||||| ||   |   || ||    |  ||| |  | ||   ||| ||  || || 
Sbjct  2897  GTTGTGAAATTGGATCAGCCGTGGCTGGAATGGGTGATATTAAAACAGTAAAAATT-TTA  2955

Query  425   GTGTGA-TGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATC  483
             | || | | ||  || | ||||| || |||   || ||||| ||||||   || || |||
Sbjct  2956  GGGTCACTAGCTCTGATCGACGATGGGGAGTTAGATTGGAAAGTGATTTGTATTGATATC  3015

Query  484   AACGATCCATTGGCCCCAAAGTTGAACGACATT-GAGGATGTCGAGAAGCACTTGCCAGG  542
             || || ||||||||||   |  | ||| || || |  ||||| || |  ||  |||| ||
Sbjct  3016  AATGACCCATTGGCCCATGAAATAAAC-ACTTTGGTAGATGTAGACACTCATATGCCGGG  3074

Query  543   TTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGA  602
              ||  ||   || || |   | ||||| |||  |||||| |||||    || ||||| | 
Sbjct  3075  CTTATTAGAGGCTACCAGAAATTGGTTTAGAGACTACAAAATTCCTACAGGCAAGCCTGC  3134

Query  603   AAACCAATTTGCCTTCTCTGGTGAA-GCCAAGA  634
             |||    ||||||||   |||||||  ||||||
Sbjct  3135  AAATTCCTTTGCCTTTGATGGTGAATACCAAGA  3167


> gi|6322960|ref|NC_001144.1| Saccharomyces cerevisiae chromosome 
XII, complete chromosome sequence
Length=1078172

 Score = 37.4 bits (40),  Expect = 0.39
 Identities = 37/48 (78%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  589    GACGGTAAGCCAGAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAAC  636
              |||||||||||| |||  ||| |||  ||    |||||| ||||||||
Sbjct  97199  GACGGTAAGCCACAAATTCAAGTTGAATTTAAGGGTGAAACCAAGAAC  97152


> AEAV01000047  Kluyveromyces wickerhamii UCD 54-210 contig00050, 
whole genome shotgun sequence
Length=54078

 Score = 35.6 bits (38),  Expect = 1.4
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  334    AAGGCTGTTGGTGACAACGATCCA  357
              ||||||||||||||||| | ||||
Sbjct  17284  AAGGCTGTTGGTGACAAGGTTCCA  17261


> KLWIg9 KLWIg9 undefined product 17111:18739 reverse
Length=1629

 Score = 35.6 bits (38),  Expect = 1.4
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  334   AAGGCTGTTGGTGACAACGATCCA  357
             ||||||||||||||||| | ||||
Sbjct  1456  AAGGCTGTTGGTGACAAGGTTCCA  1479


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 35.6 bits (38),  Expect = 1.4
 Identities = 26/29 (90%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  508      AACGACATTGAGGATGTCGAGAAGCACTT  536
                || |||||||| ||||||||||| |||||
Sbjct  2304720  AAAGACATTGAAGATGTCGAGAA-CACTT  2304747


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 35.6 bits (38),  Expect = 1.4
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  359     TGGATGTGTTGGAAATCGGTGAACAAG  385
               || ||||||||||||| | ||||||||
Sbjct  652066  TGAATGTGTTGGAAATAGATGAACAAG  652092


> KLLA0D07579g KLLA0D07579g undefined product 4789299:4789592 forward
Length=294

 Score = 35.6 bits (38),  Expect = 1.4
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  359  TGGATGTGTTGGAAATCGGTGAACAAG  385
            || ||||||||||||| | ||||||||
Sbjct  149  TGAATGTGTTGGAAATAGATGAACAAG  175


> AEAS01000097  Kluyveromyces aestuarii ATCC 18862 contig00102, 
whole genome shotgun sequence
Length=103414

 Score = 35.6 bits (38),  Expect = 1.4
 Identities = 29/34 (86%), Gaps = 1/34 (2%)
 Strand=Plus/Minus

Query  116    AAGCCAATGGTATCTTCAACATG-GTTGTCGAAA  148
              |||||||||||  ||||||| || || |||||||
Sbjct  51512  AAGCCAATGGTTACTTCAACGTGCGTAGTCGAAA  51479


> gi|6322623|ref|NC_001143.1| Saccharomyces cerevisiae chromosome 
XI, complete chromosome sequence
Length=666445

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  838   TGGTTCTTCATCTCCGGT  855
             ||||||||||||||||||
Sbjct  9644  TGGTTCTTCATCTCCGGT  9627


> gi|6322016|ref|NC_001141.1| Saccharomyces cerevisiae chromosome 
IX, complete chromosome sequence
Length=439885

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  772     GCAGCTGCTGCTGTTCCACCAGCACA  797
               ||||||| || ||| |||||||||||
Sbjct  298685  GCAGCTGTTGGTGTGCCACCAGCACA  298660


> gi|6862570|ref|NC_001140.2| Saccharomyces cerevisiae chromosome 
VIII, complete chromosome sequence
Length=562639

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  590     ACGGTAAGCCAGAAAACCAATTT  612
               ||| |||||| ||||||||||||
Sbjct  130259  ACGTTAAGCCTGAAAACCAATTT  130281


> gi|6319247|ref|NC_001133.1| Saccharomyces cerevisiae chromosome 
I, complete chromosome sequence
Length=230203

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 36/48 (75%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  589     GACGGTAAGCCAGAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAAC  636
               |||||||||||  |||  ||| |||  ||    |||||| ||||||||
Sbjct  141144  GACGGTAAGCCTCAAATTCAAGTTGAATTTAAGGGTGAAACCAAGAAC  141097


> AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213, 
whole genome shotgun sequence
Length=85282

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  511    GACATTGAGGATGTCGAG  528
              ||||||||||||||||||
Sbjct  19791  GACATTGAGGATGTCGAG  19808


> KLWIg455 KLWIg455 undefined product 948663:958466 forward
Length=9804

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  511   GACATTGAGGATGTCGAG  528
             ||||||||||||||||||
Sbjct  5746  GACATTGAGGATGTCGAG  5763


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 23/25 (92%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  357     ATTGGATGTGTTGGAAATCGGTGAA  381
               ||||||| ||||||||||| |||||
Sbjct  106138  ATTGGATTTGTTGGAAATC-GTGAA  106161


 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  764     CTGCCGAGGCAGCTGCTGCTGTT  786
               |||| | ||||||||||||||||
Sbjct  500817  CTGCAGCGGCAGCTGCTGCTGTT  500795


> KLLA0E20857g KLLA0E20857g undefined product 7713404:7715536 forward
Length=2133

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  766  GCCGAGGCAGCTGCTGCTGTT  786
            || ||||||||||||||||||
Sbjct  161  GCAGAGGCAGCTGCTGCTGTT  141


> KLLA0C05588g KLLA0C05588g undefined product 2884046:2885602 forward
Length=1557

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  764  CTGCCGAGGCAGCTGCTGCTGTT  786
            |||| | ||||||||||||||||
Sbjct  196  CTGCAGCGGCAGCTGCTGCTGTT  174


> KLLA0C01386g KLLA0C01386g undefined product 2489236:2490123 forward
Length=888

 Score = 33.7 bits (36),  Expect = 4.7
 Identities = 23/25 (92%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  357  ATTGGATGTGTTGGAAATCGGTGAA  381
            ||||||| ||||||||||| |||||
Sbjct  327  ATTGGATTTGTTGGAAATC-GTGAA  350



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 68294605632


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7

  Database: Saccharomyces cerevisiae
    Posted date:  Jul 14, 2011  9:42 PM
  Number of letters in database: 12,155,026
  Number of sequences in database:  17



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>
ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGTTCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTTCATCTCCGGTTCTGCTTGA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)