blastn task: [no title]

Status
finished finished
Modified 2013-12-24T06:40:04Z
CPU time (s) 0.0
Size (bytes) 6017
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_lactis_Y-1140.fna -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces lactis NRRL Y-1140
           7 sequences; 10,729,447 total letters



Query= query

Length=22
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    9e-04
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    9e-04
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    9e-04
  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    9e-04
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    9e-04
  gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    9e-04


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  1    GACCGGGCCCAGCAGGACCAAG  22
            |||| |||||||||||||||||
Sbjct  732  GACCAGGCCCAGCAGGACCAAG  711


 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  1        GACCGGGCCCAGCAGGACCAAG  22
                |||| |||||||||||||||||
Sbjct  2601025  GACCAGGCCCAGCAGGACCAAG  2601046


 Score = 22.9 bits (24),  Expect = 5.4
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  11      AGCAGGACCAAG  22
               ||||||||||||
Sbjct  260932  AGCAGGACCAAG  260921


 Score = 22.9 bits (24),  Expect = 5.4
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  10      CAGCAGGACCAA  21
               ||||||||||||
Sbjct  408567  CAGCAGGACCAA  408556


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  1    GACCGGGCCCAGCAGGACCAAG  22
            |||| |||||||||||||||||
Sbjct  940  GACCAGGCCCAGCAGGACCAAG  919


 Score = 22.9 bits (24),  Expect = 5.4
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  6        GGCCCAGCAGGA  17
                ||||||||||||
Sbjct  1650667  GGCCCAGCAGGA  1650656


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  1    GACCGGGCCCAGCAGGACCAAG  22
            |||| |||||||||||||||||
Sbjct  988  GACCAGGCCCAGCAGGACCAAG  967


 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  1        GACCGGGCCCAGCAGGACCAAG  22
                |||| |||||||||||||||||
Sbjct  1714515  GACCAGGCCCAGCAGGACCAAG  1714536


 Score = 22.9 bits (24),  Expect = 5.4
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Plus

Query  4       CGGGCCCAGCAG  15
               ||||||||||||
Sbjct  603235  CGGGCCCAGCAG  603246


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  1    GACCGGGCCCAGCAGGACCAAG  22
            |||| |||||||||||||||||
Sbjct  859  GACCAGGCCCAGCAGGACCAAG  838


 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  1        GACCGGGCCCAGCAGGACCAAG  22
                |||| |||||||||||||||||
Sbjct  1752914  GACCAGGCCCAGCAGGACCAAG  1752935


 Score = 22.9 bits (24),  Expect = 5.4
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Plus

Query  10       CAGCAGGACCAA  21
                ||||||||||||
Sbjct  1498241  CAGCAGGACCAA  1498252


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  1     GACCGGGCCCAGCAGGACCAAG  22
             |||| |||||||||||||||||
Sbjct  1113  GACCAGGCCCAGCAGGACCAAG  1092


 Score = 22.9 bits (24),  Expect = 5.4
 Identities = 12/12 (100%), Gaps = 0/12 (0%)
 Strand=Plus/Minus

Query  10      CAGCAGGACCAA  21
               ||||||||||||
Sbjct  894231  CAGCAGGACCAA  894220


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 35.6 bits (38),  Expect = 9e-04
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  1     GACCGGGCCCAGCAGGACCAAG  22
             |||| |||||||||||||||||
Sbjct  1047  GACCAGGCCCAGCAGGACCAAG  1026



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 42917284


  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GACCGGGCCCAGCAGGACCAAG
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)