blastn task: [no title]

Status
finished finished
Modified 2016-05-16T12:49:14Z
CPU time (s) 0.1
Size (bytes) 19609
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
           510 sequences; 9,807,744 total letters



Query= query

Length=810
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAV01000011  Kluyveromyces wickerhamii UCD 54-210 contig00012,...   378    1e-104
  AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213,...  42.8    0.001 
  AEAV01000322  Kluyveromyces wickerhamii UCD 54-210 contig00333,...  37.4    0.044 
  AEAV01000087  Kluyveromyces wickerhamii UCD 54-210 contig00091,...  37.4    0.044 
  AEAV01000085  Kluyveromyces wickerhamii UCD 54-210 contig00089,...  37.4    0.044 
  AEAV01000060  Kluyveromyces wickerhamii UCD 54-210 contig00063,...  37.4    0.044 
  AEAV01000204  Kluyveromyces wickerhamii UCD 54-210 contig00212,...  33.7    0.53  
  AEAV01000172  Kluyveromyces wickerhamii UCD 54-210 contig00179,...  33.7    0.53  
  AEAV01000487  Kluyveromyces wickerhamii UCD 54-210 contig00912,...  31.9    1.9   
  AEAV01000479  Kluyveromyces wickerhamii UCD 54-210 contig00903,...  31.9    1.9   
  AEAV01000457  Kluyveromyces wickerhamii UCD 54-210 contig00867,...  31.9    1.9   
  AEAV01000406  Kluyveromyces wickerhamii UCD 54-210 contig00805,...  31.9    1.9   
  AEAV01000224  Kluyveromyces wickerhamii UCD 54-210 contig00235,...  31.9    1.9   
  AEAV01000158  Kluyveromyces wickerhamii UCD 54-210 contig00164,...  31.9    1.9   
  AEAV01000107  Kluyveromyces wickerhamii UCD 54-210 contig00112,...  31.9    1.9   
  AEAV01000482  Kluyveromyces wickerhamii UCD 54-210 contig00907,...  30.1    6.5   
  AEAV01000473  Kluyveromyces wickerhamii UCD 54-210 contig00891,...  30.1    6.5   
  AEAV01000466  Kluyveromyces wickerhamii UCD 54-210 contig00882,...  30.1    6.5   
  AEAV01000442  Kluyveromyces wickerhamii UCD 54-210 contig00846,...  30.1    6.5   
  AEAV01000341  Kluyveromyces wickerhamii UCD 54-210 contig00353,...  30.1    6.5   
  AEAV01000329  Kluyveromyces wickerhamii UCD 54-210 contig00340,...  30.1    6.5   
  AEAV01000317  Kluyveromyces wickerhamii UCD 54-210 contig00328,...  30.1    6.5   
  AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283,...  30.1    6.5   
  AEAV01000215  Kluyveromyces wickerhamii UCD 54-210 contig00226,...  30.1    6.5   
  AEAV01000214  Kluyveromyces wickerhamii UCD 54-210 contig00225,...  30.1    6.5   
  AEAV01000199  Kluyveromyces wickerhamii UCD 54-210 contig00207,...  30.1    6.5   
  AEAV01000193  Kluyveromyces wickerhamii UCD 54-210 contig00201,...  30.1    6.5   
  AEAV01000147  Kluyveromyces wickerhamii UCD 54-210 contig00153,...  30.1    6.5   
  AEAV01000139  Kluyveromyces wickerhamii UCD 54-210 contig00145,...  30.1    6.5   
  AEAV01000091  Kluyveromyces wickerhamii UCD 54-210 contig00095,...  30.1    6.5   
  AEAV01000047  Kluyveromyces wickerhamii UCD 54-210 contig00050,...  30.1    6.5   


> AEAV01000011  Kluyveromyces wickerhamii UCD 54-210 contig00012, 
whole genome shotgun sequence
Length=41694

 Score =  378 bits (418),  Expect = 1e-104
 Identities = 425/569 (75%), Gaps = 0/569 (0%)
 Strand=Plus/Plus

Query  1      GGTCAAACGTCATATTGATGGTATTGTACCTTTAGAATTACATATGACATTAAAGGTCGC  60
              ||| ||| | ||||||||||| || || ||  ||||  | ||    ||  | ||||| ||
Sbjct  10346  GGTGAAAAGACATATTGATGGAATAGTCCCAATAGACCTGCACCCTACTCTTAAGGTAGC  10405

Query  61     ATTGTCCTTATGCTCATATAGATTCACGAAGGGCCCTTGGAGAAACAGTTATATCAAGCT  120
               || ||  | ||||| |||||||| || || || |||||||| || ||||||||||||||
Sbjct  10406  GTTATCTCTGTGCTCTTATAGATTTACCAAAGGTCCTTGGAGGAATAGTTATATCAAGCT  10465

Query  121    CGGTATTGACCCAAGAACCTCGAATGAGTACGCGAAATACCAGACCGAATATTTCAAAAT  180
               ||  |||| |||||||  ||  || | || ||  |||| || || || || ||||| ||
Sbjct  10466  TGGAGTTGATCCAAGAAGTTCTGATCAATATGCTCAATATCAAACGGAGTACTTCAAGAT  10525

Query  181    CGAGAGGAGATTACTAACAGATCCAAGAATTAAAAAGAATTTGCCAGCTCCTCCACCAAA  240
               ||  | | | || ||||||||||  |  || |||||||||||||    || ||||||||
Sbjct  10526  TGAACGCAAACTATTAACAGATCCTCGTCTTGAAAAGAATTTGCCTAAACCGCCACCAAA  10585

Query  241    GGACTACCAATCCAGTGTGCCTGGAGAAATTGACCCCAGGTTCGAATTTGACGGTAAAAG  300
                | || || |||| | | |||||||| || ||  || ||||| | ||||| || |||  
Sbjct  10586  AAATTATCAGTCCAATATTCCTGGAGAGATCGATTCCCGGTTCAATTTTGATGGGAAACA  10645

Query  301    TATTCCATGGTATCTAATGTTACAAATAGACTTACTTTTGAAAGAACCTAACATCAATGA  360
               || ||||||||| | ||||||||||||||  |  | || ||||||||||| |||   ||
Sbjct  10646  AATCCCATGGTATTTGATGTTACAAATAGATCTCTTGTTAAAAGAACCTAATATCGCAGA  10705

Query  361    AATATATTCTCAAGTGGAGTTTTTGCCCGAGGCCAACGAATTAACAGGATGGTTTAACGA  420
              |||||  ||  || |  |||||||||| || || || ||||||||||| |||||||  ||
Sbjct  10706  AATATTCTCCAAACTCCAGTTTTTGCCTGAAGCTAATGAATTAACAGGCTGGTTTACAGA  10765

Query  421    GTTAGATTTAACGAAGATACGGAAAATTGTTAAGTACGAATTGGGTTGCATGGTCCAAGG  480
               ||||| || || |||||  | |  ||||| |||||||||||||| || ||||| |||||
Sbjct  10766  ATTAGACTTGACAAAGATCAGAAGGATTGTGAAGTACGAATTGGGATGTATGGTTCAAGG  10825

Query  481    AAACTATGAATTCAACGAGCATAAATTGACATTTTTCAAAAGGATGATCTACGTCAAAGA  540
              ||| |||||||||||||| || ||| | ||||| ||||| || ||| | | |||||||||
Sbjct  10826  AAATTATGAATTCAACGAACACAAACTCACATTCTTCAAGAGAATGTTATTCGTCAAAGA  10885

Query  541    ATCAATGATGAAAGACCAAGATGCGGATG  569
              ||| |||||||| || ||||| |  ||||
Sbjct  10886  ATCTATGATGAAGGATCAAGAAGGTGATG  10914


> AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213, 
whole genome shotgun sequence
Length=85282

 Score = 42.8 bits (46),  Expect = 0.001
 Identities = 36/44 (82%), Gaps = 3/44 (6%)
 Strand=Plus/Plus

Query  638    TTGGAAGAGGCAGAAGATGA---AGAGCAAGAAGACGCAGAAGA  678
              || ||||||| ||| |||||   |||||||||||| | ||||||
Sbjct  20889  TTAGAAGAGGAAGAGGATGAGGAAGAGCAAGAAGAGGAAGAAGA  20932


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  586    CCAAGATAACGACGATA  602
              |||||||||||||||||
Sbjct  19859  CCAAGATAACGACGATA  19875


> AEAV01000322  Kluyveromyces wickerhamii UCD 54-210 contig00333, 
whole genome shotgun sequence
Length=21128

 Score = 37.4 bits (40),  Expect = 0.044
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAG  668
              ||||| | |||||| |||||||||||||
Sbjct  14879  GAAGAAGAAGAAGAAGAAGAGCAAGAAG  14852


 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  653    GATGAAGAGCAAGAAGACGCAGAAGA  678
              || || ||||||||||| | ||||||
Sbjct  14900  GAAGACGAGCAAGAAGAAGAAGAAGA  14875


> AEAV01000087  Kluyveromyces wickerhamii UCD 54-210 contig00091, 
whole genome shotgun sequence
Length=75150

 Score = 37.4 bits (40),  Expect = 0.044
 Identities = 32/39 (83%), Gaps = 3/39 (7%)
 Strand=Plus/Minus

Query  640    GGAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              ||||||||   |||| |||||||||||||| |  |||||
Sbjct  33839  GGAAGAGG---AAGAGGAAGAGCAAGAAGAAGAGGAAGA  33804


 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  310   GTATCTAATGTTACAAATA  328
             |||| ||||||||||||||
Sbjct  6158  GTATTTAATGTTACAAATA  6176


> AEAV01000085  Kluyveromyces wickerhamii UCD 54-210 contig00089, 
whole genome shotgun sequence
Length=92438

 Score = 37.4 bits (40),  Expect = 0.044
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  560    GATGCGGATGGGGACGTGGATATGGACCAAGATAACGA  597
              ||| |||||  |||  ||||||||||| ||||||| ||
Sbjct  12116  GATACGGATACGGATATGGATATGGACAAAGATAAGGA  12079


> AEAV01000060  Kluyveromyces wickerhamii UCD 54-210 contig00063, 
whole genome shotgun sequence
Length=37999

 Score = 37.4 bits (40),  Expect = 0.044
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              ||||| | ||||||||||||  ||||||| |  |||||
Sbjct  20705  GAAGAAGAAGAAGATGAAGAAGAAGAAGATGATGAAGA  20742


> AEAV01000204  Kluyveromyces wickerhamii UCD 54-210 contig00212, 
whole genome shotgun sequence
Length=80973

 Score = 33.7 bits (36),  Expect = 0.53
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  640    GGAAGAGGCAGAAGATGAAGA  660
              |||||||| ||||||||||||
Sbjct  66910  GGAAGAGGAAGAAGATGAAGA  66890


 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  65     TCCTTATGCTCATATAGAT  83
              |||| ||||||||||||||
Sbjct  39730  TCCTCATGCTCATATAGAT  39748


> AEAV01000172  Kluyveromyces wickerhamii UCD 54-210 contig00179, 
whole genome shotgun sequence
Length=68566

 Score = 33.7 bits (36),  Expect = 0.53
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  642    AAGAGGCAGAAGATGAAGAGCAAGAAGACGCAG  674
              |||| | ||||||||||||  | ||||||| ||
Sbjct  33355  AAGATGAAGAAGATGAAGAAGACGAAGACGAAG  33387


> AEAV01000487  Kluyveromyces wickerhamii UCD 54-210 contig00912, 
whole genome shotgun sequence
Length=15512

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  518   AAAAGGATGATCTACGTCAAAG  539
             ||||||||||| ||| ||||||
Sbjct  5193  AAAAGGATGATGTACCTCAAAG  5214


> AEAV01000479  Kluyveromyces wickerhamii UCD 54-210 contig00903, 
whole genome shotgun sequence
Length=60100

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  224    CCAGCTCCTCCACCAAA  240
              |||||||||||||||||
Sbjct  44053  CCAGCTCCTCCACCAAA  44037


> AEAV01000457  Kluyveromyces wickerhamii UCD 54-210 contig00867, 
whole genome shotgun sequence
Length=15091

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  354   TCAATGAAATATATTCT  370
             |||||||||||||||||
Sbjct  8366  TCAATGAAATATATTCT  8382


> AEAV01000406  Kluyveromyces wickerhamii UCD 54-210 contig00805, 
whole genome shotgun sequence
Length=7254

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  648   CAGAAGATGAAGAGCAAGAAGA  669
             || |||| ||||||||||||||
Sbjct  5686  CAAAAGAAGAAGAGCAAGAAGA  5665


> AEAV01000224  Kluyveromyces wickerhamii UCD 54-210 contig00235, 
whole genome shotgun sequence
Length=26048

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  201    ATCCAAGAATTAAAAAGAAT  220
              ||||||||||| ||||||||
Sbjct  22938  ATCCAAGAATTGAAAAGAAT  22919


> AEAV01000158  Kluyveromyces wickerhamii UCD 54-210 contig00164, 
whole genome shotgun sequence
Length=62093

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 25/30 (84%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  649    AGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              ||||||||||||| ||| ||| | ||| ||
Sbjct  24572  AGAAGATGAAGAGGAAGTAGAGGAAGAGGA  24543


 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  754    TGACATAAAAACTGCT  769
              ||||||||||||||||
Sbjct  15085  TGACATAAAAACTGCT  15100


> AEAV01000107  Kluyveromyces wickerhamii UCD 54-210 contig00112, 
whole genome shotgun sequence
Length=67366

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  641    GAAGAGGCAGAAGATGAAGA  660
              ||||||| ||||||||||||
Sbjct  17535  GAAGAGGGAGAAGATGAAGA  17516


 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  423    TAGATTTAACGAAGAT  438
              ||||||||||||||||
Sbjct  53304  TAGATTTAACGAAGAT  53289


> AEAV01000482  Kluyveromyces wickerhamii UCD 54-210 contig00907, 
whole genome shotgun sequence
Length=6978

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  651   AAGATGAAGAGCAAGAAGA  669
             ||||||||||||||| |||
Sbjct  3262  AAGATGAAGAGCAAGTAGA  3280


> AEAV01000473  Kluyveromyces wickerhamii UCD 54-210 contig00891, 
whole genome shotgun sequence
Length=20950

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  168  AATATTTCAAAATCGAGAG  186
            |||||||||||||| ||||
Sbjct  138  AATATTTCAAAATCAAGAG  156


> AEAV01000466  Kluyveromyces wickerhamii UCD 54-210 contig00882, 
whole genome shotgun sequence
Length=44541

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  643    AGAGGCAGAAGATGAAGAG  661
              |||||||||||| ||||||
Sbjct  26440  AGAGGCAGAAGAAGAAGAG  26422


> AEAV01000442  Kluyveromyces wickerhamii UCD 54-210 contig00846, 
whole genome shotgun sequence
Length=51441

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  637    ATTGGAAGAGGCAGAAGAT  655
              ||||||||||| |||||||
Sbjct  10010  ATTGGAAGAGGGAGAAGAT  10028


> AEAV01000341  Kluyveromyces wickerhamii UCD 54-210 contig00353, 
whole genome shotgun sequence
Length=5241

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  651   AAGATGAAGAGCAAGAAGA  669
             |||| ||||||||||||||
Sbjct  4307  AAGAAGAAGAGCAAGAAGA  4325


> AEAV01000329  Kluyveromyces wickerhamii UCD 54-210 contig00340, 
whole genome shotgun sequence
Length=5324

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  642   AAGAGGCAGAAGATGAAGA  660
             ||||||||||||| |||||
Sbjct  2384  AAGAGGCAGAAGAGGAAGA  2366


> AEAV01000317  Kluyveromyces wickerhamii UCD 54-210 contig00328, 
whole genome shotgun sequence
Length=9632

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  660   AGCAAGAAGACGCAGAAGATC  680
             ||||||||||| || ||||||
Sbjct  1235  AGCAAGAAGACACACAAGATC  1255


> AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283, 
whole genome shotgun sequence
Length=32523

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  649   AGAAGATGAAGAGCAAGAAGA  669
             ||||||||||||  |||||||
Sbjct  9091  AGAAGATGAAGAAGAAGAAGA  9111


> AEAV01000215  Kluyveromyces wickerhamii UCD 54-210 contig00226, 
whole genome shotgun sequence
Length=25965

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  5     AAACGTCATATTGATG  20
             ||||||||||||||||
Sbjct  7011  AAACGTCATATTGATG  6996


> AEAV01000214  Kluyveromyces wickerhamii UCD 54-210 contig00225, 
whole genome shotgun sequence
Length=94528

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  3      TCAAACGTCATATTGA  18
              ||||||||||||||||
Sbjct  41554  TCAAACGTCATATTGA  41539


> AEAV01000199  Kluyveromyces wickerhamii UCD 54-210 contig00207, 
whole genome shotgun sequence
Length=97451

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  196    AACAGATCCAAGAATTAAAAAGAA  219
              |||||||||||||||  || ||||
Sbjct  36275  AACAGATCCAAGAATAGAAGAGAA  36252


> AEAV01000193  Kluyveromyces wickerhamii UCD 54-210 contig00201, 
whole genome shotgun sequence
Length=75744

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 24/29 (83%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  358   TGAAATATATTCTCAAGTGGAGTTTTTGC  386
             ||| || ||||||   |||||||||||||
Sbjct  4929  TGATATTTATTCTGCCGTGGAGTTTTTGC  4901


> AEAV01000147  Kluyveromyces wickerhamii UCD 54-210 contig00153, 
whole genome shotgun sequence
Length=16500

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  173    TTCAAAATCGAGAGGAGAT  191
              ||| |||||||||||||||
Sbjct  12922  TTCCAAATCGAGAGGAGAT  12904


> AEAV01000139  Kluyveromyces wickerhamii UCD 54-210 contig00145, 
whole genome shotgun sequence
Length=20949

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 27/34 (80%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  458    GAATTGGGTTGCATGGTCCAAGGAAACTATGAAT  491
              ||| ||| | | |||||||||||| ||  |||||
Sbjct  10596  GAAATGGATCGAATGGTCCAAGGATACACTGAAT  10629


> AEAV01000091  Kluyveromyces wickerhamii UCD 54-210 contig00095, 
whole genome shotgun sequence
Length=131328

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 24/29 (83%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  650    GAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              |||||||||||| |||| || |  |||||
Sbjct  54513  GAAGATGAAGAGGAAGAGGAAGAGGAAGA  54541


> AEAV01000047  Kluyveromyces wickerhamii UCD 54-210 contig00050, 
whole genome shotgun sequence
Length=54078

 Score = 30.1 bits (32),  Expect = 6.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  12    ATATTGATGGTATTGTACCTT  32
             || ||||||||||||| ||||
Sbjct  3749  ATTTTGATGGTATTGTTCCTT  3729



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 7689070290


  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GGTCAAACGTCATATTGATGGTATTGTACCTTTAGAATTACATATGACATTAAAGGTCGCATTGTCCTTATGCTCATATAGATTCACGAAGGGCCCTTGGAGAAACAGTTATATCAAGCTCGGTATTGACCCAAGAACCTCGAATGAGTACGCGAAATACCAGACCGAATATTTCAAAATCGAGAGGAGATTACTAACAGATCCAAGAATTAAAAAGAATTTGCCAGCTCCTCCACCAAAGGACTACCAATCCAGTGTGCCTGGAGAAATTGACCCCAGGTTCGAATTTGACGGTAAAAGTATTCCATGGTATCTAATGTTACAAATAGACTTACTTTTGAAAGAACCTAACATCAATGAAATATATTCTCAAGTGGAGTTTTTGCCCGAGGCCAACGAATTAACAGGATGGTTTAACGAGTTAGATTTAACGAAGATACGGAAAATTGTTAAGTACGAATTGGGTTGCATGGTCCAAGGAAACTATGAATTCAACGAGCATAAATTGACATTTTTCAAAAGGATGATCTACGTCAAAGAATCAATGATGAAAGACCAAGATGCGGATGGGGACGTGGATATGGACCAAGATAACGACGATAATGGTGTGGAGGATGGAGAGATGGATGACGCCTTATTGGAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGATCAGGCCGGCGAGTCGGCATTGAAATCGGAAATATCTGATGGTAAGCAAGATGAAAATTCAGAACCTGATACTTTTGACATAAAAACTGCTTCGTTCAACGAAGTTATGGATAAGATAGCCAAGCATAACTC
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)