blastn task: [no title]

Status
finished finished
Modified 2016-05-16T13:11:09Z
CPU time (s) 0.0
Size (bytes) 8451
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
           336 sequences; 9,910,115 total letters



Query= query

Length=876
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, w...   554    8e-158
  AEAS01000202  Kluyveromyces aestuarii ATCC 18862 contig00220, w...  31.9    2.0   
  AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, w...  31.9    2.0   
  AEAS01000136  Kluyveromyces aestuarii ATCC 18862 contig00142, w...  30.1    7.1   
  AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, w...  30.1    7.1   
  AEAS01000023  Kluyveromyces aestuarii ATCC 18862 contig00025, w...  30.1    7.1   


> AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, 
whole genome shotgun sequence
Length=151927

 Score =  554 bits (614),  Expect = 8e-158
 Identities = 647/871 (75%), Gaps = 2/871 (0%)
 Strand=Plus/Plus

Query  1       GCAGCACAACAAGCAAAAGCTTGCCGATTTGATCAAGAAGTTGTACGACGGCGAAGACAT  60
               ||| ||||||||    |  || || |||||||||||| |  | || |  || ||||| ||
Sbjct  101797  GCAACACAACAAATTGAGACTAGCAGATTTGATCAAGGAAGTATATGGAGGTGAAGATAT  101856

Query  61      CATCGAAAGAGACCACATCAGAAACACCTTGTTCGACATCCAAGTGAAGCGTATTCACGA  120
                || || ||| |  | |||||| | || ||||| ||||| || || ||||||||||| ||
Sbjct  101857  TATTGACAGAAAAGATATCAGAGATACGTTGTTTGACATTCAGGTAAAGCGTATTCATGA  101916

Query  121     GTACAAGCGTCAACAGTTGAACATCTTTGGGTGCATCTACAGATACTTGCGGATCAAGGA  180
               |||||| ||||||||| |||| |||||||| || |||||| | ||| ||  |||||||||
Sbjct  101917  GTACAAACGTCAACAGATGAATATCTTTGGCTGTATCTACCGTTACCTGAAGATCAAGGA  101976

Query  181     GTTGTTGGCTGAAGGTGTCCCAATTGCCGAAGTGGAAAAGAAGTACCCAAGAAAGGTGTC  240
               | || | |   | || || ||  | |  || || |  ||  | |||||||| || || ||
Sbjct  101977  GCTGCTTGGGCAGGGAGTTCCTTTCGAAGAGGTTGCCAAACAATACCCAAGGAAAGTCTC  102036

Query  241     CATCTTTGGTGGTAAGAGTGCTCCAGGTTACTACATGGCCAAGACGATTATCAAGTTGAT  300
                ||||||||||| ||||||||||| ||||| |||||||| ||   | ||||||| || ||
Sbjct  102037  TATCTTTGGTGGAAAGAGTGCTCCTGGTTATTACATGGCTAAATTGGTTATCAAATTAAT  102096

Query  301     CAACAGTGTCAGCGACGTGGTGAACCACGACAAGGAGATCGGGAACATCTTCAAGGTCGT  360
               ||| ||||||   ||||| || ||||| ||    || ||     || | |||||||||| 
Sbjct  102097  CAATAGTGTCGCTGACGTAGTTAACCATGATGCTGAAATAAAAGACTTATTCAAGGTCGC  102156

Query  361     GTTCATTCCAGACTACAACGTCTCCAAGGCAGAAATCATCATTCCTGCCAGTGACTTGAG  420
                ||||| || || ||||| || || || || || |||||| |||| || |||||||| ||
Sbjct  102157  TTTCATCCCCGATTACAATGTTTCTAAAGCGGAGATCATCGTTCCAGCTAGTGACTTAAG  102216

Query  421     TGAGCACATCTCTACCGCCGGTACCGAGGCCTCTGGTACATCCAACATGAAGTTTGTCAT  480
               ||| |||||||| || || |||||||| || || ||||| ||||| ||||| ||||| ||
Sbjct  102217  TGAACACATCTCAACTGCTGGTACCGAAGCTTCAGGTACTTCCAATATGAAATTTGTGAT  102276

Query  481     GAACGGTGGGTTGATCATTGGTACCGTGGACGGTGCCAACGTCGAGATCACCAGAGAAAT  540
               ||||||||| ||||| ||||||||||| ||||| || ||||| || || |||||||||||
Sbjct  102277  GAACGGTGGCTTGATTATTGGTACCGTTGACGGGGCTAACGTGGAAATAACCAGAGAAAT  102336

Query  541     TGGAGAGGACAACATCTTCTTGTTTGGTAACTTGGCCGAGAACGTTGACGAGTTGAGATA  600
               ||| ||||| || || |||||||| ||||||||||| || || || || ||  | |||||
Sbjct  102337  TGGTGAGGAGAATATATTCTTGTTCGGTAACTTGGCTGAAAATGTCGAGGAACTAAGATA  102396

Query  601     CCAACACCAGTACCA-CGCCAAGCCATTGCCAAAGGAGTTGGAGGAAGTGTTGCAACTGA  659
               |||||| || |||||  |||||   ||| |  || |  |||||  |||| ||  ||   |
Sbjct  102397  CCAACATCAATACCATGGCCAAAAAATTCCTGAAAG-TTTGGAACAAGTCTTCGAAGCAA  102455

Query  660     TTGAGCGCGGCACTTTCGACGGTGACTTCAAGCCTTTGGTCGACTCTATCAGACACCACG  719
               ||||  ||||   |||||| ||||| | ||| ||| |  | || |||||||  || || |
Sbjct  102456  TTGAAGGCGGTCTTTTCGATGGTGATTACAATCCTCTCATTGAATCTATCAAGCATCATG  102515

Query  720     GTGACTATTACTTAGTCAGTGACGATTTCCAATCCTACTTGCAAATGCAATCGATGGTCG  779
               ||||||| || || || ||||| |||||| | ||||| || ||||  || ||  | || |
Sbjct  102516  GTGACTACTATTTGGTGAGTGATGATTTCGACTCCTATTTACAAACACAGTCCTTAGTAG  102575

Query  780     ATGACGTCTACCACAACAACAAGAAGGAGTGGCTAAAGAAGTCCATTTTGAGTGTTGCCA  839
               ||  | ||| |||     |||| |  |||||| | || ||||||||| |   ||| || |
Sbjct  102576  ATTCCCTCTTCCATGGAGACAAAAGAGAGTGGATGAAAAAGTCCATTCTTTCTGTGGCAA  102635

Query  840     ACGTTGGTTTCTTCTCCAGTGACCGTTGTAT  870
               ||||||| ||||| || || |||||||||||
Sbjct  102636  ACGTTGGATTCTTTTCGAGCGACCGTTGTAT  102666


> AEAS01000202  Kluyveromyces aestuarii ATCC 18862 contig00220, 
whole genome shotgun sequence
Length=20759

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  630    CAAAGGAGTTGGAGGAAGTGTTGCA  654
              ||| | ||||||||||| |||||||
Sbjct  20416  CAATGAAGTTGGAGGAAATGTTGCA  20440


> AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, 
whole genome shotgun sequence
Length=95829

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  485    GGTGGGTTGATCATTGGTACCG  506
              ||||  ||||||||||||||||
Sbjct  69636  GGTGCTTTGATCATTGGTACCG  69615


> AEAS01000136  Kluyveromyces aestuarii ATCC 18862 contig00142, 
whole genome shotgun sequence
Length=38619

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  844   TGGTTTCTTCTCCAGT  859
             ||||||||||||||||
Sbjct  8036  TGGTTTCTTCTCCAGT  8021


> AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, 
whole genome shotgun sequence
Length=81824

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  292    CAAGTTGATCAACAGTGTCAG  312
              |||||||||||||| ||| ||
Sbjct  36525  CAAGTTGATCAACATTGTAAG  36545


> AEAS01000023  Kluyveromyces aestuarii ATCC 18862 contig00025, 
whole genome shotgun sequence
Length=71608

 Score = 30.1 bits (32),  Expect = 7.1
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  803   AAGGAGTGGCTAAAGAAGTCCATTTT  828
             || ||| | ||||||||||| |||||
Sbjct  9614  AAAGAGAGTCTAAAGAAGTCGATTTT  9589



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8416172150


  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GCAGCACAACAAGCAAAAGCTTGCCGATTTGATCAAGAAGTTGTACGACGGCGAAGACATCATCGAAAGAGACCACATCAGAAACACCTTGTTCGACATCCAAGTGAAGCGTATTCACGAGTACAAGCGTCAACAGTTGAACATCTTTGGGTGCATCTACAGATACTTGCGGATCAAGGAGTTGTTGGCTGAAGGTGTCCCAATTGCCGAAGTGGAAAAGAAGTACCCAAGAAAGGTGTCCATCTTTGGTGGTAAGAGTGCTCCAGGTTACTACATGGCCAAGACGATTATCAAGTTGATCAACAGTGTCAGCGACGTGGTGAACCACGACAAGGAGATCGGGAACATCTTCAAGGTCGTGTTCATTCCAGACTACAACGTCTCCAAGGCAGAAATCATCATTCCTGCCAGTGACTTGAGTGAGCACATCTCTACCGCCGGTACCGAGGCCTCTGGTACATCCAACATGAAGTTTGTCATGAACGGTGGGTTGATCATTGGTACCGTGGACGGTGCCAACGTCGAGATCACCAGAGAAATTGGAGAGGACAACATCTTCTTGTTTGGTAACTTGGCCGAGAACGTTGACGAGTTGAGATACCAACACCAGTACCACGCCAAGCCATTGCCAAAGGAGTTGGAGGAAGTGTTGCAACTGATTGAGCGCGGCACTTTCGACGGTGACTTCAAGCCTTTGGTCGACTCTATCAGACACCACGGTGACTATTACTTAGTCAGTGACGATTTCCAATCCTACTTGCAAATGCAATCGATGGTCGATGACGTCTACCACAACAACAAGAAGGAGTGGCTAAAGAAGTCCATTTTGAGTGTTGCCAACGTTGGTTTCTTCTCCAGTGACCGTTGTATCCAGGA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)