blastn task: [no title]

Status
finished finished
Modified 2016-05-16T13:28:30Z
CPU time (s) 0.0
Size (bytes) 15365
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
           336 sequences; 9,910,115 total letters



Query= query

Length=922
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000322  Kluyveromyces aestuarii ATCC 18862 contig00658, w...   149    1e-35
  AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, w...  33.7    0.62 
  AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, w...  33.7    0.62 
  AEAS01000336  Kluyveromyces aestuarii ATCC 18862 contig00682, w...  31.9    2.1  
  AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, w...  31.9    2.1  
  AEAS01000207  Kluyveromyces aestuarii ATCC 18862 contig00226, w...  31.9    2.1  
  AEAS01000153  Kluyveromyces aestuarii ATCC 18862 contig00162, w...  31.9    2.1  
  AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, w...  31.9    2.1  
  AEAS01000066  Kluyveromyces aestuarii ATCC 18862 contig00070, w...  31.9    2.1  
  AEAS01000042  Kluyveromyces aestuarii ATCC 18862 contig00044, w...  31.9    2.1  
  AEAS01000247  Kluyveromyces aestuarii ATCC 18862 contig00548, w...  30.1    7.5  
  AEAS01000235  Kluyveromyces aestuarii ATCC 18862 contig00535, w...  30.1    7.5  
  AEAS01000234  Kluyveromyces aestuarii ATCC 18862 contig00534, w...  30.1    7.5  
  AEAS01000201  Kluyveromyces aestuarii ATCC 18862 contig00219, w...  30.1    7.5  
  AEAS01000132  Kluyveromyces aestuarii ATCC 18862 contig00138, w...  30.1    7.5  
  AEAS01000131  Kluyveromyces aestuarii ATCC 18862 contig00137, w...  30.1    7.5  
  AEAS01000122  Kluyveromyces aestuarii ATCC 18862 contig00128, w...  30.1    7.5  
  AEAS01000087  Kluyveromyces aestuarii ATCC 18862 contig00092, w...  30.1    7.5  
  AEAS01000084  Kluyveromyces aestuarii ATCC 18862 contig00088, w...  30.1    7.5  
  AEAS01000061  Kluyveromyces aestuarii ATCC 18862 contig00065, w...  30.1    7.5  
  AEAS01000040  Kluyveromyces aestuarii ATCC 18862 contig00042, w...  30.1    7.5  
  AEAS01000039  Kluyveromyces aestuarii ATCC 18862 contig00041, w...  30.1    7.5  
  AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, w...  30.1    7.5  
  AEAS01000031  Kluyveromyces aestuarii ATCC 18862 contig00033, w...  30.1    7.5  
  AEAS01000010  Kluyveromyces aestuarii ATCC 18862 contig00011, w...  30.1    7.5  


> AEAS01000322  Kluyveromyces aestuarii ATCC 18862 contig00658, 
whole genome shotgun sequence
Length=103820

 Score =  149 bits (164),  Expect = 1e-35
 Identities = 348/520 (67%), Gaps = 20/520 (3%)
 Strand=Plus/Plus

Query  184    TGTTTCCCCGGTGTAGTTTTCGCATCTCCATCCAAGAGTAAACCGGATTACTTTTACCAT  243
              ||| | || ||||| ||||||||||| || || || |  || || ||||| | ||| |||
Sbjct  27241  TGTGTTCCTGGTGTCGTTTTCGCATCGCCCTCAAAAAAAAATCCTGATTATTATTATCAT  27300

Query  244    TGGATTAGAGATGGCGCCATTACCATTAACACTTTGATCAACACATATTCGGAGGTCGAC  303
              |||||| ||||||| ||||| || ||||| || ||| | ||||   |||   | |  || 
Sbjct  27301  TGGATTCGAGATGGTGCCATCACTATTAATACGTTGGTGAACAATCATTTAAATGAAGAA  27360

Query  304    ----AAAGAACGCACTTTGAAAACAGTCTTAAACTACGTGAATGCTTCTATCGACTTGCA  359
                  | ||||| |    ||  |    ||||| | || || |||||   ||  || |||||
Sbjct  27361  TTTGATAGAACCCTTCATGTGA----TCTTACAATATGTTAATGCAAGTAAAGAATTGCA  27416

Query  360    ACATAGGTCTAATCCAAGTGGTCCCGTTGATGACCCACTATTGAGAAACTTGGGAGAACC  419
              |||||   |||| ||||| |||    | ||||| |||  ||| ||| |||||||||| ||
Sbjct  27417  ACATACTGCTAACCCAAGCGGTGATTTAGATGATCCAAAATTAAGATACTTGGGAGAGCC  27476

Query  420    TAAATACCATGTTGACAATTCGCCATTTGAACAGGTTTGGGGTAGACCACAAAATGATGG  479
               ||||  |||||| | |||     ||||||  | || ||||| |||||||||||||||||
Sbjct  27477  CAAATGGCATGTTAATAATAGCGTATTTGAGGATGTGTGGGGCAGACCACAAAATGATGG  27536

Query  480    ACCTCCATTAAGAGCCATTGCCTTGTTGAATTTCTTGAACTCAATGAATGTGTCCAGCAA  539
               ||| |  | |||   ||| |  |  | || ||||||||   |||  |||     |   |
Sbjct  27537  GCCTGCTCTTAGAAGTATTTCTCTAATTAACTTCTTGAATAAAATTCATG---ATATGGA  27593

Query  540    TAGCGATGCCAACAGTGATTACCAATGGATCTTT---GATGATTTAATTACATTGGACTT  596
              |   ||||  || |   |  |  | ||||| |||   |||| ||  |||||  | || ||
Sbjct  27594  T---GATGGGAATACAAAACATGACTGGATTTTTTCAGATG-TTGTATTAC--TTGATTT  27647

Query  597    GAAGTTTGTCTTGTACAACTGGCACGTCTCAAGCTTCGATTTGTGGGAAGAAGTTGATGC  656
              ||||||| | || |  || ||| |   | |    || ||||| |||||||||||  ||||
Sbjct  27648  GAAGTTTATTTTATTAAATTGGAATTCCACTTCTTTTGATTTATGGGAAGAAGTAAATGC  27707

Query  657    GTACCATTTCTTCACGAGTATGGTTCAATTGAAGGCTTTG  696
               || || || ||||| || ||||| ||| | ||||| |||
Sbjct  27708  ATATCACTTTTTCACAAGCATGGTACAACTTAAGGCATTG  27747


> AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, 
whole genome shotgun sequence
Length=72341

 Score = 33.7 bits (36),  Expect = 0.62
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  60     CCCATTTTCAAAAAATATTTC  80
              |||||||||||| ||||||||
Sbjct  39209  CCCATTTTCAAACAATATTTC  39189


> AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, 
whole genome shotgun sequence
Length=81824

 Score = 33.7 bits (36),  Expect = 0.62
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  854    ATATTGTGGAGACACCAAGTAACTTG  879
              |||||||||||||||||  ||| |||
Sbjct  48003  ATATTGTGGAGACACCAGCTAATTTG  48028


> AEAS01000336  Kluyveromyces aestuarii ATCC 18862 contig00682, 
whole genome shotgun sequence
Length=139775

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  719    TGAAAAAACTTTCAAGCGGTAT  740
              ||||| || |||||||||||||
Sbjct  77568  TGAAAGAATTTTCAAGCGGTAT  77547


> AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, 
whole genome shotgun sequence
Length=151927

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  798     GGTGGAATCCTTCATCAAGAGT  819
               ||| |||| |||||||||||||
Sbjct  147116  GGTCGAATTCTTCATCAAGAGT  147137


> AEAS01000207  Kluyveromyces aestuarii ATCC 18862 contig00226, 
whole genome shotgun sequence
Length=15240

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  822    CAGTTCCGGATTTATTAACCAT  843
              |||| |||||||||||||| ||
Sbjct  11745  CAGTGCCGGATTTATTAACTAT  11724


> AEAS01000153  Kluyveromyces aestuarii ATCC 18862 contig00162, 
whole genome shotgun sequence
Length=43652

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  229   GATTACTTTTACCATTGGAT  248
             || |||||||||||||||||
Sbjct  6077  GAGTACTTTTACCATTGGAT  6058


> AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, 
whole genome shotgun sequence
Length=165313

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  276     TTTGATCAACACATATT  292
               |||||||||||||||||
Sbjct  160196  TTTGATCAACACATATT  160212


> AEAS01000066  Kluyveromyces aestuarii ATCC 18862 contig00070, 
whole genome shotgun sequence
Length=49444

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  728    TTTCAAGCGGTATTACATTA  747
              ||| ||||||||||||||||
Sbjct  22420  TTTTAAGCGGTATTACATTA  22439


> AEAS01000042  Kluyveromyces aestuarii ATCC 18862 contig00044, 
whole genome shotgun sequence
Length=70813

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  501    CTTGTTGAATTTCTTGA  517
              |||||||||||||||||
Sbjct  15805  CTTGTTGAATTTCTTGA  15789


> AEAS01000247  Kluyveromyces aestuarii ATCC 18862 contig00548, 
whole genome shotgun sequence
Length=33401

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  93     CAACCAATGGTTGAAG  108
              ||||||||||||||||
Sbjct  17140  CAACCAATGGTTGAAG  17125


> AEAS01000235  Kluyveromyces aestuarii ATCC 18862 contig00535, 
whole genome shotgun sequence
Length=66971

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  510    TTTCTTGAACTCAATG  525
              ||||||||||||||||
Sbjct  15274  TTTCTTGAACTCAATG  15289


> AEAS01000234  Kluyveromyces aestuarii ATCC 18862 contig00534, 
whole genome shotgun sequence
Length=70289

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  601    TTTGTCTTGTACAACTGGCACGTCTC  626
              || ||||| | | |||||||||||||
Sbjct  52671  TTCGTCTTCTTCTACTGGCACGTCTC  52696


> AEAS01000201  Kluyveromyces aestuarii ATCC 18862 contig00219, 
whole genome shotgun sequence
Length=11697

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  757   GAAGATGATCTCTTGAAAGAT  777
             || ||||| ||||||||||||
Sbjct  1265  GATGATGAGCTCTTGAAAGAT  1245


> AEAS01000132  Kluyveromyces aestuarii ATCC 18862 contig00138, 
whole genome shotgun sequence
Length=91365

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  159    AGAATCGTCAGGAAAATTCGA  179
              |||||  ||||||||||||||
Sbjct  43661  AGAATAATCAGGAAAATTCGA  43681


> AEAS01000131  Kluyveromyces aestuarii ATCC 18862 contig00137, 
whole genome shotgun sequence
Length=95076

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  571    TTTGATGATTTAATTACAT  589
              |||||| ||||||||||||
Sbjct  65151  TTTGATCATTTAATTACAT  65133


> AEAS01000122  Kluyveromyces aestuarii ATCC 18862 contig00128, 
whole genome shotgun sequence
Length=129885

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  216   CAAGAGTAAACCGGATTACTT  236
             |||||| ||||||||||| ||
Sbjct  7572  CAAGAGCAAACCGGATTAATT  7552


> AEAS01000087  Kluyveromyces aestuarii ATCC 18862 contig00092, 
whole genome shotgun sequence
Length=166145

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  504    GTTGAATTTCTTGAACTCAAT  524
              ||||||||||||| | |||||
Sbjct  92957  GTTGAATTTCTTGGAATCAAT  92937


 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  823     AGTTCCGGATTTATTAACC  841
               ||||| |||||||||||||
Sbjct  100241  AGTTCTGGATTTATTAACC  100223


> AEAS01000084  Kluyveromyces aestuarii ATCC 18862 contig00088, 
whole genome shotgun sequence
Length=48776

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  228    GGATTACTTTTACCATTGGATTAG  251
              ||| | ||||||||||||||| ||
Sbjct  37284  GGAGTCCTTTTACCATTGGATAAG  37261


> AEAS01000061  Kluyveromyces aestuarii ATCC 18862 contig00065, 
whole genome shotgun sequence
Length=34095

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  85    ACCGATTTCAACCAAT  100
             ||||||||||||||||
Sbjct  3736  ACCGATTTCAACCAAT  3721


> AEAS01000040  Kluyveromyces aestuarii ATCC 18862 contig00042, 
whole genome shotgun sequence
Length=20281

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  68     CAAAAAATATTTCTAGAAC  86
              |||||||||||| ||||||
Sbjct  9987   CAAAAAATATTTTTAGAAC  10005


> AEAS01000039  Kluyveromyces aestuarii ATCC 18862 contig00041, 
whole genome shotgun sequence
Length=15675

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  667    TTCACGAGTATGGTTC  682
              ||||||||||||||||
Sbjct  14724  TTCACGAGTATGGTTC  14709


> AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, 
whole genome shotgun sequence
Length=106698

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  65     TTTCAAAAAATATTTC  80
              ||||||||||||||||
Sbjct  17432  TTTCAAAAAATATTTC  17447


> AEAS01000031  Kluyveromyces aestuarii ATCC 18862 contig00033, 
whole genome shotgun sequence
Length=124751

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  762     TGATCTCTTGAAAGATCTTGA  782
               ||||||||||||||  |||||
Sbjct  103041  TGATCTCTTGAAAGCGCTTGA  103021


> AEAS01000010  Kluyveromyces aestuarii ATCC 18862 contig00011, 
whole genome shotgun sequence
Length=66885

 Score = 30.1 bits (32),  Expect = 7.5
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  273    CACTTTGATCAACACATAT  291
              |||||| ||||||||||||
Sbjct  32427  CACTTTTATCAACACATAT  32445



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8871635584


  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GGTCAATATATACAAGTAATTGACTTTAACAAGGTCTCCGACTTTCAACTTCAACCGATCCCATTTTCAAAAAATATTTCTAGAACCGATTTCAACCAATGGTTGAAGGACCAGGAACGAGTTTCGTTTGAACGTATGTTCGATAATATTTGCAACGAAGAATCGTCAGGAAAATTCGACAACTGTTTCCCCGGTGTAGTTTTCGCATCTCCATCCAAGAGTAAACCGGATTACTTTTACCATTGGATTAGAGATGGCGCCATTACCATTAACACTTTGATCAACACATATTCGGAGGTCGACAAAGAACGCACTTTGAAAACAGTCTTAAACTACGTGAATGCTTCTATCGACTTGCAACATAGGTCTAATCCAAGTGGTCCCGTTGATGACCCACTATTGAGAAACTTGGGAGAACCTAAATACCATGTTGACAATTCGCCATTTGAACAGGTTTGGGGTAGACCACAAAATGATGGACCTCCATTAAGAGCCATTGCCTTGTTGAATTTCTTGAACTCAATGAATGTGTCCAGCAATAGCGATGCCAACAGTGATTACCAATGGATCTTTGATGATTTAATTACATTGGACTTGAAGTTTGTCTTGTACAACTGGCACGTCTCAAGCTTCGATTTGTGGGAAGAAGTTGATGCGTACCATTTCTTCACGAGTATGGTTCAATTGAAGGCTTTGGTCGATGGTAGAGCATTCATACTGAAAAAACTTTCAAGCGGTATTACATTAACTAGTGCGGAAGATGATCTCTTGAAAGATCTTGAGGCTGGTATCGATAAGGTGGAATCCTTCATCAAGAGTTCCAGTTCCGGATTTATTAACCATGAAAAGGGCTATATTGTGGAGACACCAAGTAACTTGGACCAAAGGTCTGGTTTAGATATCGCAGTCATTATGGCCAGTA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)