blastn task: [no title]

Status
finished finished
Modified 2016-05-16T11:41:25Z
CPU time (s) 0.0
Size (bytes) 17518
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
           510 sequences; 9,807,744 total letters



Query= 
Length=864
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAV01000156  Kluyveromyces wickerhamii UCD 54-210 contig00162,...   946    0.0  
  AEAV01000047  Kluyveromyces wickerhamii UCD 54-210 contig00050,...  35.6    0.16 
  AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213,...  33.7    0.57 
  AEAV01000277  Kluyveromyces wickerhamii UCD 54-210 contig00288,...  31.9    2.0  
  AEAV01000237  Kluyveromyces wickerhamii UCD 54-210 contig00248,...  31.9    2.0  
  AEAV01000220  Kluyveromyces wickerhamii UCD 54-210 contig00231,...  31.9    2.0  
  AEAV01000164  Kluyveromyces wickerhamii UCD 54-210 contig00171,...  31.9    2.0  
  AEAV01000098  Kluyveromyces wickerhamii UCD 54-210 contig00102,...  31.9    2.0  
  AEAV01000479  Kluyveromyces wickerhamii UCD 54-210 contig00903,...  30.1    6.9  
  AEAV01000471  Kluyveromyces wickerhamii UCD 54-210 contig00889,...  30.1    6.9  
  AEAV01000420  Kluyveromyces wickerhamii UCD 54-210 contig00823,...  30.1    6.9  
  AEAV01000342  Kluyveromyces wickerhamii UCD 54-210 contig00354,...  30.1    6.9  
  AEAV01000300  Kluyveromyces wickerhamii UCD 54-210 contig00311,...  30.1    6.9  
  AEAV01000285  Kluyveromyces wickerhamii UCD 54-210 contig00296,...  30.1    6.9  
  AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283,...  30.1    6.9  
  AEAV01000266  Kluyveromyces wickerhamii UCD 54-210 contig00277,...  30.1    6.9  
  AEAV01000233  Kluyveromyces wickerhamii UCD 54-210 contig00244,...  30.1    6.9  
  AEAV01000216  Kluyveromyces wickerhamii UCD 54-210 contig00227,...  30.1    6.9  
  AEAV01000190  Kluyveromyces wickerhamii UCD 54-210 contig00197,...  30.1    6.9  
  AEAV01000141  Kluyveromyces wickerhamii UCD 54-210 contig00147,...  30.1    6.9  
  AEAV01000085  Kluyveromyces wickerhamii UCD 54-210 contig00089,...  30.1    6.9  
  AEAV01000078  Kluyveromyces wickerhamii UCD 54-210 contig00082,...  30.1    6.9  
  AEAV01000073  Kluyveromyces wickerhamii UCD 54-210 contig00077,...  30.1    6.9  
  AEAV01000069  Kluyveromyces wickerhamii UCD 54-210 contig00073,...  30.1    6.9  
  AEAV01000031  Kluyveromyces wickerhamii UCD 54-210 contig00033,...  30.1    6.9  
  AEAV01000027  Kluyveromyces wickerhamii UCD 54-210 contig00029,...  30.1    6.9  
  AEAV01000002  Kluyveromyces wickerhamii UCD 54-210 contig00002,...  30.1    6.9  


> AEAV01000156  Kluyveromyces wickerhamii UCD 54-210 contig00162, 
whole genome shotgun sequence
Length=71611

 Score =  946 bits (1048),  Expect = 0.0
 Identities = 728/864 (85%), Gaps = 0/864 (0%)
 Strand=Plus/Plus

Query  1      ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATC  60
              ||||||||  ||||||||||| | ||||||||||||||| | ||||||||||||||||||
Sbjct  69476  ATGTCTTATTCTACCAGACAAGTTGGTGCCAAGAACACCCTAGACTACAAAGTTTTCATC  69535

Query  61     GAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCC  120
              || |||||||| ||||| || || || ||||||||| | |||||||| |||||||| |||
Sbjct  69536  GAGAAGGATGGTAAGCCTGTTTCCGCTTTCCACGACGTTCCATTGTATGCTGACGAGGCC  69595

Query  121    AATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATC  180
              || || |||||||||||| |||| || || || ||||||||||| |||||||||||||| 
Sbjct  69596  AACGGGATCTTCAACATGATTGTAGAGATTCCTCGTTGGACCAATGCCAAGTTGGAAATT  69655

Query  181    ACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTT  240
              |||||||| || |  |||||||| |||||||| |||||||||||||| ||  | ||||| 
Sbjct  69656  ACCAAGGAAGAAACTTTGAACCCTATCATCCAGGACACCAAGAAGGGGAAATTGAGATTC  69715

Query  241    GTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACC  300
              ||||||||||||||||| |||||||| ||||| |||||||||||||| ||||| || || 
Sbjct  69716  GTGAGAAACTGTTTCCCTCACCACGGGTACATTCACAACTACGGTGCGTTCCCTCAGACA  69775

Query  301    TGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTG  360
              ||||| || ||||||||| | ||||| || || ||||| || || |||||||||||||||
Sbjct  69776  TGGGAGGACCCTAACGAGGCTCACCCGGAGACTAAGGCAGTCGGAGACAACGATCCATTG  69835

Query  361    GATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTT  420
              ||||||||||| |||||||| || || || ||||| || ||||| ||||| || || || 
Sbjct  69836  GATGTGTTGGAGATCGGTGAGCAGGTTGCGTACACCGGCCAAGTCAAGCAGGTGAAAGTG  69895

Query  421    CTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGAC  480
               | ||||||||||| ||||||||||| || ||||| |||||||||||||| | |||||||
Sbjct  69896  TTGGGTGTGATGGCATTGTTGGACGAGGGCGAGACTGACTGGAAGGTGATCGCGATCGAC  69955

Query  481    ATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCA  540
              ||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||
Sbjct  69956  ATCAACGATCCATTGGCGCCCAAGTTGAACGACATCGAGGATGTCGAGAAGCACTTGCCA  70015

Query  541    GGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCA  600
              || ||| | |||||||| |||||||||||||||||||||||||| || ||||| ||||| 
Sbjct  70016  GGCTTGTTGAGAGCCACGAACGAATGGTTCAGAATCTACAAGATCCCTGACGGCAAGCCG  70075

Query  601    GAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATC  660
              || ||||| || || || || || || |||||||||||||||||| |  | || || |||
Sbjct  70076  GAGAACCAGTTCGCGTTTTCAGGCGAGGCCAAGAACAAGAAGTACACCTTGGAGGTCATC  70135

Query  661    AGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAG  720
              || ||||||||||| || ||||||||| |||| || || |||||||| ||||| ||||||
Sbjct  70136  AGAGAGTGTAACGAGGCGTGGAAGAAGCTGATCTCGGGCAAGTCTGCGGACGCCAAGAAG  70195

Query  721    ATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCT  780
              ||||| ||||||||||| ||||||  ||||||  | || | |||||  |  || || || 
Sbjct  70196  ATCGACTTGACCAACACGACGTTGAGCGACACGCCAACGTTCTCTGTGGCCGCGGCCGCG  70255

Query  781    GCTGTTCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGG  840
              || || ||| | ||  |||| ||||| |||||||| ||||||||||| || |||||||||
Sbjct  70256  GCCGTGCCAGCTGCCAACGTGTTGCCCGACGAGCCGATCGACAAGTCGATCGACAAGTGG  70315

Query  841    TTCTTCATCTCCGGTTCTGCTTGA  864
              ||||| |||||||| |||||||||
Sbjct  70316  TTCTTTATCTCCGGCTCTGCTTGA  70339


> AEAV01000047  Kluyveromyces wickerhamii UCD 54-210 contig00050, 
whole genome shotgun sequence
Length=54078

 Score = 35.6 bits (38),  Expect = 0.16
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  334    AAGGCTGTTGGTGACAACGATCCA  357
              ||||||||||||||||| | ||||
Sbjct  17284  AAGGCTGTTGGTGACAAGGTTCCA  17261


> AEAV01000205  Kluyveromyces wickerhamii UCD 54-210 contig00213, 
whole genome shotgun sequence
Length=85282

 Score = 33.7 bits (36),  Expect = 0.57
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  511    GACATTGAGGATGTCGAG  528
              ||||||||||||||||||
Sbjct  19791  GACATTGAGGATGTCGAG  19808


> AEAV01000277  Kluyveromyces wickerhamii UCD 54-210 contig00288, 
whole genome shotgun sequence
Length=11460

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  199   AACCCAATCATCCAAGACACCA  220
             ||| |||||||||||||| |||
Sbjct  4616  AACACAATCATCCAAGACTCCA  4637


> AEAV01000237  Kluyveromyces wickerhamii UCD 54-210 contig00248, 
whole genome shotgun sequence
Length=62804

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  677    CTTGGAAGAAGTTGATT  693
              |||||||||||||||||
Sbjct  52527  CTTGGAAGAAGTTGATT  52543


> AEAV01000220  Kluyveromyces wickerhamii UCD 54-210 contig00231, 
whole genome shotgun sequence
Length=42794

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  621    TGGTGAAGCCAAGAACAAGA  640
              || |||||||||||||||||
Sbjct  17503  TGATGAAGCCAAGAACAAGA  17522


 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  59     TCGAAAAGGATGGCAA  74
              ||||||||||||||||
Sbjct  19293  TCGAAAAGGATGGCAA  19278


> AEAV01000164  Kluyveromyces wickerhamii UCD 54-210 contig00171, 
whole genome shotgun sequence
Length=36959

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  159   GACCAACGCCAAGTTGG  175
             |||||||||||||||||
Sbjct  5306  GACCAACGCCAAGTTGG  5290


> AEAV01000098  Kluyveromyces wickerhamii UCD 54-210 contig00102, 
whole genome shotgun sequence
Length=15792

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  47    ACAAAGTTTTCATCGAAAAG  66
             |||||||| |||||||||||
Sbjct  7033  ACAAAGTTATCATCGAAAAG  7052


> AEAV01000479  Kluyveromyces wickerhamii UCD 54-210 contig00903, 
whole genome shotgun sequence
Length=60100

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  242    TGAGAAACTGTTTCCC  257
              ||||||||||||||||
Sbjct  28578  TGAGAAACTGTTTCCC  28563


> AEAV01000471  Kluyveromyces wickerhamii UCD 54-210 contig00889, 
whole genome shotgun sequence
Length=92975

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  114    CGAAGCCAATGGTATCTTCAA  134
              ||| |||||||||||||| ||
Sbjct  13296  CGATGCCAATGGTATCTTGAA  13316


> AEAV01000420  Kluyveromyces wickerhamii UCD 54-210 contig00823, 
whole genome shotgun sequence
Length=45284

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  602   AAAACCAATTTGCCTT  617
             ||||||||||||||||
Sbjct  3760  AAAACCAATTTGCCTT  3775


> AEAV01000342  Kluyveromyces wickerhamii UCD 54-210 contig00354, 
whole genome shotgun sequence
Length=1422

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  621  TGGTGAAGCCAAGAACAAGAA  641
            ||| |||| ||||||||||||
Sbjct  545  TGGCGAAGTCAAGAACAAGAA  525


> AEAV01000300  Kluyveromyces wickerhamii UCD 54-210 contig00311, 
whole genome shotgun sequence
Length=18757

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  838   TGGTTCTTCATCTCCGGTTCT  858
             ||||| || ||||||||||||
Sbjct  6700  TGGTTTTTGATCTCCGGTTCT  6720


> AEAV01000285  Kluyveromyces wickerhamii UCD 54-210 contig00296, 
whole genome shotgun sequence
Length=54334

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  765    TGCCGAGGCAGCTGCTGCTGT  785
              ||||||||  |||||||||||
Sbjct  52907  TGCCGAGGGTGCTGCTGCTGT  52927


> AEAV01000272  Kluyveromyces wickerhamii UCD 54-210 contig00283, 
whole genome shotgun sequence
Length=32523

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  200    ACCCAATCATCCAAGA  215
              ||||||||||||||||
Sbjct  19894  ACCCAATCATCCAAGA  19879


> AEAV01000266  Kluyveromyces wickerhamii UCD 54-210 contig00277, 
whole genome shotgun sequence
Length=9668

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  633   GAACAAGAAGTACGCTCTAGAAGTGA  658
             ||||| ||||   |||||||||||||
Sbjct  5820  GAACACGAAGGTGGCTCTAGAAGTGA  5795


> AEAV01000233  Kluyveromyces wickerhamii UCD 54-210 contig00244, 
whole genome shotgun sequence
Length=58931

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  175    GAAATCACCAAGGAGGAGA  193
              || ||||||||||||||||
Sbjct  45556  GACATCACCAAGGAGGAGA  45574


> AEAV01000216  Kluyveromyces wickerhamii UCD 54-210 contig00227, 
whole genome shotgun sequence
Length=67392

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  508    AACGACATTGAGGATGTCGAG  528
              ||||||||||||||| | |||
Sbjct  36195  AACGACATTGAGGATTTTGAG  36175


> AEAV01000190  Kluyveromyces wickerhamii UCD 54-210 contig00197, 
whole genome shotgun sequence
Length=24243

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  178    ATCACCAAGGAGGAGA  193
              ||||||||||||||||
Sbjct  23101  ATCACCAAGGAGGAGA  23086


> AEAV01000141  Kluyveromyces wickerhamii UCD 54-210 contig00147, 
whole genome shotgun sequence
Length=11038

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  162   CAACGCCAAGTTGGAA  177
             ||||||||||||||||
Sbjct  4345  CAACGCCAAGTTGGAA  4330


> AEAV01000085  Kluyveromyces wickerhamii UCD 54-210 contig00089, 
whole genome shotgun sequence
Length=92438

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  325    CCAGAAACCAAGGCTG  340
              ||||||||||||||||
Sbjct  34120  CCAGAAACCAAGGCTG  34105


> AEAV01000078  Kluyveromyces wickerhamii UCD 54-210 contig00082, 
whole genome shotgun sequence
Length=66720

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  705    TGCTGACGCTAAGAAGATCGA  725
              |||||||||||||||  ||||
Sbjct  63617  TGCTGACGCTAAGAAATTCGA  63597


> AEAV01000073  Kluyveromyces wickerhamii UCD 54-210 contig00077, 
whole genome shotgun sequence
Length=59958

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  115    GAAGCCAATGGTATCTTCAAC  135
              || |||||||||||||| |||
Sbjct  59476  GACGCCAATGGTATCTTGAAC  59496


> AEAV01000069  Kluyveromyces wickerhamii UCD 54-210 contig00073, 
whole genome shotgun sequence
Length=12611

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  623  GTGAAGCCAAGAACAAGAAGT  643
            ||||||||||||||  |||||
Sbjct  576  GTGAAGCCAAGAACTCGAAGT  556


> AEAV01000031  Kluyveromyces wickerhamii UCD 54-210 contig00033, 
whole genome shotgun sequence
Length=26237

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  184    AAGGAGGAGAAGTTGAACCCA  204
              ||||||||||| ||||| |||
Sbjct  21035  AAGGAGGAGAATTTGAAACCA  21015


> AEAV01000027  Kluyveromyces wickerhamii UCD 54-210 contig00029, 
whole genome shotgun sequence
Length=22505

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  567   GTTCAGAATCTACAAGATTCC  587
             |||||||||||| || |||||
Sbjct  3972  GTTCAGAATCTAAAACATTCC  3992


> AEAV01000002  Kluyveromyces wickerhamii UCD 54-210 contig00002, 
whole genome shotgun sequence
Length=27796

 Score = 30.1 bits (32),  Expect = 6.9
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  188    AGGAGAAGTTGAACCCAAT  206
              |||| ||||||||||||||
Sbjct  18494  AGGATAAGTTGAACCCAAT  18476



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8207777592


  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>
ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGTTCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTTCATCTCCGGTTCTGCTTGA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)