blastn task: [no title]

Status
finished finished
Modified 2016-05-16T11:44:29Z
CPU time (s) 0.0
Size (bytes) 15947
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_lactis_Y-1140.fna -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces lactis NRRL Y-1140
           7 sequences; 10,729,447 total letters



Query= 
Length=864
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  1117    0.0  
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    0.18 
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  35.6    0.18 
  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  33.7    0.62 
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    2.2  
  gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 c...  31.9    2.2  


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 1117 bits (1238),  Expect = 0.0
 Identities = 762/857 (89%), Gaps = 0/857 (0%)
 Strand=Plus/Minus

Query  6        TTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAA  65
                ||||||||| |||||| | |||||||||||  ||||||| ||||| |||| ||| |||||
Sbjct  1570108  TTACACTACTAGACAAGTTGGTGCCAAGAATTCCTTGGATTACAAGGTTTACATTGAAAA  1570049

Query  66       GGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGG  125
                |||||| |||||| | ||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct  1570048  GGATGGTAAGCCAATTTCTGCTTTCCACGACATCCCATTGTATGCTGATGAAGCCAATGG  1569989

Query  126      TATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAA  185
                |||||||||||||||||| ||||| |||||||||||||| |||||||||||||| |||||
Sbjct  1569988  TATCTTCAACATGGTTGTTGAAATTCCACGTTGGACCAATGCCAAGTTGGAAATTACCAA  1569929

Query  186      GGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAG  245
                ||| |||   ||||||||||| || ||||||||||||||||||||| |||||||||| ||
Sbjct  1569928  GGAAGAGCCATTGAACCCAATTATTCAAGACACCAAGAAGGGTAAGTTAAGATTTGTTAG  1569869

Query  246      AAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGA  305
                ||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||
Sbjct  1569868  AAACTGTTTCCCACATCACGGTTACATTCACAACTACGGTGCCTTCCCACAAACATGGGA  1569809

Query  306      AGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
                |||||| ||||| || |||||||| || ||||||||||||||||||||||||||||||||
Sbjct  1569808  AGATCCAAACGAATCTCACCCAGAGACTAAGGCTGTTGGTGACAACGATCCATTGGATGT  1569749

Query  366      GTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
                 |||||||||||||| ||||| || ||||||||||||||||| |||||||||||||||||
Sbjct  1569748  CTTGGAAATCGGTGAGCAAGTTGCTTACACTGGTCAAGTGAAACAAGTCAAGGTTCTTGG  1569689

Query  426      TGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAA  485
                ||| ||||| ||||||||||||||||| || ||||||||||| ||||  ||||| || ||
Sbjct  1569688  TGTTATGGCATTGTTGGACGAAGGTGAAACTGACTGGAAGGTCATTGCCATCGATATTAA  1569629

Query  486      CGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTT  545
                |||||||||||| || |||||||||||||| || ||||| || ||||| || ||||||||
Sbjct  1569628  CGATCCATTGGCTCCTAAGTTGAACGACATCGAAGATGTTGAAAAGCATTTACCAGGTTT  1569569

Query  546      GCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAA  605
                | | |||||||| || ||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct  1569568  GTTGAGAGCCACCAATGAATGGTTCAGAATCTACAAGATCCCAGATGGTAAGCCAGAAAA  1569509

Query  606      CCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGA  665
                ||||||||||||||| |||||||||||||||||||||||| |  | || || ||||| ||
Sbjct  1569508  CCAATTTGCCTTCTCCGGTGAAGCCAAGAACAAGAAGTACACCTTGGACGTCATCAGAGA  1569449

Query  666      GTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGA  725
                 ||||||||||| ||||||||||||||||| |||||||||||||| || |||||||||||
Sbjct  1569448  ATGTAACGAAGCCTGGAAGAAGTTGATTTCTGGTAAGTCTGCTGATGCCAAGAAGATCGA  1569389

Query  726      TTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGT  785
                 ||||| |||||||| |||   |||||||| |||||||| ||||| || ||  |||||||
Sbjct  1569388  CTTGACTAACACCACTTTGTCTGACACTGCTACTTACTCAGCCGAAGCTGCCTCTGCTGT  1569329

Query  786      TCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
                |||| | ||  ||||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct  1569328  TCCAGCTGCTAACGTCTTGCCAGATGAACCAATCGACAAGTCCATTGACAAATGGTTCTT  1569269

Query  846      CATCTCCGGTTCTGCTT  862
                |||||||||||||||||
Sbjct  1569268  CATCTCCGGTTCTGCTT  1569252


 Score = 95.1 bits (104),  Expect = 2e-19
 Identities = 310/468 (67%), Gaps = 29/468 (6%)
 Strand=Plus/Minus

Query  133     AACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAG  192
               |||||| | || ||  | ||||||||||  || |  ||||| |||||||  |||   || 
Sbjct  975769  AACATGATCGTAGAGGTTCCACGTTGGAGTAATGGGAAGTTTGAAATCAGTAAGACCGAA  975710

Query  193     AAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAACTGT  252
                  || ||||| ||||  || ||||  ||||| || |||| | ||||||| |  |||  |
Sbjct  975709  CCATTTAACCCCATCACACAGGACATAAAGAAAGGCAAGCCACGATTTGTCAATAACATT  975650

Query  253     TTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCC-  311
               |||||  |||| || ||||| || ||||| || ||  ||||||| || |||||| | || 
Sbjct  975649  TTCCCTTACCATGGATACATTCATAACTATGGGGCTATCCCACAGACATGGGAACAGCCA  975590

Query  312     --TAACGA-GTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTGTT  368
                 ||  || ||    ||| |   | ||||      |||| || || ||||||||  ||||
Sbjct  975589  CTTATTGAAGTATTGCCCGGTTTC-AAGG------GTGATAATGACCCATTGGAC-TGTT  975538

Query  369     G-GAAATCGGTGAACAAG--TCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGG  425
               | ||||| |||   | ||  ||||  | |  ||  |  | ||  |||| ||| |||| ||
Sbjct  975537  GTGAAATTGGTT--CCAGCATCGCCAAAATGGGAGATATCAAAAAAGTAAAGCTTCTAGG  975480

Query  426     TGTGATG-GCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCA  484
                || ||  ||| |  | ||||| || ||   ||| ||||| || |||   ||||||||  
Sbjct  975479  -GTCATTAGCCCTCATTGACGATGGAGAACTCGATTGGAAAGTCATTTGTATCGACATTG  975421

Query  485     ACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACT----TGCCA  540
               | |||||  | ||   ||| |||||| |  | |  ||||| ||    ||||    |||| 
Sbjct  975420  AAGATCCCATTGCTATAAAATTGAACAAGTTGGCAGATGTAGA----CACTGTTATGCCT  975365

Query  541     GGTTTGCTAAGA-GCCACTAACGAATGGTTCAGAATCTACAAGATTCC  587
               ||| | ||  || || ||||    ||||||||||   |||||||||||
Sbjct  975364  GGTCT-CTTGGATGCAACTAGAACATGGTTCAGAGATTACAAGATTCC  975318


 Score = 33.7 bits (36),  Expect = 0.62
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  766      GCCGAGGCAGCTGCTGCTGTT  786
                || ||||||||||||||||||
Sbjct  1860677  GCAGAGGCAGCTGCTGCTGTT  1860657


 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  821     ACAAGTCCATTGACAAGTGGTTCTTCA  847
               ||| |||||||||||||| | || |||
Sbjct  664099  ACAGGTCCATTGACAAGTCGATCATCA  664073


 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  820     GACAAGTCCATTGACAA  836
               |||||||||||||||||
Sbjct  734501  GACAAGTCCATTGACAA  734517


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  536     TGCCAGGTTTGCTAAGAGC  554
               |||||| ||||||||||||
Sbjct  257131  TGCCAGCTTTGCTAAGAGC  257149


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 35.6 bits (38),  Expect = 0.18
 Identities = 26/29 (90%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  508      AACGACATTGAGGATGTCGAGAAGCACTT  536
                || |||||||| ||||||||||| |||||
Sbjct  2304720  AAAGACATTGAAGATGTCGAGAA-CACTT  2304747


 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 25/30 (84%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  120      CAATGGTATCTTCAACATGGTTGTCGAAAT  149
                || ||||||||||||||   || |||||||
Sbjct  2240937  CAGTGGTATCTTCAACAACTTTTTCGAAAT  2240908


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  365      TGTTGGAAATCGGTGA  380
                ||||||||||||||||
Sbjct  1491770  TGTTGGAAATCGGTGA  1491755


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 35.6 bits (38),  Expect = 0.18
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  359     TGGATGTGTTGGAAATCGGTGAACAAG  385
               || ||||||||||||| | ||||||||
Sbjct  652066  TGAATGTGTTGGAAATAGATGAACAAG  652092


 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  339     TGTTGGTGACAACGATCCATTGGATGT  365
               || || || ||| ||||||||||||||
Sbjct  248123  TGCTGATGTCAAGGATCCATTGGATGT  248097


 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 24/27 (89%), Gaps = 1/27 (3%)
 Strand=Plus/Plus

Query  616      TTCT-CTGGTGAAGCCAAGAACAAGAA  641
                |||| ||| ||| ||||||||||||||
Sbjct  1183122  TTCTGCTGATGATGCCAAGAACAAGAA  1183148


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  670    AACGAAGCTTGGAAGAAGT  688
              |||||| ||||||||||||
Sbjct  55359  AACGAACCTTGGAAGAAGT  55377


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  624    TGAAGCCAAGAACAAGAAG  642
              |||||||||||| ||||||
Sbjct  80083  TGAAGCCAAGAATAAGAAG  80065


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  624     TGAAGCCAAGAACAAG  639
               ||||||||||||||||
Sbjct  656334  TGAAGCCAAGAACAAG  656319


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  838     TGGTTCTTCATCTCCGGTT  856
               ||| |||||||||||||||
Sbjct  810799  TGGATCTTCATCTCCGGTT  810817


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 33.7 bits (36),  Expect = 0.62
 Identities = 23/25 (92%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  357     ATTGGATGTGTTGGAAATCGGTGAA  381
               ||||||| ||||||||||| |||||
Sbjct  106138  ATTGGATTTGTTGGAAATC-GTGAA  106161


 Score = 33.7 bits (36),  Expect = 0.62
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  764     CTGCCGAGGCAGCTGCTGCTGTT  786
               |||| | ||||||||||||||||
Sbjct  500817  CTGCAGCGGCAGCTGCTGCTGTT  500795


 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  216      CACCAAGAAGGGTAAGCTAAGA  237
                ||||||||||||||||  ||||
Sbjct  1188112  CACCAAGAAGGGTAAGAGAAGA  1188133


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  122     ATGGTATCTTCAACATGGTTGTCG  145
               |||||||||||||  || ||||||
Sbjct  736114  ATGGTATCTTCAATTTGCTTGTCG  736091


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  604     AACCAATTTGCCTTCT  619
               ||||||||||||||||
Sbjct  907804  AACCAATTTGCCTTCT  907789


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  627      AGCCAAGAACAAGAAG  642
                ||||||||||||||||
Sbjct  1267091  AGCCAAGAACAAGAAG  1267076


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  223      AAGGGTAAGCTAAGATTTG  241
                |||| ||||||||||||||
Sbjct  1686762  AAGGTTAAGCTAAGATTTG  1686744


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  51      AGTTTTCATCGAAAAGGATG  70
               || |||||||||||||||||
Sbjct  917517  AGATTTCATCGAAAAGGATG  917536


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  762      CTCTGCCGAGGCAGCTGCTGCTGT  785
                |||||||   ||||||||||||||
Sbjct  1030533  CTCTGCCTTCGCAGCTGCTGCTGT  1030556


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  268     TACATCCACAACTACGG  284
               |||||||||||||||||
Sbjct  715463  TACATCCACAACTACGG  715479


 Score = 31.9 bits (34),  Expect = 2.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  249     CTGTTTCCCACACCACG  265
               |||||||||||||||||
Sbjct  989635  CTGTTTCCCACACCACG  989651


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  562     GAATGGTTCAGAATCTACAAG  582
               |||||||||||||| || |||
Sbjct  266708  GAATGGTTCAGAATATATAAG  266728


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  504     GTTGAACGACATTGAGGATGT  524
               ||||||||||||||  |||||
Sbjct  928244  GTTGAACGACATTGTTGATGT  928264


 Score = 30.1 bits (32),  Expect = 7.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  49       AAAGTTTTCATCGAAA  64
                ||||||||||||||||
Sbjct  1028327  AAAGTTTTCATCGAAA  1028312



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8991124070


  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>
ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGTTCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTTCATCTCCGGTTCTGCTTGA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)