tblastx task: miRNA RC

Status
finished finished
Modified 2018-07-11T18:13:29Z
CPU time (s) 40429.6
Size (bytes) 53060
Command tblastx -num_descriptions 500 -outfmt 0 -db_gencode 1 -db 'Betula_pendula_genome.fasta nt' -num_alignments 250 -seg '12 2.2 2.5' -query_gencode 1 -evalue 10.0
Error [none]
Output
TBLASTX 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Betula pendula genome; All GenBank+EMBL+DDBJ+PDB sequences (but no
EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS
sequences)
           15,105,361 sequences; 39,509,311,070 total letters



Query= 735866139LD261650_1_SW_scaffold128692_size1046:648-667_-_miRNA-
precursor_1_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735898266LD229612_1_SW_scaffold97366_size2466:2349-2369_-_miRNA-
precursor_28_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735904777LD223101_1_SW_scaffold90832_size2716:2654-2674_+_miRNA-
precursor_45_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735912906LD214972_1_SW_scaffold82060_size3165:555-575_+_miRNA-
precursor_62_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735918380LD209498_1_SW_scaffold77253_size3638:1125-1145_-_miRNA-
precursor_71_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735920675LD207203_1_SW_scaffold74967_size4022:2071-2091_-_miRNA-
precursor_74_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735926327LD201551_1_SW_scaffold69307_size5058:875-895_+_miRNA-
precursor_86_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.312    0.149    0.463 


Effective search space used: 92188392492


Query= 735926680LD201198_1_SW_scaffold68932_size5134:2743-2764_-_miRNA-
precursor_90_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.313    0.120    0.470 


Effective search space used: 92188392492


Query= 735928268LD199610_1_SW_scaffold67373_size5476:4512-4532_+_miRNA-
precursor_95_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735931836LD196042_1_SW_scaffold63744_size6541:3276-3296_+_miRNA-
precursor_103_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.316    0.114    0.362 


Effective search space used: 92188392492


Query= 735932436LD195442_1_SW_scaffold63190_size6729:1375-1395_-_miRNA-
precursor_105_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.316    0.145    0.388 


Effective search space used: 92188392492


Query= 735934184LD193694_1_SW_scaffold61380_size7367:1903-1923_+_miRNA-
precursor_108_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735938592LD189286_1_SW_scaffold57049_size8997:760-780_-_miRNA-
precursor_125_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.301    0.123    0.365 


Effective search space used: 92188392492


Query= 735938592LD189286_1_SW_scaffold57049_size8997:3103-3123_-_miRNA-
precursor_126_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.301    0.123    0.365 


Effective search space used: 92188392492


Query= 735939890LD187988_1_SW_scaffold55747_size9531:664-683_+_miRNA-
precursor_134_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.316    0.149    0.536 


Effective search space used: 79018622136


Query= 735941560LD186318_1_SW_scaffold54032_size10208:6997-7016_-_miRNA-
precursor_142_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735943143LD184735_1_SW_scaffold52452_size10781:5185-5205_-_miRNA-
precursor_150_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735943767LD184111_1_SW_scaffold51819_size11017:7631-7651_-_miRNA-
precursor_156_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735945476LD182405_1_SW_scaffold50049_size11684:11281-11301_-_miRNA-
precursor_169_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735947299LD180582_1_SW_scaffold48338_size12335:7444-7464_+_miRNA-
precursor_179_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735948209LD179672_1_SW_scaffold47419_size12683:11065-11085_-_miRNA-
precursor_186_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735948538LD179343_1_SW_scaffold47099_size12822:4673-4692_+_miRNA-
precursor_193_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.281    0.101    0.225 


Effective search space used: 79018622136


Query= 735948538LD179343_1_SW_scaffold47099_size12822:6896-6915_+_miRNA-
precursor_194_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.281    0.101    0.225 


Effective search space used: 79018622136


Query= 735948739LD179142_1_SW_scaffold45620_size13421:2044-2064_-_miRNA-
precursor_197_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735949700LD178181_1_SW_scaffold45896_size13310:3866-3886_+_miRNA-
precursor_200_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735950933LD176948_1_SW_scaffold44682_size13837:10480-10500_-_miRNA-
precursor_208_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735951529LD176352_1_SW_scaffold44114_size14089:13293-13310_-_miRNA-
precursor_212_RC

Length=18


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735952393LD175488_1_SW_scaffold43215_size14507:4618-4638_+_miRNA-
precursor_221_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.309    0.126    0.412 


Effective search space used: 92188392492


Query= 735952458LD175423_1_SW_scaffold42492_size14850:5249-5269_-_miRNA-
precursor_223_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735954623LD173258_1_SW_scaffold40986_size15617:2224-2243_+_miRNA-
precursor_237_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.316    0.112    0.447 


Effective search space used: 79018622136


Query= 735955063LD172818_1_SW_scaffold40336_size15940:10200-10220_+_miRNA-
precursor_240_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735957337LD170850_1_SW_scaffold38467_size16947:2486-2506_-_miRNA-
precursor_251_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735957773LD170414_1_SW_scaffold38129_size17140:497-517_-_miRNA-
precursor_261_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735957847LD170340_1_SW_scaffold37926_size17249:13195-13215_+_miRNA-
precursor_262_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.309    0.132    0.358 


Effective search space used: 92188392492


Query= 735958104LD170083_1_SW_scaffold37818_size17308:4110-4130_+_miRNA-
precursor_268_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735958447LD169740_1_SW_scaffold34397_size60143:57101-57121_+_miRNA-
precursor_273_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735958983LD169204_1_SW_scaffold36858_size17871:1828-1848_-_miRNA-
precursor_279_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735958983LD169204_1_SW_scaffold36858_size17871:4237-4257_-_miRNA-
precursor_280_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735958995LD169192_1_SW_scaffold36356_size18179:13562-13583_+_miRNA-
precursor_281_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.313    0.120    0.470 


Effective search space used: 92188392492


Query= 735961882LD166307_1_SW_scaffold34013_size19637:12892-12913_+_miRNA-
precursor_312_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.313    0.117    0.255 


Effective search space used: 92188392492


Query= 735962151LD166038_1_SW_scaffold33778_size19796:9544-9564_+_miRNA-
precursor_316_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.313    0.126    0.313 


Effective search space used: 92188392492


Query= 735962151LD166038_1_SW_scaffold33778_size19796:16969-16989_-_miRNA-
precursor_317_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735963505LD164684_1_SW_scaffold32430_size20666:8132-8152_+_miRNA-
precursor_328_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.316    0.114    0.362 


Effective search space used: 92188392492


Query= 735963684LD164505_1_SW_scaffold31181_size42969:37588-37608_-_miRNA-
precursor_331_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735964067LD164122_1_SW_scaffold31124_size21552:1553-1573_-_miRNA-
precursor_334_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.312    0.149    0.463 


Effective search space used: 92188392492


Query= 735965192LD162997_1_SW_scaffold29023_size23012:9625-9645_-_miRNA-
precursor_342_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.297    0.130    0.378 


Effective search space used: 92188392492


Query= 735965451LD162738_1_SW_scaffold30446_size22025:1041-1060_+_miRNA-
precursor_346_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735966091LD162098_1_SW_scaffold29838_size22444:7232-7252_+_miRNA-
precursor_353_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735966117LD162072_1_SW_scaffold29785_size22484:15070-15089_-_miRNA-
precursor_355_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.281    0.101    0.225 


Effective search space used: 79018622136


Query= 735966802LD161387_1_SW_scaffold29054_size22996:8668-8687_+_miRNA-
precursor_365_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735966898LD161291_1_SW_scaffold28744_size23234:20427-20447_-_miRNA-
precursor_368_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735967475LD160715_1_SW_scaffold27357_size24323:15101-15121_+_miRNA-
precursor_382_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.315    0.121    0.377 


Effective search space used: 92188392492


Query= 735969600LD158590_1_SW_scaffold26343_size25119:19984-20003_-_miRNA-
precursor_407_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735969630LD158560_1_SW_scaffold26312_size25140:20732-20752_+_miRNA-
precursor_408_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735969990LD158200_1_SW_scaffold25966_size25424:12760-12780_+_miRNA-
precursor_414_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735970125LD158065_1_SW_scaffold25403_size56799:37888-37908_+_miRNA-
precursor_417_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.316    0.114    0.318 


Effective search space used: 92188392492


Query= 735971495LD156695_1_SW_scaffold24316_size26860:3635-3655_+_miRNA-
precursor_432_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.293    0.119    0.368 


Effective search space used: 92188392492


Query= 735971637LD156612_1_SW_scaffold24233_size26938:6864-6884_-_miRNA-
precursor_434_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735972393LD155963_1_SW_scaffold23720_size27421:19655-19674_+_miRNA-
precursor_449_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.281    0.101    0.225 


Effective search space used: 79018622136


Query= 735972997LD155359_1_SW_scaffold23086_size28017:2441-2461_+_miRNA-
precursor_455_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735972997LD155359_1_SW_scaffold23086_size28017:27031-27051_+_miRNA-
precursor_456_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735973217LD155139_1_SW_scaffold22883_size28209:9245-9265_+_miRNA-
precursor_461_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735973217LD155139_1_SW_scaffold22883_size28209:12412-12432_+_miRNA-
precursor_462_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735973411LD154945_1_SW_scaffold22582_size28514:238-258_+_miRNA-
precursor_464_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735973411LD154945_1_SW_scaffold22582_size28514:238-258_+_miRNA-
precursor_465_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735973945LD154411_1_SW_scaffold22110_size28987:13313-13333_-_miRNA-
precursor_472_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735973990LD154366_1_SW_scaffold22047_size29051:26381-26401_-_miRNA-
precursor_473_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735974801LD153555_1_SW_scaffold21059_size30107:551-571_-_miRNA-
precursor_485_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735974904LD153452_1_SW_scaffold21195_size29973:23277-23296_+_miRNA-
precursor_486_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.291   0.0980    0.201 


Effective search space used: 79018622136


Query= 735975082LD153274_1_SW_scaffold20780_size30385:17602-17622_+_miRNA-
precursor_489_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735975453LD152903_1_SW_scaffold20640_size30548:14923-14943_-_miRNA-
precursor_496_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735975795LD152561_1_SW_scaffold20061_size31126:2926-2945_-_miRNA-
precursor_498_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.298    0.134    0.402 


Effective search space used: 79018622136


Query= 735976666LD151690_1_SW_scaffold19384_size31866:17468-17488_+_miRNA-
precursor_511_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.282   0.0934    0.202 


Effective search space used: 92188392492


Query= 735976871LD151485_1_SW_scaffold18547_size32883:108-128_-_miRNA-
precursor_513_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.308    0.113    0.326 


Effective search space used: 92188392492


Query= 735977296LD151060_1_SW_scaffold18793_size32552:13228-13248_+_miRNA-
precursor_522_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735977384LD150972_1_SW_scaffold18591_size32818:17679-17699_-_miRNA-
precursor_525_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.291    0.105    0.242 


Effective search space used: 92188392492


Query= 735977384LD150972_1_SW_scaffold18591_size32818:18734-18754_-_miRNA-
precursor_526_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.291    0.105    0.242 


Effective search space used: 92188392492


Query= 735978705LD149651_1_SW_scaffold16849_size75750:4075-4095_+_miRNA-
precursor_542_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735979849LD148507_1_SW_scaffold16231_size35807:8086-8107_-_miRNA-
precursor_565_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735980034LD148322_1_SW_scaffold16052_size36087:23888-23908_+_miRNA-
precursor_569_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735980064LD148292_1_SW_scaffold15978_size36180:2522-2542_-_miRNA-
precursor_570_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735980224LD148132_1_SW_scaffold15759_size36462:29008-29028_-_miRNA-
precursor_575_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735980518LD147838_1_SW_scaffold15479_size36850:32054-32074_-_miRNA-
precursor_582_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735980649LD147707_1_SW_scaffold15414_size36945:9877-9897_+_miRNA-
precursor_583_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735981397LD146959_1_SW_scaffold13748_size39428:13155-13175_+_miRNA-
precursor_596_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735981422LD146934_1_SW_scaffold14658_size38075:27199-27217_+_miRNA-
precursor_597_RC

Length=19


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735981475LD146881_1_SW_scaffold14605_size38150:9003-9023_-_miRNA-
precursor_602_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735981744LD146612_1_SW_scaffold13663_size78320:38991-39009_+_miRNA-
precursor_606_RC

Length=19


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735981820LD146536_1_SW_scaffold14267_size38662:11295-11314_+_miRNA-
precursor_608_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.281    0.101    0.225 


Effective search space used: 79018622136


Query= 735982061LD146295_1_SW_scaffold14021_size39050:17964-17984_+_miRNA-
precursor_614_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.293    0.119    0.294 


Effective search space used: 92188392492


Query= 735982173LD146183_1_SW_scaffold13380_size39997:18053-18073_+_miRNA-
precursor_617_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735982288LD146068_1_SW_scaffold13801_size39361:34557-34577_+_miRNA-
precursor_620_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.301    0.115    0.266 


Effective search space used: 92188392492


Query= 735982288LD146068_1_SW_scaffold13801_size39361:36841-36861_+_miRNA-
precursor_621_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.301    0.115    0.266 


Effective search space used: 92188392492


Query= 735982907LD145449_1_SW_scaffold13091_size40503:30751-30771_-_miRNA-
precursor_629_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.312    0.149    0.463 


Effective search space used: 92188392492


Query= 735983699LD144657_1_SW_scaffold12391_size71677:22846-22866_-_miRNA-
precursor_638_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.303    0.119    0.300 


Effective search space used: 92188392492


Query= 735983941LD144415_1_SW_scaffold12161_size42168:34753-34773_-_miRNA-
precursor_641_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.311    0.121    0.339 


Effective search space used: 92188392492


Query= 735984011LD144345_1_SW_scaffold12057_size42345:29700-29720_+_miRNA-
precursor_642_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735984379LD143977_1_SW_scaffold11671_size43036:27773-27793_-_miRNA-
precursor_657_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.315    0.125    0.308 


Effective search space used: 92188392492


Query= 735984600LD143756_1_SW_scaffold11400_size43604:3697-3718_-_miRNA-
precursor_661_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.312    0.152    0.472 


Effective search space used: 92188392492


Query= 735984600LD143756_1_SW_scaffold11400_size43604:3697-3718_-_miRNA-
precursor_662_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.312    0.152    0.472 


Effective search space used: 92188392492


Query= 735984715LD143641_1_SW_scaffold11147_size44070:26249-26269_+_miRNA-
precursor_664_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735985154LD143202_1_SW_scaffold10736_size44898:39181-39200_-_miRNA-
precursor_676_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.298    0.134    0.402 


Effective search space used: 79018622136


Query= 735986199LD142157_1_SW_scaffold9275_size48116:24794-24814_+_miRNA-
precursor_703_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735986254LD142102_1_SW_scaffold9719_size47148:40597-40617_-_miRNA-
precursor_706_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.316    0.114    0.362 


Effective search space used: 92188392492


Query= 735986626LD141730_1_SW_scaffold9398_size47817:11850-11870_-_miRNA-
precursor_716_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735986671LD141685_1_SW_scaffold9045_size48755:22885-22905_-_miRNA-
precursor_718_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735986689LD141667_1_SW_scaffold9347_size47945:20641-20661_-_miRNA-
precursor_719_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735987028LD141328_1_SW_scaffold9039_size48768:17011-17030_-_miRNA-
precursor_729_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.291   0.0980    0.201 


Effective search space used: 79018622136


Query= 735987082LD141274_1_SW_scaffold8891_size49115:30810-30830_+_miRNA-
precursor_731_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.312    0.117    0.468 


Effective search space used: 92188392492


Query= 735987793LD140563_1_SW_scaffold7902_size51703:49814-49834_-_miRNA-
precursor_753_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735988153LD140203_1_SW_scaffold7950_size51580:36530-36550_+_miRNA-
precursor_765_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735988465LD139891_1_SW_scaffold7631_size52456:10867-10887_-_miRNA-
precursor_768_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735988784LD139572_1_SW_scaffold7309_size53500:51420-51442_+_miRNA-
precursor_776_RC

Length=23


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735988825LD139531_1_SW_scaffold6984_size108417:40307-40327_-_miRNA-
precursor_777_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735989001LD139355_1_SW_scaffold7061_size54252:7965-7985_+_miRNA-
precursor_783_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735989001LD139355_1_SW_scaffold7061_size54252:8186-8206_+_miRNA-
precursor_784_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735990220LD138137_1_SW_scaffold5692_size115363:86530-86548_+_miRNA-
precursor_817_RC

Length=19


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735990234LD138123_1_SW_scaffold5635_size138164:12555-12575_-_miRNA-
precursor_819_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.293    0.119    0.368 


Effective search space used: 92188392492


Query= 735990416LD137941_1_SW_scaffold5664_size59149:37013-37033_+_miRNA-
precursor_823_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735990676LD137681_1_SW_scaffold4568_size64122:59384-59404_+_miRNA-
precursor_832_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.298    0.127    0.397 


Effective search space used: 92188392492


Query= 735990993LD137364_1_SW_scaffold4796_size62939:35382-35403_-_miRNA-
precursor_844_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735991051LD137306_1_SW_scaffold5036_size61776:12507-12527_+_miRNA-
precursor_846_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.298    0.127    0.397 


Effective search space used: 92188392492


Query= 735991410LD136947_1_SW_scaffold4582_size64058:17865-17885_-_miRNA-
precursor_859_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735991794LD136563_1_SW_scaffold4234_size65909:2428-2448_+_miRNA-
precursor_873_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735991794LD136563_1_SW_scaffold4234_size65909:12441-12461_+_miRNA-
precursor_874_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735992187LD136170_1_SW_scaffold3771_size68584:63050-63070_-_miRNA-
precursor_886_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.308    0.113    0.326 


Effective search space used: 92188392492


Query= 735992509LD135848_1_SW_scaffold3534_size69916:30993-31012_+_miRNA-
precursor_897_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735992539LD135818_1_SW_scaffold3492_size70202:59566-59585_-_miRNA-
precursor_899_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.291   0.0980    0.201 


Effective search space used: 79018622136


Query= 735992970LD135387_1_SW_scaffold3002_size73454:39545-39565_+_miRNA-
precursor_915_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.314    0.102    0.301 


Effective search space used: 92188392492


Query= 735993067LD135290_1_SW_scaffold2942_size73918:53917-53936_-_miRNA-
precursor_916_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735993067LD135290_1_SW_scaffold2942_size73918:54329-54348_-_miRNA-
precursor_917_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735993368LD134989_1_SW_scaffold2733_size75506:58294-58314_+_miRNA-
precursor_926_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.300    0.118    0.301 


Effective search space used: 92188392492


Query= 735993979LD134378_1_SW_scaffold2008_size82214:66467-66488_-_miRNA-
precursor_958_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.312    0.152    0.472 


Effective search space used: 92188392492


Query= 735993979LD134378_1_SW_scaffold2008_size82214:68983-69004_-_miRNA-
precursor_959_RC

Length=22


***** No hits found *****



Lambda     K      H
   0.312    0.152    0.472 


Effective search space used: 92188392492


Query= 735995140LD133983_1_SW_scaffold1689_size86608:21238-21257_-_miRNA-
precursor_973_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.281    0.101    0.225 


Effective search space used: 79018622136


Query= 735995197LD133926_1_SW_scaffold1619_size87536:9376-9396_-_miRNA-
precursor_974_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.292    0.120    0.339 


Effective search space used: 92188392492


Query= 735995390LD133733_1_SW_scaffold1099_size96485:64575-64595_-_miRNA-
precursor_986_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.312    0.142    0.395 


Effective search space used: 92188392492


Query= 735995457LD133666_1_SW_scaffold989_size98414:40795-40815_+_miRNA-
precursor_991_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735995686LD133437_1_SW_scaffold1102_size96447:34599-34619_+_miRNA-
precursor_1001_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735995796LD133327_1_SW_scaffold1066_size96981:11160-11179_+_miRNA-
precursor_1010_RC

Length=20


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735995924LD133199_1_SW_scaffold744_size104800:73323-73343_-_miRNA-
precursor_1012_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.312    0.149    0.463 


Effective search space used: 92188392492


Query= 735995960LD133163_1_SW_scaffold828_size102702:81529-81547_-_miRNA-
precursor_1016_RC

Length=19


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 79018622136


Query= 735996159LD132964_1_SW_scaffold695_size106883:82643-82663_-_miRNA-
precursor_1032_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


Query= 735996616LD132507_1_SW_scaffold81_size157070:153322-153342_-_miRNA-
precursor_1058_RC

Length=21


***** No hits found *****



Lambda     K      H
   0.318    0.134    0.401 


Effective search space used: 92188392492


  Database: Betula pendula genome
    Posted date:  Jul 3, 2017  10:24 AM
  Number of letters in database: 435,172,141
  Number of sequences in database:  5,642

  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Nov 30, 2011  4:13 AM
  Number of letters in database: 39,074,138,929
  Number of sequences in database:  15,099,719



Matrix: BLOSUM62
Neighboring words threshold: 13
Window for multiple hits: 40
Query
>735866139LD261650_1_SW_scaffold128692_size1046:648-667_-_miRNA-precursor_1_RC
TGGAACCAAGTTTGGACAGC

>735898266LD229612_1_SW_scaffold97366_size2466:2349-2369_-_miRNA-precursor_28_RC
GATATTGGCACGGCTCAATCA

>735904777LD223101_1_SW_scaffold90832_size2716:2654-2674_+_miRNA-precursor_45_RC
GGGGAATGAAGCCTGGTCCGA

>735912906LD214972_1_SW_scaffold82060_size3165:555-575_+_miRNA-precursor_62_RC
CATGTGTTCTCAGGCAACCCC

>735918380LD209498_1_SW_scaffold77253_size3638:1125-1145_-_miRNA-precursor_71_RC
CCGGCAAGTCATCCTTGGCTG

>735920675LD207203_1_SW_scaffold74967_size4022:2071-2091_-_miRNA-precursor_74_RC
CATCAACGCTGCACTCAATGA

>735926327LD201551_1_SW_scaffold69307_size5058:875-895_+_miRNA-precursor_86_RC
GGCGCTATCCCTCCTGAGCTT

>735926680LD201198_1_SW_scaffold68932_size5134:2743-2764_-_miRNA-precursor_90_RC
TGGAATACTCATTTGAGCAAGA

>735928268LD199610_1_SW_scaffold67373_size5476:4512-4532_+_miRNA-precursor_95_RC
CAGGCAAGTCATCCTTGGCTA

>735931836LD196042_1_SW_scaffold63744_size6541:3276-3296_+_miRNA-precursor_103_RC
ATGCAGCATCATCAAGATTCT

>735932436LD195442_1_SW_scaffold63190_size6729:1375-1395_-_miRNA-precursor_105_RC
GGGCAAGTCATCCTTGGCTCA

>735934184LD193694_1_SW_scaffold61380_size7367:1903-1923_+_miRNA-precursor_108_RC
CTGGATGCAGAGGTTTATCGA

>735938592LD189286_1_SW_scaffold57049_size8997:760-780_-_miRNA-precursor_125_RC
CCTGCCAAAAGAGAGACGCCC

>735938592LD189286_1_SW_scaffold57049_size8997:3103-3123_-_miRNA-precursor_126_RC
CCTGCCAAAAGAGAGACGCCC

>735939890LD187988_1_SW_scaffold55747_size9531:664-683_+_miRNA-precursor_134_RC
GGAGCTCCCTTCAATCCAAG

>735941560LD186318_1_SW_scaffold54032_size10208:6997-7016_-_miRNA-precursor_142_RC
GTGCTCACTCTCTTCTGTCA

>735943143LD184735_1_SW_scaffold52452_size10781:5185-5205_-_miRNA-precursor_150_RC
TAGAGCTCCCTTCAATCCAAA

>735943767LD184111_1_SW_scaffold51819_size11017:7631-7651_-_miRNA-precursor_156_RC
TAGGGCAACTCTCCTTTGGCA

>735945476LD182405_1_SW_scaffold50049_size11684:11281-11301_-_miRNA-precursor_169_RC
TAGATCATGCTGGCAGCTTCA

>735947299LD180582_1_SW_scaffold48338_size12335:7444-7464_+_miRNA-precursor_179_RC
GATATTGGCACGGCTCAATCA

>735948209LD179672_1_SW_scaffold47419_size12683:11065-11085_-_miRNA-precursor_186_RC
CCGGCAAGTCATCCTTGGCTG

>735948538LD179343_1_SW_scaffold47099_size12822:4673-4692_+_miRNA-precursor_193_RC
GGGAGCTCCCTTCAGTCCAA

>735948538LD179343_1_SW_scaffold47099_size12822:6896-6915_+_miRNA-precursor_194_RC
GGGAGCTCCCTTCAGTCCAA

>735948739LD179142_1_SW_scaffold45620_size13421:2044-2064_-_miRNA-precursor_197_RC
GGGGAATGAAGCCTGGTCCGA

>735949700LD178181_1_SW_scaffold45896_size13310:3866-3886_+_miRNA-precursor_200_RC
CTGGATGCAGAGGTTTATCGA

>735950933LD176948_1_SW_scaffold44682_size13837:10480-10500_-_miRNA-precursor_208_RC
CAGGCAAGTCATCCTTGGCTA

>735951529LD176352_1_SW_scaffold44114_size14089:13293-13310_-_miRNA-precursor_212_RC
TGCCCACCACTCCACCCA

>735952393LD175488_1_SW_scaffold43215_size14507:4618-4638_+_miRNA-precursor_221_RC
AATTCATGTCCAACCATCGAA

>735952458LD175423_1_SW_scaffold42492_size14850:5249-5269_-_miRNA-precursor_223_RC
GGGGAATGAAGCCTGGTCCGA

>735954623LD173258_1_SW_scaffold40986_size15617:2224-2243_+_miRNA-precursor_237_RC
TACGCGGCTTGGAGCCAGGA

>735955063LD172818_1_SW_scaffold40336_size15940:10200-10220_+_miRNA-precursor_240_RC
GGGGAATGAAGCCTGGTCCGA

>735957337LD170850_1_SW_scaffold38467_size16947:2486-2506_-_miRNA-precursor_251_RC
GGAGTTCTCAAGTGATGGGCT

>735957773LD170414_1_SW_scaffold38129_size17140:497-517_-_miRNA-precursor_261_RC
TAGGGCAACTCTCCTTTGGCA

>735957847LD170340_1_SW_scaffold37926_size17249:13195-13215_+_miRNA-precursor_262_RC
GGAGATATTGACGCGGCTCAA

>735958104LD170083_1_SW_scaffold37818_size17308:4110-4130_+_miRNA-precursor_268_RC
AGCTCTGATACCAACTTGTAA

>735958447LD169740_1_SW_scaffold34397_size60143:57101-57121_+_miRNA-precursor_273_RC
GTGCTCTCTATCTTCTGTCAA

>735958983LD169204_1_SW_scaffold36858_size17871:1828-1848_-_miRNA-precursor_279_RC
TGCACGTGCCCTGCTTCTCCA

>735958983LD169204_1_SW_scaffold36858_size17871:4237-4257_-_miRNA-precursor_280_RC
TGCACGTGCCCTGCTTCTCCA

>735958995LD169192_1_SW_scaffold36356_size18179:13562-13583_+_miRNA-precursor_281_RC
TGGAATACTCATTTGAGCAAGA

>735961882LD166307_1_SW_scaffold34013_size19637:12892-12913_+_miRNA-precursor_312_RC
GCGTCATCTCTCCTGCGACAGT

>735962151LD166038_1_SW_scaffold33778_size19796:9544-9564_+_miRNA-precursor_316_RC
AAGTTCAAGAAAGCTGTGGAA

>735962151LD166038_1_SW_scaffold33778_size19796:16969-16989_-_miRNA-precursor_317_RC
CTTCCCACAGCTTTATTGAAC

>735963505LD164684_1_SW_scaffold32430_size20666:8132-8152_+_miRNA-precursor_328_RC
ATGCAGCATCATCAAGATTCT

>735963684LD164505_1_SW_scaffold31181_size42969:37588-37608_-_miRNA-precursor_331_RC
AACCCTATTCACACATGCACA

>735964067LD164122_1_SW_scaffold31124_size21552:1553-1573_-_miRNA-precursor_334_RC
GGCGCTATCCCTCCTGAGCTT

>735965192LD162997_1_SW_scaffold29023_size23012:9625-9645_-_miRNA-precursor_342_RC
GGAGGCGGACAGAATGCCAAA

>735965451LD162738_1_SW_scaffold30446_size22025:1041-1060_+_miRNA-precursor_346_RC
GTGCTCACTCTCTTCTGTCA

>735966091LD162098_1_SW_scaffold29838_size22444:7232-7252_+_miRNA-precursor_353_RC
GGGGAATGAAGCCTGGTCCGA

>735966117LD162072_1_SW_scaffold29785_size22484:15070-15089_-_miRNA-precursor_355_RC
GGGAGCTCCCTTCAGTCCAA

>735966802LD161387_1_SW_scaffold29054_size22996:8668-8687_+_miRNA-precursor_365_RC
AGAAGCCCTTGAGGGAGAGT

>735966898LD161291_1_SW_scaffold28744_size23234:20427-20447_-_miRNA-precursor_368_RC
CCGGCAAGTCATCCTTGGCTG

>735967475LD160715_1_SW_scaffold27357_size24323:15101-15121_+_miRNA-precursor_382_RC
CTGCAGCATCATCAAGATTCT

>735969600LD158590_1_SW_scaffold26343_size25119:19984-20003_-_miRNA-precursor_407_RC
AGAAGCCCTTGAGGGAGAGT

>735969630LD158560_1_SW_scaffold26312_size25140:20732-20752_+_miRNA-precursor_408_RC
TAGAGCTCCCTTCAATCCAAA

>735969990LD158200_1_SW_scaffold25966_size25424:12760-12780_+_miRNA-precursor_414_RC
GATATTGGCACGGCTCAATCA

>735970125LD158065_1_SW_scaffold25403_size56799:37888-37908_+_miRNA-precursor_417_RC
GCGTGCTCTCTCTCGTTGTCA

>735971495LD156695_1_SW_scaffold24316_size26860:3635-3655_+_miRNA-precursor_432_RC
GGAGCTCCCCCAAACACTTCA

>735971637LD156612_1_SW_scaffold24233_size26938:6864-6884_-_miRNA-precursor_434_RC
CCGGCAAGTCATCCTTGGCTG

>735972393LD155963_1_SW_scaffold23720_size27421:19655-19674_+_miRNA-precursor_449_RC
GGGAGCTCCCTTCAGTCCAA

>735972997LD155359_1_SW_scaffold23086_size28017:2441-2461_+_miRNA-precursor_455_RC
TAGATCATGCTGGCAGCTTCA

>735972997LD155359_1_SW_scaffold23086_size28017:27031-27051_+_miRNA-precursor_456_RC
TAGATCATGCTGGCAGCTTCA

>735973217LD155139_1_SW_scaffold22883_size28209:9245-9265_+_miRNA-precursor_461_RC
TAGGCAAGTCATCCTTGGCTA

>735973217LD155139_1_SW_scaffold22883_size28209:12412-12432_+_miRNA-precursor_462_RC
TAGGCAAGTCATCCTTGGCTA

>735973411LD154945_1_SW_scaffold22582_size28514:238-258_+_miRNA-precursor_464_RC
GGGGAATGAAGCCTGGTCCGA

>735973411LD154945_1_SW_scaffold22582_size28514:238-258_+_miRNA-precursor_465_RC
GGGGAATGAAGCCTGGTCCGA

>735973945LD154411_1_SW_scaffold22110_size28987:13313-13333_-_miRNA-precursor_472_RC
TGTTTGTTGATGGTCATCTAA

>735973990LD154366_1_SW_scaffold22047_size29051:26381-26401_-_miRNA-precursor_473_RC
GATATTGGCACGGCTCAATCA

>735974801LD153555_1_SW_scaffold21059_size30107:551-571_-_miRNA-precursor_485_RC
TAGGGCAACTCTCCTTTGGCA

>735974904LD153452_1_SW_scaffold21195_size29973:23277-23296_+_miRNA-precursor_486_RC
AGGAGCTCCCTTCAGTCCAA

>735975082LD153274_1_SW_scaffold20780_size30385:17602-17622_+_miRNA-precursor_489_RC
CGAGTTTGTGCGTGAATCTAA

>735975453LD152903_1_SW_scaffold20640_size30548:14923-14943_-_miRNA-precursor_496_RC
GATATTGGCACGGCTCAATCA

>735975795LD152561_1_SW_scaffold20061_size31126:2926-2945_-_miRNA-precursor_498_RC
GGAGGTGGACAGAATGCCAA

>735976666LD151690_1_SW_scaffold19384_size31866:17468-17488_+_miRNA-precursor_511_RC
CAACAACAACAACAACAAGAG

>735976871LD151485_1_SW_scaffold18547_size32883:108-128_-_miRNA-precursor_513_RC
CGGCATACAGGGAGCCAGGCA

>735977296LD151060_1_SW_scaffold18793_size32552:13228-13248_+_miRNA-precursor_522_RC
CAGATCATGCTGGCAGCTTCA

>735977384LD150972_1_SW_scaffold18591_size32818:17679-17699_-_miRNA-precursor_525_RC
GGCAAGTCATCCTTGGCTGCA

>735977384LD150972_1_SW_scaffold18591_size32818:18734-18754_-_miRNA-precursor_526_RC
GGCAAGTCATCCTTGGCTGCA

>735978705LD149651_1_SW_scaffold16849_size75750:4075-4095_+_miRNA-precursor_542_RC
AATCCAAAGGGATAGCATGAT

>735979849LD148507_1_SW_scaffold16231_size35807:8086-8107_-_miRNA-precursor_565_RC
TCGGCAAGTCATTTTTGGCTCA

>735980034LD148322_1_SW_scaffold16052_size36087:23888-23908_+_miRNA-precursor_569_RC
CCATGCTCTGTCTGTTCCCTG

>735980064LD148292_1_SW_scaffold15978_size36180:2522-2542_-_miRNA-precursor_570_RC
AATCCAAAGGGATAGCATGAT

>735980224LD148132_1_SW_scaffold15759_size36462:29008-29028_-_miRNA-precursor_575_RC
GTGCTCTCTATCTTCTGTCAA

>735980518LD147838_1_SW_scaffold15479_size36850:32054-32074_-_miRNA-precursor_582_RC
AAGATCATGCTGGCAGCTTCA

>735980649LD147707_1_SW_scaffold15414_size36945:9877-9897_+_miRNA-precursor_583_RC
CGAGTTTGTGCGTGAATCTAA

>735981397LD146959_1_SW_scaffold13748_size39428:13155-13175_+_miRNA-precursor_596_RC
TAGGGCAACTCTCCTTTGGCA

>735981422LD146934_1_SW_scaffold14658_size38075:27199-27217_+_miRNA-precursor_597_RC
TAGATGTTCTTCATGTTCT

>735981475LD146881_1_SW_scaffold14605_size38150:9003-9023_-_miRNA-precursor_602_RC
AGTTCAAAATAGTCAGTTGCA

>735981744LD146612_1_SW_scaffold13663_size78320:38991-39009_+_miRNA-precursor_606_RC
TCCTCTTTCTTAGCTTGTG

>735981820LD146536_1_SW_scaffold14267_size38662:11295-11314_+_miRNA-precursor_608_RC
GGGAGCTCCCTTCAGTCCAA

>735982061LD146295_1_SW_scaffold14021_size39050:17964-17984_+_miRNA-precursor_614_RC
GAGGAGCTCCCTTCAGTCCAA

>735982173LD146183_1_SW_scaffold13380_size39997:18053-18073_+_miRNA-precursor_617_RC
CAGGCAAGTCATCCTTGGCTA

>735982288LD146068_1_SW_scaffold13801_size39361:34557-34577_+_miRNA-precursor_620_RC
AAGCTGTACTCTCTCTCTTCT

>735982288LD146068_1_SW_scaffold13801_size39361:36841-36861_+_miRNA-precursor_621_RC
AAGCTGTACTCTCTCTCTTCT

>735982907LD145449_1_SW_scaffold13091_size40503:30751-30771_-_miRNA-precursor_629_RC
GGCGCTATCCCTCCTGAGCTT

>735983699LD144657_1_SW_scaffold12391_size71677:22846-22866_-_miRNA-precursor_638_RC
AGTGATATTGGCGCGGCTCAA

>735983941LD144415_1_SW_scaffold12161_size42168:34753-34773_-_miRNA-precursor_641_RC
CCGAAGATGAAGACGAAGAGG

>735984011LD144345_1_SW_scaffold12057_size42345:29700-29720_+_miRNA-precursor_642_RC
TAGATCATGCTGGCAGCTTCA

>735984379LD143977_1_SW_scaffold11671_size43036:27773-27793_-_miRNA-precursor_657_RC
CAGTTCAAGAAAGCTGTGGAA

>735984600LD143756_1_SW_scaffold11400_size43604:3697-3718_-_miRNA-precursor_661_RC
GGTATGGGAGGTGTTGGGAAAA

>735984600LD143756_1_SW_scaffold11400_size43604:3697-3718_-_miRNA-precursor_662_RC
GGTATGGGAGGTGTTGGGAAAA

>735984715LD143641_1_SW_scaffold11147_size44070:26249-26269_+_miRNA-precursor_664_RC
GTGCTCTCTATCTTCTGTCAA

>735985154LD143202_1_SW_scaffold10736_size44898:39181-39200_-_miRNA-precursor_676_RC
GGAGGTGGACAGAATGCCAA

>735986199LD142157_1_SW_scaffold9275_size48116:24794-24814_+_miRNA-precursor_703_RC
CAGTGAAGTGTTCGAGGAAAC

>735986254LD142102_1_SW_scaffold9719_size47148:40597-40617_-_miRNA-precursor_706_RC
ATGCAGCATCATCAAGATTCT

>735986626LD141730_1_SW_scaffold9398_size47817:11850-11870_-_miRNA-precursor_716_RC
GATATTGGCACGGCTCAATCA

>735986671LD141685_1_SW_scaffold9045_size48755:22885-22905_-_miRNA-precursor_718_RC
CAGGCAAGTCATCCTTGGCTA

>735986689LD141667_1_SW_scaffold9347_size47945:20641-20661_-_miRNA-precursor_719_RC
GGGGAATGAAGCCTGGTCCGA

>735987028LD141328_1_SW_scaffold9039_size48768:17011-17030_-_miRNA-precursor_729_RC
AGGAGCTCCCTTCAGTCCAA

>735987082LD141274_1_SW_scaffold8891_size49115:30810-30830_+_miRNA-precursor_731_RC
TGGCATACAGGGAGCCAGGCA

>735987793LD140563_1_SW_scaffold7902_size51703:49814-49834_-_miRNA-precursor_753_RC
GTGCTCTCTATCTTCTGTCAA

>735988153LD140203_1_SW_scaffold7950_size51580:36530-36550_+_miRNA-precursor_765_RC
GATATTGGCACGGCTCAATCA

>735988465LD139891_1_SW_scaffold7631_size52456:10867-10887_-_miRNA-precursor_768_RC
CATCAACGCTGCACTCAATGA

>735988784LD139572_1_SW_scaffold7309_size53500:51420-51442_+_miRNA-precursor_776_RC
GCCGGCAAGTCATTCTTGGCTCA

>735988825LD139531_1_SW_scaffold6984_size108417:40307-40327_-_miRNA-precursor_777_RC
TAAACCTCAGGATGCAGATTA

>735989001LD139355_1_SW_scaffold7061_size54252:7965-7985_+_miRNA-precursor_783_RC
GGGGAATGAAGCCTGGTCCGA

>735989001LD139355_1_SW_scaffold7061_size54252:8186-8206_+_miRNA-precursor_784_RC
GGGGAATGAAGCCTGGTCCGA

>735990220LD138137_1_SW_scaffold5692_size115363:86530-86548_+_miRNA-precursor_817_RC
CTGCAAATCGGACATCCCC

>735990234LD138123_1_SW_scaffold5635_size138164:12555-12575_-_miRNA-precursor_819_RC
GGAGCTCCCCCAAACACTTCA

>735990416LD137941_1_SW_scaffold5664_size59149:37013-37033_+_miRNA-precursor_823_RC
CCGGCAAGTCATCCTTGGCTG

>735990676LD137681_1_SW_scaffold4568_size64122:59384-59404_+_miRNA-precursor_832_RC
GGAGTTCCCCCAAACACTTCA

>735990993LD137364_1_SW_scaffold4796_size62939:35382-35403_-_miRNA-precursor_844_RC
AGATCAATGCGATCCCTTTGGA

>735991051LD137306_1_SW_scaffold5036_size61776:12507-12527_+_miRNA-precursor_846_RC
GGAGTTCCCCCAAACACTTCA

>735991410LD136947_1_SW_scaffold4582_size64058:17865-17885_-_miRNA-precursor_859_RC
CCGGCAAGTCATCCTTGGCTG

>735991794LD136563_1_SW_scaffold4234_size65909:2428-2448_+_miRNA-precursor_873_RC
TGCACGTGCCCTGCTTCTCCA

>735991794LD136563_1_SW_scaffold4234_size65909:12441-12461_+_miRNA-precursor_874_RC
TGCACGTGCCCTGCTTCTCCA

>735992187LD136170_1_SW_scaffold3771_size68584:63050-63070_-_miRNA-precursor_886_RC
CGGCATACAGGGAGCCAGGCA

>735992509LD135848_1_SW_scaffold3534_size69916:30993-31012_+_miRNA-precursor_897_RC
GTGCTCACTCTCTTCTGTCA

>735992539LD135818_1_SW_scaffold3492_size70202:59566-59585_-_miRNA-precursor_899_RC
AGGAGCTCCCTTCAGTCCAA

>735992970LD135387_1_SW_scaffold3002_size73454:39545-39565_+_miRNA-precursor_915_RC
ACATCATGTTCACGAGCCGCT

>735993067LD135290_1_SW_scaffold2942_size73918:53917-53936_-_miRNA-precursor_916_RC
AGAAGCCCTTGAGGGAGAGT

>735993067LD135290_1_SW_scaffold2942_size73918:54329-54348_-_miRNA-precursor_917_RC
AGAAGCCCTTGAGGGAGAGT

>735993368LD134989_1_SW_scaffold2733_size75506:58294-58314_+_miRNA-precursor_926_RC
GATATTGGCACGGCTCAATCA

>735993979LD134378_1_SW_scaffold2008_size82214:66467-66488_-_miRNA-precursor_958_RC
GGTATGGGTGGAGTAGGAAAGA

>735993979LD134378_1_SW_scaffold2008_size82214:68983-69004_-_miRNA-precursor_959_RC
GGTATGGGTGGAGTAGGAAAGA

>735995140LD133983_1_SW_scaffold1689_size86608:21238-21257_-_miRNA-precursor_973_RC
GGGAGCTCCCTTCAGTCCAA

>735995197LD133926_1_SW_scaffold1619_size87536:9376-9396_-_miRNA-precursor_974_RC
CCTGCCAAGAAAGAGAAGCCC

>735995390LD133733_1_SW_scaffold1099_size96485:64575-64595_-_miRNA-precursor_986_RC
TTAGAAGCCTTTGAGGGAGAT

>735995457LD133666_1_SW_scaffold989_size98414:40795-40815_+_miRNA-precursor_991_RC
TTCCCGACCTGCACCAAGCGA

>735995686LD133437_1_SW_scaffold1102_size96447:34599-34619_+_miRNA-precursor_1001_RC
GGGGAATGAAGCCTGGTCCGA

>735995796LD133327_1_SW_scaffold1066_size96981:11160-11179_+_miRNA-precursor_1010_RC
TAGAAGCCTTAAGGGAGAGT

>735995924LD133199_1_SW_scaffold744_size104800:73323-73343_-_miRNA-precursor_1012_RC
GGTGCTATCCCTCCTGAGCTT

>735995960LD133163_1_SW_scaffold828_size102702:81529-81547_-_miRNA-precursor_1016_RC
GAGTAATGATATGTGCACC

>735996159LD132964_1_SW_scaffold695_size106883:82643-82663_-_miRNA-precursor_1032_RC
GTGCCCTCTCTCTTCTGTCAA

>735996616LD132507_1_SW_scaffold81_size157070:153322-153342_-_miRNA-precursor_1058_RC
TATGCATGGCTCCTCATACGC
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)