blastn task: [no title]

Status
finished finished
Modified 2016-05-16T12:47:29Z
CPU time (s) 0.1
Size (bytes) 23955
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
           336 sequences; 9,910,115 total letters



Query= query

Length=810
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000073  Kluyveromyces aestuarii ATCC 18862 contig00077, w...   309    5e-84
  AEAS01000051  Kluyveromyces aestuarii ATCC 18862 contig00053, w...  48.2    2e-05
  AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, w...  44.6    3e-04
  AEAS01000167  Kluyveromyces aestuarii ATCC 18862 contig00180, w...  41.0    0.004
  AEAS01000317  Kluyveromyces aestuarii ATCC 18862 contig00649, w...  39.2    0.013
  AEAS01000157  Kluyveromyces aestuarii ATCC 18862 contig00168, w...  39.2    0.013
  AEAS01000046  Kluyveromyces aestuarii ATCC 18862 contig00048, w...  39.2    0.013
  AEAS01000208  Kluyveromyces aestuarii ATCC 18862 contig00227, w...  37.4    0.044
  AEAS01000018  Kluyveromyces aestuarii ATCC 18862 contig00020, w...  37.4    0.044
  AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, w...  33.7    0.54 
  AEAS01000234  Kluyveromyces aestuarii ATCC 18862 contig00534, w...  33.7    0.54 
  AEAS01000315  Kluyveromyces aestuarii ATCC 18862 contig00647, w...  31.9    1.9  
  AEAS01000245  Kluyveromyces aestuarii ATCC 18862 contig00546, w...  31.9    1.9  
  AEAS01000179  Kluyveromyces aestuarii ATCC 18862 contig00192, w...  31.9    1.9  
  AEAS01000166  Kluyveromyces aestuarii ATCC 18862 contig00179, w...  31.9    1.9  
  AEAS01000160  Kluyveromyces aestuarii ATCC 18862 contig00171, w...  31.9    1.9  
  AEAS01000125  Kluyveromyces aestuarii ATCC 18862 contig00131, w...  31.9    1.9  
  AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, w...  31.9    1.9  
  AEAS01000003  Kluyveromyces aestuarii ATCC 18862 contig00004, w...  31.9    1.9  
  AEAS01000336  Kluyveromyces aestuarii ATCC 18862 contig00682, w...  30.1    6.6  
  AEAS01000235  Kluyveromyces aestuarii ATCC 18862 contig00535, w...  30.1    6.6  
  AEAS01000168  Kluyveromyces aestuarii ATCC 18862 contig00181, w...  30.1    6.6  
  AEAS01000164  Kluyveromyces aestuarii ATCC 18862 contig00176, w...  30.1    6.6  
  AEAS01000150  Kluyveromyces aestuarii ATCC 18862 contig00159, w...  30.1    6.6  
  AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, w...  30.1    6.6  
  AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, w...  30.1    6.6  
  AEAS01000126  Kluyveromyces aestuarii ATCC 18862 contig00132, w...  30.1    6.6  
  AEAS01000107  Kluyveromyces aestuarii ATCC 18862 contig00112, w...  30.1    6.6  
  AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, w...  30.1    6.6  
  AEAS01000044  Kluyveromyces aestuarii ATCC 18862 contig00046, w...  30.1    6.6  
  AEAS01000042  Kluyveromyces aestuarii ATCC 18862 contig00044, w...  30.1    6.6  
  AEAS01000039  Kluyveromyces aestuarii ATCC 18862 contig00041, w...  30.1    6.6  


> AEAS01000073  Kluyveromyces aestuarii ATCC 18862 contig00077, 
whole genome shotgun sequence
Length=53734

 Score =  309 bits (342),  Expect = 5e-84
 Identities = 473/670 (71%), Gaps = 17/670 (2%)
 Strand=Plus/Minus

Query  1      GGTCAAACGTCATATTGATGGTATTGTACCTTTAGAATTACATATGACATTAAAGGTCGC  60
              ||| ||||| || |||||||| || || ||| |||| || ||    ||  |||| || ||
Sbjct  15155  GGTAAAACGACACATTGATGGAATCGTTCCTATAGACTTGCACCCAACTCTAAAAGTGGC  15096

Query  61     ATTGTC-CTTATGCTCATATAGATTCACGAAGGGCCCTTGGAGAAACAGTTATATCAAGC  119
               || || |||| | || || ||||| || |||||||| |||||||| || ||||| ||||
Sbjct  15095  GTTATCACTTAAG-TCTTACAGATTTACCAAGGGCCCATGGAGAAATAGCTATATTAAGC  15037

Query  120    TCGGTATTGACCCAAGAACCTCGAATGAGTACGCGAAATACCAGACCGAATATTTCAAAA  179
              | ||| |||| || |||  |||| ||  ||  |||   || ||||| ||||| |||||||
Sbjct  15036  TAGGTGTTGATCCGAGAGTCTCGGATAGGTTTGCGTGTTATCAGACGGAATACTTCAAAA  14977

Query  180    TCGAGAGGAGATTACTAACAGATCCAAGAATTAAAAAGAATTTGCCAGCTCCTCCACCAA  239
              | ||  | | | ||||    ||| |||| ||||  || ||| | ||| |||| ||||| |
Sbjct  14976  TAGAACGAAAACTACTTCATGATACAAGGATTACGAAAAATCTTCCACCTCCGCCACCCA  14917

Query  240    AGGACTACCAATCCAGTGTGCCTGGAGAAATTGACCCCAGGTTCGAATTTGACGGTAAAA  299
              |    |||||| | || |  || ||| |||| || |||||||||   ||||| || || |
Sbjct  14916  AACTTTACCAAACAAGCGATCCCGGAAAAATAGATCCCAGGTTCTTTTTTGATGGGAAGA  14857

Query  300    GTATTCCATGGTATCTAATGTTACAAATAGACTTACTTTTGAAAGAACCTAACATCAATG  359
              | |||||||||||| ||||||||||||||||| ||||||     |||||||| ||   ||
Sbjct  14856  GAATTCCATGGTATTTAATGTTACAAATAGACCTACTTTCCGGGGAACCTAATATTGCTG  14797

Query  360    AAATATATTCTCAAGTGGAGTTTTTGCCCGAGGCCAACGAATTAACAGGATGGTTTAACG  419
              |  | |  ||| |||   | |   ||  ||| |  || || ||||| |||||||| |  |
Sbjct  14796  AGGTCTTATCTGAAGCCAAATACCTGGACGAAGTAAATGAGTTAACTGGATGGTTCACAG  14737

Query  420    AGTTAGATTTAACGAAGATACGGAAAATTGTTAAGTACGAATTGGGTTGCATGGTCCAAG  479
              | || || || || |||||  |||||||||| || || ||  | || |||||||| ||||
Sbjct  14736  AATTGGACTTGACAAAGATTAGGAAAATTGTAAAATATGAGCTCGGGTGCATGGTGCAAG  14677

Query  480    GAAACTATGAATTCAACGAGCATAAATTGACATTTTTCAAAAGGATGATCTACGTCAAAG  539
              | || |  ||||| ||||| |||||| | |  || || || || ||| | || || | ||
Sbjct  14676  GCAATTTCGAATTTAACGAACATAAACTAAAGTTCTTTAAGAGAATGGTTTATGTTAGAG  14617

Query  540    AATCAATGATGAAAGACCAAGATGCGGATGGGGACGTGGAT-ATGGACCA----------  588
              |||| |||||||| || |||||||  ||||  ||  ||||  |||| | |          
Sbjct  14616  AATCCATGATGAAGGATCAAGATGGAGATGTAGATATGGACGATGGTCAAGAAGGCACTC  14557

Query  589    -AGA--TA-ACGACGATAATGGTGTGGAGGATGGAGAGATGGATGACGCCTTATTGGAAG  644
               |||  || | ||||||||||| || ||||| || ||| |||| || ||| |  | ||||
Sbjct  14556  CAGACCTAGATGACGATAATGGGGTCGAGGAAGGTGAGTTGGACGATGCCATTCTTGAAG  14497

Query  645    AGGCAGAAGA  654
              | ||||| ||
Sbjct  14496  AAGCAGAGGA  14487


> AEAS01000051  Kluyveromyces aestuarii ATCC 18862 contig00053, 
whole genome shotgun sequence
Length=130892

 Score = 48.2 bits (52),  Expect = 2e-05
 Identities = 34/39 (88%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  640   GGAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
             |||||||| ||| || |||||| ||||||||||||| ||
Sbjct  7197  GGAAGAGGAAGAGGAAGAAGAGGAAGAAGACGCAGATGA  7235


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  487    TGAATTCAACGAGCATA  503
              |||||||||||||||||
Sbjct  90534  TGAATTCAACGAGCATA  90550


> AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, 
whole genome shotgun sequence
Length=151927

 Score = 44.6 bits (48),  Expect = 3e-04
 Identities = 33/39 (85%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  640    GGAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              |||||| | ||||||||||||  ||||||| | ||||||
Sbjct  22499  GGAAGAAGAAGAAGATGAAGAAGAAGAAGATGAAGAAGA  22537


 Score = 42.8 bits (46),  Expect = 0.001
 Identities = 32/38 (85%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              ||||| | ||||||||||||  ||||||| | ||||||
Sbjct  22515  GAAGAAGAAGAAGATGAAGAAGAAGAAGATGAAGAAGA  22552


 Score = 35.6 bits (38),  Expect = 0.15
 Identities = 31/39 (80%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGAT  679
              ||||| | ||||||||||||  |||| || |  ||||||
Sbjct  22530  GAAGAAGAAGAAGATGAAGAAGAAGATGATGATGAAGAT  22568


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 25/30 (84%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  650    GAAGATGAAGAGCAAGAAGACGCAGAAGAT  679
              |||||||||||  | ||||| | |||||||
Sbjct  22563  GAAGATGAAGAAGAGGAAGAAGAAGAAGAT  22592


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  19      TGGTATTGTACCTTTAGAA  37
               |||||||||||||||| ||
Sbjct  121048  TGGTATTGTACCTTTACAA  121066


> AEAS01000167  Kluyveromyces aestuarii ATCC 18862 contig00180, 
whole genome shotgun sequence
Length=98644

 Score = 41.0 bits (44),  Expect = 0.004
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  642    AAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              ||||| ||||| | ||||||||||||||   ||||||
Sbjct  98171  AAGAGCCAGAACAAGAAGAGCAAGAAGAGCAAGAAGA  98135


> AEAS01000317  Kluyveromyces aestuarii ATCC 18862 contig00649, 
whole genome shotgun sequence
Length=24690

 Score = 39.2 bits (42),  Expect = 0.013
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGA  666
              ||||||| |||||| |||||||||||
Sbjct  18148  GAAGAGGAAGAAGAAGAAGAGCAAGA  18123


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 28/35 (80%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGA  675
              ||| | | ||||||||||||  ||||||| | |||
Sbjct  17884  GAAAATGAAGAAGATGAAGATGAAGAAGAGGTAGA  17850


> AEAS01000157  Kluyveromyces aestuarii ATCC 18862 contig00168, 
whole genome shotgun sequence
Length=59600

 Score = 39.2 bits (42),  Expect = 0.013
 Identities = 33/41 (81%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGATCA  681
              ||||| | ||||||||||||  ||||||| |  ||| ||||
Sbjct  28566  GAAGAAGAAGAAGATGAAGATGAAGAAGAAGGTGAAAATCA  28526


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 25/30 (84%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  649    AGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              ||||||||||||  ||||||| | ||| ||
Sbjct  28573  AGAAGATGAAGAAGAAGAAGATGAAGATGA  28544


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  197    ACAGATCCAAGAATTAA  213
              |||||||||||||||||
Sbjct  50723  ACAGATCCAAGAATTAA  50739


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  504    AATTGACATTTTTCAA  519
              ||||||||||||||||
Sbjct  35144  AATTGACATTTTTCAA  35159


> AEAS01000046  Kluyveromyces aestuarii ATCC 18862 contig00048, 
whole genome shotgun sequence
Length=21122

 Score = 39.2 bits (42),  Expect = 0.013
 Identities = 27/31 (88%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  649   AGAAGATGAAGAGCAAGAAGACGCAGAAGAT  679
             ||||||||||||  | ||||| |||||||||
Sbjct  5910  AGAAGATGAAGATAATGAAGAAGCAGAAGAT  5880


> AEAS01000208  Kluyveromyces aestuarii ATCC 18862 contig00227, 
whole genome shotgun sequence
Length=28736

 Score = 37.4 bits (40),  Expect = 0.044
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  645    AGGCAGAAGATGAAGAGCAAGAA  667
              ||| |||||||||||||||||||
Sbjct  25480  AGGAAGAAGATGAAGAGCAAGAA  25502


> AEAS01000018  Kluyveromyces aestuarii ATCC 18862 contig00020, 
whole genome shotgun sequence
Length=17326

 Score = 37.4 bits (40),  Expect = 0.044
 Identities = 33/41 (81%), Gaps = 3/41 (7%)
 Strand=Plus/Plus

Query  641  GAAGAGGCAGA---AGATGAAGAGCAAGAAGACGCAGAAGA  678
            ||||||| |||   |||  ||||||||||||| | ||||||
Sbjct  594  GAAGAGGAAGAGCAAGAGCAAGAGCAAGAAGAAGAAGAAGA  634


 Score = 35.6 bits (38),  Expect = 0.15
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  640  GGAAGAGGCAGAAGATGAAGAGCAAGA  666
            ||||||||  ||||| |||||||||||
Sbjct  584  GGAAGAGGATGAAGAGGAAGAGCAAGA  610


> AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, 
whole genome shotgun sequence
Length=84350

 Score = 33.7 bits (36),  Expect = 0.54
 Identities = 25/28 (90%), Gaps = 1/28 (3%)
 Strand=Plus/Plus

Query  336    TTTTGAAAGAACCTAACATCAATGAAAT  363
              ||||| |||| | |||||||||||||||
Sbjct  20897  TTTTGTAAGAGC-TAACATCAATGAAAT  20923


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  35     GAATTACATATGACATTAAAGG  56
              ||||  ||||||||||||||||
Sbjct  64556  GAATGTCATATGACATTAAAGG  64577


> AEAS01000234  Kluyveromyces aestuarii ATCC 18862 contig00534, 
whole genome shotgun sequence
Length=70289

 Score = 33.7 bits (36),  Expect = 0.54
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              || |||| ||||||||||||  |||| || |  |||||
Sbjct  51699  GATGAGGAAGAAGATGAAGATGAAGATGAAGATGAAGA  51662


 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  511    ATTTTTCAAAAGGATGATCT  530
              ||||||||||||| ||||||
Sbjct  21357  ATTTTTCAAAAGGTTGATCT  21338


> AEAS01000315  Kluyveromyces aestuarii ATCC 18862 contig00647, 
whole genome shotgun sequence
Length=19817

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 31/40 (78%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  640    GGAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGAT  679
              |||||| | ||||||||||||  |||  ||| | ||| ||
Sbjct  12224  GGAAGATGAAGAAGATGAAGATAAAGGTGACTCTGAACAT  12263


> AEAS01000245  Kluyveromyces aestuarii ATCC 18862 contig00546, 
whole genome shotgun sequence
Length=17774

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 29/37 (79%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  644   GAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGATC  680
             || || |||||||||||  |||| || |  |||||||
Sbjct  4938  GATGCTGAAGATGAAGATGAAGATGAAGATGAAGATC  4974


> AEAS01000179  Kluyveromyces aestuarii ATCC 18862 contig00192, 
whole genome shotgun sequence
Length=61779

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 26/31 (84%), Gaps = 3/31 (9%)
 Strand=Plus/Plus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACG  671
              ||||| | |||||||||||   |||||||||
Sbjct  22961  GAAGACGAAGAAGATGAAG---AAGAAGACG  22988


> AEAS01000166  Kluyveromyces aestuarii ATCC 18862 contig00179, 
whole genome shotgun sequence
Length=227372

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 30/38 (79%), Gaps = 3/38 (7%)
 Strand=Plus/Plus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGA  678
              |||||||   | || || ||||||||||| | ||||||
Sbjct  11972  GAAGAGG---ATGAGGAGGAGCAAGAAGAAGGAGAAGA  12006


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  505     ATTGACATTTTTCAAAAGGATGATCT  530
               || ||||||||||||||  |||| ||
Sbjct  222862  ATGGACATTTTTCAAAATAATGAGCT  222887


> AEAS01000160  Kluyveromyces aestuarii ATCC 18862 contig00171, 
whole genome shotgun sequence
Length=114832

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  91     GGGCCCTTGGAGAAACAGTTAT  112
              |||||||||||||||| | |||
Sbjct  75830  GGGCCCTTGGAGAAACTGGTAT  75851


> AEAS01000125  Kluyveromyces aestuarii ATCC 18862 contig00131, 
whole genome shotgun sequence
Length=46256

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  638    TTGGAAGAGGCAGAAGA  654
              |||||||||||||||||
Sbjct  33026  TTGGAAGAGGCAGAAGA  33042


> AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, 
whole genome shotgun sequence
Length=72341

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 30/37 (82%), Gaps = 1/37 (2%)
 Strand=Plus/Plus

Query  277    CAGGTTCGAATTTGACGGTAAAAGTATTCCA-TGGTA  312
              || || | |||||||||||||| || || || |||||
Sbjct  13846  CAAGTACAAATTTGACGGTAAATGTTTTGCACTGGTA  13882


> AEAS01000003  Kluyveromyces aestuarii ATCC 18862 contig00004, 
whole genome shotgun sequence
Length=80680

 Score = 31.9 bits (34),  Expect = 1.9
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  163    GACCGAATATTTCAAAATCGAGAGG  187
              ||||||| | | |||||||||||||
Sbjct  63376  GACCGAAAAATCCAAAATCGAGAGG  63400


> AEAS01000336  Kluyveromyces aestuarii ATCC 18862 contig00682, 
whole genome shotgun sequence
Length=139775

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 27/34 (80%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  596  GACGATAATGGTGTGGAGGATGGAGAGATGGATG  629
            ||| || | | || |||||| | |||||||||||
Sbjct  452  GACAATGAAGTTGAGGAGGAGGAAGAGATGGATG  419


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  695    GCATTGAAATCGGAAATATCT  715
              ||||||||||| | |||||||
Sbjct  56938  GCATTGAAATCAGCAATATCT  56958


> AEAS01000235  Kluyveromyces aestuarii ATCC 18862 contig00535, 
whole genome shotgun sequence
Length=66971

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  413    TTTAACGAGTTAGATTTAACG  433
              ||||||||||| ||||| |||
Sbjct  62662  TTTAACGAGTTGGATTTTACG  62682


> AEAS01000168  Kluyveromyces aestuarii ATCC 18862 contig00181, 
whole genome shotgun sequence
Length=43118

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  718    TGGTAAGCAAGATGAAAAT  736
              ||||||||||||||| |||
Sbjct  32618  TGGTAAGCAAGATGACAAT  32600


> AEAS01000164  Kluyveromyces aestuarii ATCC 18862 contig00176, 
whole genome shotgun sequence
Length=46955

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 31/41 (76%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  650    GAAGATGAAGAGCAAGAAGACGCAGAAGATCAGGCCGGCGA  690
              |||||||||||  |||| || |  |||||| | | || |||
Sbjct  20297  GAAGATGAAGACGAAGACGAAGACGAAGATGAAGACGACGA  20337


> AEAS01000150  Kluyveromyces aestuarii ATCC 18862 contig00159, 
whole genome shotgun sequence
Length=19989

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 28/36 (78%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  559    AGATGCGGATGGGGACGTGGATATGGACCAAGATAA  594
              ||||| ||| ||| |||  | ||  |||||||||||
Sbjct  10337  AGATGAGGAAGGGTACGACGTTAATGACCAAGATAA  10302


> AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, 
whole genome shotgun sequence
Length=165313

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  576   TGGATATGGACCAAGATAACG  596
             ||||||||||| |||| ||||
Sbjct  8616  TGGATATGGACGAAGAAAACG  8636


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 33/44 (75%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  641    GAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGATCAGGC  684
              ||||| |  |||||||||||  | ||||| | ||| || || ||
Sbjct  35611  GAAGACGATGAAGATGAAGACGATGAAGATGAAGAGGAACAAGC  35568


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  207    GAATTAAAAAGAATTT  222
              ||||||||||||||||
Sbjct  56616  GAATTAAAAAGAATTT  56601


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  361     AATATATTCTCAAGTGGAGTTTTTGC  386
               ||||  |||||||||||||  |||||
Sbjct  150579  AATAGTTTCTCAAGTGGAGCGTTTGC  150554


 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  657     AAGAGCAAGAAGACGCAGAAG  677
               ||||||||||||| | |||||
Sbjct  163214  AAGAGCAAGAAGAAGAAGAAG  163194


> AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, 
whole genome shotgun sequence
Length=95829

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  425    GATTTAACGAAGATACGGAAA  445
              || |||||||||||| |||||
Sbjct  87014  GACTTAACGAAGATATGGAAA  87034


> AEAS01000126  Kluyveromyces aestuarii ATCC 18862 contig00132, 
whole genome shotgun sequence
Length=21234

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  638  TTGGAAGAGGCAGAAG  653
            ||||||||||||||||
Sbjct  60   TTGGAAGAGGCAGAAG  45


> AEAS01000107  Kluyveromyces aestuarii ATCC 18862 contig00112, 
whole genome shotgun sequence
Length=30873

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  70     ATGCTCATATAGATTC  85
              ||||||||||||||||
Sbjct  11799  ATGCTCATATAGATTC  11784


> AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, 
whole genome shotgun sequence
Length=148475

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  618   GAGAGATGGATGACGCCTTATTGG  641
             |||||||||||||| | || ||||
Sbjct  991   GAGAGATGGATGACACTTTCTTGG  1014


> AEAS01000044  Kluyveromyces aestuarii ATCC 18862 contig00046, 
whole genome shotgun sequence
Length=33514

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  650   GAAGATGAAGAGCAAGAAGACGCAGA  675
             |||||||||||  ||||||| | |||
Sbjct  6886  GAAGATGAAGACGAAGAAGATGGAGA  6861


> AEAS01000042  Kluyveromyces aestuarii ATCC 18862 contig00044, 
whole genome shotgun sequence
Length=70813

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  176    AAAATCGAGAGGAGATTACTA  196
              ||||||||||||| ||| |||
Sbjct  15163  AAAATCGAGAGGATATTCCTA  15183


> AEAS01000039  Kluyveromyces aestuarii ATCC 18862 contig00041, 
whole genome shotgun sequence
Length=15675

 Score = 30.1 bits (32),  Expect = 6.6
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  374    GTGGAGTTTTTGCCCGAGGCC  394
              || ||||||||||||||| ||
Sbjct  14794  GTTGAGTTTTTGCCCGAGTCC  14814



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 7762681136


  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GGTCAAACGTCATATTGATGGTATTGTACCTTTAGAATTACATATGACATTAAAGGTCGCATTGTCCTTATGCTCATATAGATTCACGAAGGGCCCTTGGAGAAACAGTTATATCAAGCTCGGTATTGACCCAAGAACCTCGAATGAGTACGCGAAATACCAGACCGAATATTTCAAAATCGAGAGGAGATTACTAACAGATCCAAGAATTAAAAAGAATTTGCCAGCTCCTCCACCAAAGGACTACCAATCCAGTGTGCCTGGAGAAATTGACCCCAGGTTCGAATTTGACGGTAAAAGTATTCCATGGTATCTAATGTTACAAATAGACTTACTTTTGAAAGAACCTAACATCAATGAAATATATTCTCAAGTGGAGTTTTTGCCCGAGGCCAACGAATTAACAGGATGGTTTAACGAGTTAGATTTAACGAAGATACGGAAAATTGTTAAGTACGAATTGGGTTGCATGGTCCAAGGAAACTATGAATTCAACGAGCATAAATTGACATTTTTCAAAAGGATGATCTACGTCAAAGAATCAATGATGAAAGACCAAGATGCGGATGGGGACGTGGATATGGACCAAGATAACGACGATAATGGTGTGGAGGATGGAGAGATGGATGACGCCTTATTGGAAGAGGCAGAAGATGAAGAGCAAGAAGACGCAGAAGATCAGGCCGGCGAGTCGGCATTGAAATCGGAAATATCTGATGGTAAGCAAGATGAAAATTCAGAACCTGATACTTTTGACATAAAAACTGCTTCGTTCAACGAAGTTATGGATAAGATAGCCAAGCATAACTC
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)