blastn task: [no title]

Status
finished finished
Modified 2016-05-16T11:38:29Z
CPU time (s) 0.0
Size (bytes) 16713
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
           336 sequences; 9,910,115 total letters



Query= 
Length=864
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000027  Kluyveromyces aestuarii ATCC 18862 contig00029, w...   879    0.0  
  AEAS01000044  Kluyveromyces aestuarii ATCC 18862 contig00046, w...  53.6    6e-07
  AEAS01000046  Kluyveromyces aestuarii ATCC 18862 contig00048, w...  31.9    2.0  
  AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, w...  31.9    2.0  
  AEAS01000322  Kluyveromyces aestuarii ATCC 18862 contig00658, w...  30.1    7.0  
  AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, w...  30.1    7.0  
  AEAS01000258  Kluyveromyces aestuarii ATCC 18862 contig00562, w...  30.1    7.0  
  AEAS01000254  Kluyveromyces aestuarii ATCC 18862 contig00556, w...  30.1    7.0  
  AEAS01000247  Kluyveromyces aestuarii ATCC 18862 contig00548, w...  30.1    7.0  
  AEAS01000205  Kluyveromyces aestuarii ATCC 18862 contig00223, w...  30.1    7.0  
  AEAS01000179  Kluyveromyces aestuarii ATCC 18862 contig00192, w...  30.1    7.0  
  AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, w...  30.1    7.0  
  AEAS01000127  Kluyveromyces aestuarii ATCC 18862 contig00133, w...  30.1    7.0  
  AEAS01000111  Kluyveromyces aestuarii ATCC 18862 contig00116, w...  30.1    7.0  
  AEAS01000099  Kluyveromyces aestuarii ATCC 18862 contig00104, w...  30.1    7.0  
  AEAS01000097  Kluyveromyces aestuarii ATCC 18862 contig00102, w...  30.1    7.0  
  AEAS01000077  Kluyveromyces aestuarii ATCC 18862 contig00081, w...  30.1    7.0  
  AEAS01000072  Kluyveromyces aestuarii ATCC 18862 contig00076, w...  30.1    7.0  
  AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, w...  30.1    7.0  
  AEAS01000051  Kluyveromyces aestuarii ATCC 18862 contig00053, w...  30.1    7.0  


> AEAS01000027  Kluyveromyces aestuarii ATCC 18862 contig00029, 
whole genome shotgun sequence
Length=33180

 Score =  879 bits (974),  Expect = 0.0
 Identities = 711/857 (83%), Gaps = 5/857 (0%)
 Strand=Plus/Plus

Query  7      TACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAAG  66
              ||||| || |||||||| ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct  26567  TACACCACTAGACAAATTGGTGCTAAGAACACTTTGGACTACAAGGTCTTCATTGAAAAG  26626

Query  67     GATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGGT  126
              |||||||||   || ||| | ||||| ||||| ||||||||||| || || |||||||||
Sbjct  26627  GATGGCAAGGTTGTTTCTCCATTCCATGACATTCCATTGTACGCAGATGAGGCCAATGGT  26686

Query  127    ATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAG  186
              || || ||||||||||| ||||||||||||||||| || || ||||| |||||  | |||
Sbjct  26687  ATTTTTAACATGGTTGTTGAAATCCCACGTTGGACTAATGCTAAGTTAGAAATTTCTAAG  26746

Query  187    GAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGA  246
              || || |  ||||| || || || ||||||||||||||||||||| | ||||  || |||
Sbjct  26747  GAAGAAAGTTTGAATCCTATTATTCAAGACACCAAGAAGGGTAAGTTGAGATACGTCAGA  26806

Query  247    AACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAA  306
              ||||||||||| |||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct  26807  AACTGTTTCCCTCACCACGGTTACATTCACAACTACGGTGCTTTCCCACAAACTTGGGAA  26866

Query  307    GATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTG  366
              |||||||||||  | ||||||||||| ||||| | ||||||  |||||||| | ||||| 
Sbjct  26867  GATCCTAACGAAGCTCACCCAGAAACTAAGGCAGCTGGTGATGACGATCCACTAGATGTT  26926

Query  367    TTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGGT  426
              || ||||| ||||||||||| || |||||||||||| | || ||||| |||||| | |||
Sbjct  26927  TTAGAAATTGGTGAACAAGTTGCTTACACTGGTCAAATCAAACAAGTTAAGGTTTTGGGT  26986

Query  427    GTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAAC  486
              || ||||| |||||||| |||||||| || |||||||| || ||||| |||||  |||| 
Sbjct  26987  GTTATGGCTTTGTTGGATGAAGGTGAAACTGACTGGAAAGTTATTGTTATCGATGTCAAT  27046

Query  487    GATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTTG  546
              ||||||||||| |||||||||||||||||||| ||||| || ||||||||||||||||||
Sbjct  27047  GATCCATTGGCTCCAAAGTTGAACGACATTGAAGATGTGGAAAAGCACTTGCCAGGTTTG  27106

Query  547    CTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAAC  606
               | ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct  27107  TTGAGAGCTACCAACGAATGGTTCAGAATCTACAAGATTCCTGACGGTAAGCCAGAAAAC  27166

Query  607    CAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGAG  666
              |||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |||
Sbjct  27167  CAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTTTGGAAGTTATCAGAGAG  27226

Query  667    TGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGAT  726
              |||||||||||||||||| | ||||||   ||||||   | ||| |||||| | |    |
Sbjct  27227  TGTAACGAAGCTTGGAAGCAATTGATTGGTGGTAAG---GTTGATGCTAAGGACACTAGT  27283

Query  727    TTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGTT  786
              ||||||||||| ||  |    || |||||  |||| ||||  || ||  |  || | |||
Sbjct  27284  TTGACCAACACTACCCTAACTGAAACTGCTGCTTATTCTGATGAAGCCTCCACTTCAGTT  27343

Query  787    CCACCAGCACACGTC-TTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTT  845
              ||  | ||  || || |||  ||| |  ||| | ||||||||  ||||||| ||||||||
Sbjct  27344  CCTGCTGC-TACCTCTTTGGAAGATGCTCCAGTTGACAAGTCAGTTGACAAATGGTTCTT  27402

Query  846    CATCTCCGGTTCTGCTT  862
              |||||| ||||| ||||
Sbjct  27403  CATCTCTGGTTCCGCTT  27419


> AEAS01000044  Kluyveromyces aestuarii ATCC 18862 contig00046, 
whole genome shotgun sequence
Length=33514

 Score = 53.6 bits (58),  Expect = 6e-07
 Identities = 327/513 (64%), Gaps = 22/513 (4%)
 Strand=Plus/Plus

Query  132    CAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGA--G  189
              |||||||||||| ||| | || || ||||| || |  || || || || |  | | |   
Sbjct  24183  CAACATGGTTGTTGAAGTTCCTCGCTGGACAAATGGTAAATTCGAGATAA--ATGTATCC  24240

Query  190    GAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAAC  249
              |||||  | || || || |  || || |  |||||||| |  |  |||||  | |  || 
Sbjct  24241  GAGAAACTTAATCCTATAACACAGGATATAAAGAAGGGAACCCCCAGATTCATTAATAAT  24300

Query  250    TGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGAT  309
                ||||||  | || || || || || || || || ||  |||| ||||| |||||| | 
Sbjct  24301  ATTTTCCCTTATCATGGCTATATTCATAATTATGGAGCAATCCCTCAAACTTGGGAACAA  24360

Query  310    CCTAACG----AGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGT  365
              || ||||    |||     | || |  ||||      ||||| || ||||| || ||| |
Sbjct  24361  CCGAACGTGGAAGT-TTTGCAAGGACTCAAG------GGTGATAATGATCCCTTAGAT-T  24412

Query  366    GTTG-GAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTG  424
              |||| ||||| ||   |   || ||    |  ||| |  | ||   ||| ||  || || 
Sbjct  24413  GTTGTGAAATTGGATCAGCCGTGGCTGGAATGGGTGATATTAAAACAGTAAAAATT-TTA  24471

Query  425    GTGTGA-TGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATC  483
              | || | | ||  || | ||||| || |||   || ||||| ||||||   || || |||
Sbjct  24472  GGGTCACTAGCTCTGATCGACGATGGGGAGTTAGATTGGAAAGTGATTTGTATTGATATC  24531

Query  484    AACGATCCATTGGCCCCAAAGTTGAACGACATT-GAGGATGTCGAGAAGCACTTGCCAGG  542
              || || ||||||||||   |  | ||| || || |  ||||| || |  ||  |||| ||
Sbjct  24532  AATGACCCATTGGCCCATGAAATAAAC-ACTTTGGTAGATGTAGACACTCATATGCCGGG  24590

Query  543    TTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGA  602
               ||  ||   || || |   | ||||| |||  |||||| |||||    || ||||| | 
Sbjct  24591  CTTATTAGAGGCTACCAGAAATTGGTTTAGAGACTACAAAATTCCTACAGGCAAGCCTGC  24650

Query  603    AAACCAATTTGCCTTCTCTGGTGAA-GCCAAGA  634
              |||    ||||||||   |||||||  ||||||
Sbjct  24651  AAATTCCTTTGCCTTTGATGGTGAATACCAAGA  24683


> AEAS01000046  Kluyveromyces aestuarii ATCC 18862 contig00048, 
whole genome shotgun sequence
Length=21122

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  353    ATCCATTGGATGTGTTGGAAAT  374
              ||| |||||||||||| |||||
Sbjct  13502  ATCTATTGGATGTGTTTGAAAT  13481


> AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, 
whole genome shotgun sequence
Length=106698

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  500    CAAAGTTGAACGACATTGAG  519
              ||||||||||| ||||||||
Sbjct  20646  CAAAGTTGAACAACATTGAG  20665


> AEAS01000322  Kluyveromyces aestuarii ATCC 18862 contig00658, 
whole genome shotgun sequence
Length=103820

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  54    TTTCATCGAAAAGGAT  69
             ||||||||||||||||
Sbjct  9782  TTTCATCGAAAAGGAT  9767


 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  816    AATCGACAAGTCCATTGACAA  836
              |||| |||||||||||| |||
Sbjct  71083  AATCTACAAGTCCATTGCCAA  71063


> AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, 
whole genome shotgun sequence
Length=151927

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  700    AAGTCTGCTGACGCTAAGAAGATCGA  725
              |||||||  | ||||||||||| |||
Sbjct  24424  AAGTCTGAAGCCGCTAAGAAGAGCGA  24449


> AEAS01000258  Kluyveromyces aestuarii ATCC 18862 contig00562, 
whole genome shotgun sequence
Length=20201

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  565    TGGTTCAGAATCTACAAGATT  585
              || |||||| |||||||||||
Sbjct  18475  TGTTTCAGATTCTACAAGATT  18455


> AEAS01000254  Kluyveromyces aestuarii ATCC 18862 contig00556, 
whole genome shotgun sequence
Length=60282

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  573    AATCTACAAGATTCCA  588
              ||||||||||||||||
Sbjct  46863  AATCTACAAGATTCCA  46878


> AEAS01000247  Kluyveromyces aestuarii ATCC 18862 contig00548, 
whole genome shotgun sequence
Length=33401

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  552   AGCCACTAACGAATGGTTCAGAAT  575
             ||||  |||| |||||||||||||
Sbjct  5495  AGCCCTTAACAAATGGTTCAGAAT  5472


> AEAS01000205  Kluyveromyces aestuarii ATCC 18862 contig00223, 
whole genome shotgun sequence
Length=19494

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 24/29 (83%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  478   GACATCAACGATCCATTGGCCCCAAAGTT  506
             ||||  ||||||||||||||  ||| |||
Sbjct  3121  GACACAAACGATCCATTGGCTGCAATGTT  3093


> AEAS01000179  Kluyveromyces aestuarii ATCC 18862 contig00192, 
whole genome shotgun sequence
Length=61779

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  168   CAAGTTGGAAATCACC  183
             ||||||||||||||||
Sbjct  5147  CAAGTTGGAAATCACC  5132


> AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, 
whole genome shotgun sequence
Length=95829

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  565    TGGTTCAGAATCTACA  580
              ||||||||||||||||
Sbjct  66743  TGGTTCAGAATCTACA  66728


> AEAS01000127  Kluyveromyces aestuarii ATCC 18862 contig00133, 
whole genome shotgun sequence
Length=111072

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  585    TCCAGACGGTAAGCCAGAA  603
              ||||||||||| |||||||
Sbjct  81677  TCCAGACGGTAGGCCAGAA  81659


 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  585    TCCAGACGGTAAGCCAGAA  603
              ||||||||||| |||||||
Sbjct  81774  TCCAGACGGTAGGCCAGAA  81756


> AEAS01000111  Kluyveromyces aestuarii ATCC 18862 contig00116, 
whole genome shotgun sequence
Length=90498

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  511   GACATTGAGGATGTCGAGAAG  531
             || ||||||||||| ||||||
Sbjct  4775  GAGATTGAGGATGTAGAGAAG  4755


> AEAS01000099  Kluyveromyces aestuarii ATCC 18862 contig00104, 
whole genome shotgun sequence
Length=68330

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  120    CAATGGTATCTTCAACATGGT  140
              || ||||||||||| ||||||
Sbjct  31312  CACTGGTATCTTCATCATGGT  31332


> AEAS01000097  Kluyveromyces aestuarii ATCC 18862 contig00102, 
whole genome shotgun sequence
Length=103414

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  47     ACAAAGTTTTCATCGA  62
              ||||||||||||||||
Sbjct  50475  ACAAAGTTTTCATCGA  50490


> AEAS01000077  Kluyveromyces aestuarii ATCC 18862 contig00081, 
whole genome shotgun sequence
Length=57574

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  342    TGGTGACAACGATCCATTGGA  362
              || |||||| |||||||||||
Sbjct  12439  TGATGACAAGGATCCATTGGA  12459


> AEAS01000072  Kluyveromyces aestuarii ATCC 18862 contig00076, 
whole genome shotgun sequence
Length=90370

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  674    AAGCTTGGAAGAAGTTGATTT  694
              ||| |||||||||||| ||||
Sbjct  43889  AAGTTTGGAAGAAGTTAATTT  43869


> AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, 
whole genome shotgun sequence
Length=81824

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  411   AGTCAAGGTTCTTGGT  426
             ||||||||||||||||
Sbjct  6887  AGTCAAGGTTCTTGGT  6872


> AEAS01000051  Kluyveromyces aestuarii ATCC 18862 contig00053, 
whole genome shotgun sequence
Length=130892

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  128    TCTTCAACATGGTTGT  143
              ||||||||||||||||
Sbjct  80400  TCTTCAACATGGTTGT  80415



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8297355602


  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>
ATGTCTTACACTACCAGACAAATCGGTGCCAAGAACACCTTGGACTACAAAGTTTTCATCGAAAAGGATGGCAAGCCAGTGTCTGCCTTCCACGACATCCCATTGTACGCTGACGAAGCCAATGGTATCTTCAACATGGTTGTCGAAATCCCACGTTGGACCAACGCCAAGTTGGAAATCACCAAGGAGGAGAAGTTGAACCCAATCATCCAAGACACCAAGAAGGGTAAGCTAAGATTTGTGAGAAACTGTTTCCCACACCACGGTTACATCCACAACTACGGTGCCTTCCCACAAACCTGGGAAGATCCTAACGAGTCCCACCCAGAAACCAAGGCTGTTGGTGACAACGATCCATTGGATGTGTTGGAAATCGGTGAACAAGTCGCATACACTGGTCAAGTGAAGCAAGTCAAGGTTCTTGGTGTGATGGCCTTGTTGGACGAAGGTGAGACCGACTGGAAGGTGATTGTGATCGACATCAACGATCCATTGGCCCCAAAGTTGAACGACATTGAGGATGTCGAGAAGCACTTGCCAGGTTTGCTAAGAGCCACTAACGAATGGTTCAGAATCTACAAGATTCCAGACGGTAAGCCAGAAAACCAATTTGCCTTCTCTGGTGAAGCCAAGAACAAGAAGTACGCTCTAGAAGTGATCAGGGAGTGTAACGAAGCTTGGAAGAAGTTGATTTCCGGTAAGTCTGCTGACGCTAAGAAGATCGATTTGACCAACACCACGTTGGTCGACACTGCCACTTACTCTGCCGAGGCAGCTGCTGCTGTTCCACCAGCACACGTCTTGCCAGACGAGCCAATCGACAAGTCCATTGACAAGTGGTTCTTCATCTCCGGTTCTGCTTGA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)