blastn task: ste12

Status
finished finished
Modified 2018-06-19T16:24:45Z
CPU time (s) 0.6
Size (bytes) 308716
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna yeast.nt' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes;
Kluyveromyces lactis; Kluyveromyces lactis NRRL Y-1140;
Saccharomyces cerevisiae
           20,007 sequences; 72,458,844 total letters



Query= query

Length=717
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|6322960|ref|NC_001144.1| Saccharomyces cerevisiae chromosome...  1294    0.0  
  gi|6324406|ref|NC_001147.1| Saccharomyces cerevisiae chromosome...  68.0    2e-10
  gsASS001Lm                                                          64.4    2e-09
  KLDOg4824                                                           64.4    2e-09
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  53.6    4e-06
  KLLA0E04995g KLLA0E04995g undefined product 6293776:6294522 rev...  53.6    4e-06
  KLDOg2586                                                           51.8    1e-05
  KLDOg2424                                                           50.0    4e-05
  KLWIg852 KLWIg852 undefined product 1774503:1776416 reverse         48.2    2e-04
  KLDOg2477                                                           44.6    0.002
  KLWIg4784 KLWIg4784 undefined product 9762495:9763444 reverse       44.6    0.002
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  44.6    0.002
  KLLA0D00836g KLLA0D00836g undefined product 4215583:4217505 rev...  44.6    0.002
  AEAS01000121  Kluyveromyces aestuarii ATCC 18862 contig00127, w...  44.6    0.002
  KLAEg3779 KLAEg3779 undefined product 7980251:7980970 forward       44.6    0.002
  KLAEg687 KLAEg687 undefined product 1507295:1509007 forward         44.6    0.002
  gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome...  42.8    0.007
  KLDOg2960                                                           42.8    0.007
  KLDOg2359                                                           42.8    0.007
  KLWIg4661 KLWIg4661 undefined product 9494270:9495514 reverse       42.8    0.007
  KLWIg908 KLWIg908 undefined product 1870356:1873343 reverse         42.8    0.007
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  42.8    0.007
  KLLA0D04136g KLLA0D04136g undefined product 4488357:4489505 for...  42.8    0.007
  KLLA0B08305g KLLA0B08305g undefined product 1800557:1802764 for...  42.8    0.007
  AEAS01000147  Kluyveromyces aestuarii ATCC 18862 contig00156, w...  42.8    0.007
  KLAEg4455 KLAEg4455 undefined product 9490784:9492928 forward       42.8    0.007
  gi|6322623|ref|NC_001143.1| Saccharomyces cerevisiae chromosome...  41.0    0.023
  gi|6322236|ref|NC_001142.1| Saccharomyces cerevisiae chromosome...  41.0    0.023
  gi|6321173|ref|NC_001139.1| Saccharomyces cerevisiae chromosome...  41.0    0.023
  KLDOg3775                                                           41.0    0.023
  KLDOg899                                                            41.0    0.023
  KLDOg73                                                             41.0    0.023
  KLWIg656 KLWIg656 undefined product 1388799:1390553 reverse         41.0    0.023
  gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome...  41.0    0.023
  KLLA0E02311g KLLA0E02311g undefined product 6066919:6068172 rev...  41.0    0.023
  KLLA0C15697g KLLA0C15697g undefined product 3743713:3744627 for...  41.0    0.023
  AEAS01000317  Kluyveromyces aestuarii ATCC 18862 contig00649, w...  41.0    0.023
  AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, w...  41.0    0.023
  KLAEg4576 KLAEg4576 undefined product 9761141:9763135 forward       41.0    0.023
  KLAEg2012 KLAEg2012 undefined product 4253223:4255067 reverse       41.0    0.023
  KLAEg1369 KLAEg1369 undefined product 2896279:2899001 forward       41.0    0.023
  gi|6324971|ref|NC_001148.1| Saccharomyces cerevisiae chromosome...  39.2    0.081
  gi|6862570|ref|NC_001140.2| Saccharomyces cerevisiae chromosome...  39.2    0.081
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  39.2    0.081
  KLDOg4018                                                           39.2    0.081
  KLDOg3021                                                           39.2    0.081
  KLDOg1733                                                           39.2    0.081
  KLDOg1475                                                           39.2    0.081
  KLDOg798                                                            39.2    0.081
  KLDOg743                                                            39.2    0.081
  KLDOg632                                                            39.2    0.081
  KLWIg3760 KLWIg3760 undefined product 7617774:7619237 forward       39.2    0.081
  KLWIg2334 KLWIg2334 undefined product 4771564:4773369 forward       39.2    0.081
  KLWIg1928 KLWIg1928 undefined product 3977301:3978368 forward       39.2    0.081
  KLWIg1318 KLWIg1318 undefined product 2688152:2690893 forward       39.2    0.081
  gsASS001Lm                                                          39.2    0.081
  KLLA0E00771g KLLA0E00771g undefined product 5930908:5932248 for...  39.2    0.081
  KLLA0C16797g KLLA0C16797g undefined product 3850407:3853349 for...  39.2    0.081
  KLLA0C11209g KLLA0C11209g undefined product 3346412:3348295 for...  39.2    0.081
  KLLA0B09746g KLLA0B09746g undefined product 1912992:1914365 for...  39.2    0.081
  KLLA0B08679g KLLA0B08679g undefined product 1830398:1831489 for...  39.2    0.081
  KLLA0A07689g KLLA0A07689g undefined product 686738:687457 reverse   39.2    0.081
  KLLA0A07425g KLLA0A07425g undefined product 663956:668764 reverse   39.2    0.081
  KLLA0A06710g KLLA0A06710g undefined product 608103:609374 forward   39.2    0.081
  AEAS01000336  Kluyveromyces aestuarii ATCC 18862 contig00682, w...  39.2    0.081
  AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, w...  39.2    0.081
  AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, w...  39.2    0.081
  AEAS01000093  Kluyveromyces aestuarii ATCC 18862 contig00098, w...  39.2    0.081
  AEAS01000051  Kluyveromyces aestuarii ATCC 18862 contig00053, w...  39.2    0.081
  KLAEg3293 KLAEg3293 undefined product 6935842:6936411 forward       39.2    0.081
  KLAEg2282 KLAEg2282 undefined product 4821687:4822259 forward       39.2    0.081
  KLAEg2271 KLAEg2271 undefined product 4802384:4803172 forward       39.2    0.081
  KLAEg1377 KLAEg1377 undefined product 2918005:2919279 reverse       39.2    0.081
  KLAEg980 KLAEg980 undefined product 2122928:2124976 reverse         39.2    0.081
  KLAEg581 KLAEg581 undefined product 1256115:1257290 reverse         39.2    0.081
  gi|6323989|ref|NC_001146.1| Saccharomyces cerevisiae chromosome...  37.4    0.28 
  gi|6322016|ref|NC_001141.1| Saccharomyces cerevisiae chromosome...  37.4    0.28 
  gi|7276232|ref|NC_001137.2| Saccharomyces cerevisiae chromosome...  37.4    0.28 
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    0.28 
  KLDOg4829                                                           37.4    0.28 
  KLDOg4613                                                           37.4    0.28 
  KLDOg4198                                                           37.4    0.28 
  KLDOg3707                                                           37.4    0.28 
  KLDOg3669                                                           37.4    0.28 
  KLDOg2778                                                           37.4    0.28 
  KLDOg1064                                                           37.4    0.28 
  KLDOg1027                                                           37.4    0.28 
  KLDOg430                                                            37.4    0.28 
  KLWIg3854 KLWIg3854 undefined product 7792505:7794346 reverse       37.4    0.28 
  KLWIg3581 KLWIg3581 undefined product 7254822:7255235 forward       37.4    0.28 
  KLWIg2304 KLWIg2304 undefined product 4704623:4706095 reverse       37.4    0.28 
  KLWIg786 KLWIg786 undefined product 1639387:1642512 reverse         37.4    0.28 
  KLWIg756 KLWIg756 undefined product 1582687:1584023 forward         37.4    0.28 
  gi|7276232|ref|NC_001137.2| Saccharomyces cerevisiae chromosome...  37.4    0.28 
  KLLA0F04433g KLLA0F04433g undefined product 8511386:8512627 rev...  37.4    0.28 
  KLLA0E22969g KLLA0E22969g undefined product 7897210:7899666 rev...  37.4    0.28 
  KLLA0E15049g KLLA0E15049g undefined product 7196130:7197383 rev...  37.4    0.28 
  KLLA0D07216g KLLA0D07216g undefined product 4751831:4755667 for...  37.4    0.28 
  KLLA0C04103g KLLA0C04103g undefined product 2756177:2757871 rev...  37.4    0.28 
  KLLA0B07491g KLLA0B07491g undefined product 1711837:1713936 rev...  37.4    0.28 
  AEAS01000324  Kluyveromyces aestuarii ATCC 18862 contig00661, w...  37.4    0.28 
  AEAS01000322  Kluyveromyces aestuarii ATCC 18862 contig00658, w...  37.4    0.28 
  AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, w...  37.4    0.28 
  AEAS01000251  Kluyveromyces aestuarii ATCC 18862 contig00552, w...  37.4    0.28 
  AEAS01000137  Kluyveromyces aestuarii ATCC 18862 contig00143, w...  37.4    0.28 
  AEAS01000136  Kluyveromyces aestuarii ATCC 18862 contig00142, w...  37.4    0.28 
  AEAS01000092  Kluyveromyces aestuarii ATCC 18862 contig00097, w...  37.4    0.28 
  AEAS01000018  Kluyveromyces aestuarii ATCC 18862 contig00020, w...  37.4    0.28 
  KLAEg4046 KLAEg4046 undefined product 8580590:8582968 forward       37.4    0.28 
  KLAEg3658 KLAEg3658 undefined product 7715783:7717285 forward       37.4    0.28 
  KLAEg2758 KLAEg2758 undefined product 5823454:5826465 reverse       37.4    0.28 
  KLAEg2604 KLAEg2604 undefined product 5510989:5513343 forward       37.4    0.28 
  KLAEg2348 KLAEg2348 undefined product 4958927:4960270 forward       37.4    0.28 
  KLAEg2278 KLAEg2278 undefined product 4813758:4816394 forward       37.4    0.28 
  KLAEg2130.t2 KLAEg2130.t2 undefined product 4499119:4502412 rev...  37.4    0.28 
  KLAEg2130.t1 KLAEg2130.t1 undefined product 4499119:4502412 rev...  37.4    0.28 
  KLAEg1598 KLAEg1598 undefined product 3370331:3371875 reverse       37.4    0.28 
  KLAEg692 KLAEg692 undefined product 1520720:1521676 forward         37.4    0.28 
  gi|6323501|ref|NC_001145.1| Saccharomyces cerevisiae chromosome...  35.6    0.98 
  gi|6321039|ref|NC_001138.1| Saccharomyces cerevisiae chromosome...  35.6    0.98 
  KLDOg4752                                                           35.6    0.98 
  KLDOg3622                                                           35.6    0.98 
  KLDOg3374                                                           35.6    0.98 
  KLDOg3008                                                           35.6    0.98 
  KLDOg2810                                                           35.6    0.98 
  KLDOg2571                                                           35.6    0.98 
  KLDOg2254                                                           35.6    0.98 
  KLAEg1598 KLAEg1598 undefined product 3370331:3371875 reverse       35.6    0.98 
  KLAEg1369 KLAEg1369 undefined product 2896279:2899001 forward       35.6    0.98 
  KLDOg596                                                            35.6    0.98 
  KLDOg542                                                            35.6    0.98 
  KLDOg162                                                            35.6    0.98 
  KLWIg2468 KLWIg2468 undefined product 5030457:5031887 forward       35.6    0.98 
  KLWIg2431 KLWIg2431 undefined product 4962276:4964168 forward       35.6    0.98 
  KLWIg2429 KLWIg2429 undefined product 4959719:4960623 forward       35.6    0.98 
  KLWIg1789 KLWIg1789 undefined product 3684083:3686017 reverse       35.6    0.98 
  KLWIg1653 KLWIg1653 undefined product 3359668:3361461 forward       35.6    0.98 
  KLWIg1610 KLWIg1610 undefined product 3268818:3270836 reverse       35.6    0.98 
  KLWIg1560 KLWIg1560 undefined product 3168194:3172582 forward       35.6    0.98 
  KLWIg963 KLWIg963 undefined product 1974256:1978641 forward         35.6    0.98 
  KLWIg789 KLWIg789 undefined product 1646434:1648663 reverse         35.6    0.98 
  KLWIg527 KLWIg527 undefined product 1116982:1118943 reverse         35.6    0.98 
  KLLA0F19888g KLLA0F19888g undefined product 9926641:9941388 rev...  35.6    0.98 
  KLLA0F10175g KLLA0F10175g undefined product 9031460:9033190 rev...  35.6    0.98 
  KLLA0E12519g KLLA0E12519g undefined product 6960735:6963755 rev...  35.6    0.98 
  KLLA0D15631g KLLA0D15631g undefined product 5456566:5460078 for...  35.6    0.98 
  KLLA0D15268g KLLA0D15268g undefined product 5434536:5436353 for...  35.6    0.98 
  KLLA0C14047g KLLA0C14047g undefined product 3591797:3592933 rev...  35.6    0.98 
  KLLA0C09394g KLLA0C09394g undefined product 3201349:3204903 for...  35.6    0.98 
  KLLA0C05016g KLLA0C05016g undefined product 2839472:2839951 rev...  35.6    0.98 
  KLLA0C04928g KLLA0C04928g undefined product 2833244:2833768 for...  35.6    0.98 
  KLLA0A00737g KLLA0A00737g undefined product 72233:73981 forward     35.6    0.98 
  AEAS01000318  Kluyveromyces aestuarii ATCC 18862 contig00650, w...  35.6    0.98 
  AEAS01000285  Kluyveromyces aestuarii ATCC 18862 contig00611, w...  35.6    0.98 
  AEAS01000234  Kluyveromyces aestuarii ATCC 18862 contig00534, w...  35.6    0.98 
  AEAS01000208  Kluyveromyces aestuarii ATCC 18862 contig00227, w...  35.6    0.98 
  AEAS01000182  Kluyveromyces aestuarii ATCC 18862 contig00195, w...  35.6    0.98 
  AEAS01000145  Kluyveromyces aestuarii ATCC 18862 contig00154, w...  35.6    0.98 
  AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, w...  35.6    0.98 
  AEAS01000081  Kluyveromyces aestuarii ATCC 18862 contig00085, w...  35.6    0.98 
  AEAS01000080  Kluyveromyces aestuarii ATCC 18862 contig00084, w...  35.6    0.98 
  AEAS01000061  Kluyveromyces aestuarii ATCC 18862 contig00065, w...  35.6    0.98 
  AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, w...  35.6    0.98 
  AEAS01000031  Kluyveromyces aestuarii ATCC 18862 contig00033, w...  35.6    0.98 
  KLAEg4525 KLAEg4525 undefined product 9630420:9631691 forward       35.6    0.98 
  KLAEg4306 KLAEg4306 undefined product 9177855:9179654 forward       35.6    0.98 
  KLAEg4071.t2 KLAEg4071.t2 undefined product 8627381:8627860 for...  35.6    0.98 
  KLAEg4071.t1 KLAEg4071.t1 undefined product 8627366:8627860 for...  35.6    0.98 
  KLAEg3468 KLAEg3468 undefined product 7300506:7302302 forward       35.6    0.98 
  KLAEg3017 KLAEg3017 undefined product 6344266:6345810 reverse       35.6    0.98 
  KLAEg2939 KLAEg2939 undefined product 6192501:6193079 reverse       35.6    0.98 
  KLAEg2551 KLAEg2551 undefined product 5416414:5417724 forward       35.6    0.98 
  KLAEg1883 KLAEg1883 undefined product 4023098:4025677 forward       35.6    0.98 
  KLAEg1699.t1 KLAEg1699.t1 undefined product 3621657:3625428 rev...  35.6    0.98 
  KLAEg1699.t2 KLAEg1699.t2 undefined product 3621657:3625338 rev...  35.6    0.98 
  KLAEg1441 KLAEg1441 undefined product 3034324:3036138 reverse       35.6    0.98 
  KLAEg960 KLAEg960 undefined product 2063400:2067530 forward         35.6    0.98 
  KLAEg863 KLAEg863 undefined product 1858616:1859554 forward         35.6    0.98 
  KLAEg644 KLAEg644 undefined product 1397832:1398647 forward         35.6    0.98 
  KLAEg578 KLAEg578 undefined product 1250498:1253404 forward         35.6    0.98 
  KLAEg563 KLAEg563 undefined product 1218052:1219341 reverse         35.6    0.98 
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  33.7    3.4  
  KLDOg4277                                                           33.7    3.4  
  KLDOg3953                                                           33.7    3.4  
  KLDOg3782                                                           33.7    3.4  
  KLDOg3602                                                           33.7    3.4  
  KLDOg3151                                                           33.7    3.4  
  KLDOg3116                                                           33.7    3.4  
  KLDOg3003                                                           33.7    3.4  
  KLDOg2318                                                           33.7    3.4  
  KLDOg2060                                                           33.7    3.4  
  KLDOg1862                                                           33.7    3.4  
  KLDOg1444                                                           33.7    3.4  
  KLDOg1236.t2                                                        33.7    3.4  
  KLDOg1236.t1                                                        33.7    3.4  
  KLDOg1119                                                           33.7    3.4  
  KLDOg1034                                                           33.7    3.4  
  KLDOg849                                                            33.7    3.4  
  KLDOg640                                                            33.7    3.4  
  KLDOg492                                                            33.7    3.4  
  AEAS01000081  Kluyveromyces aestuarii ATCC 18862 contig00085, w...  33.7    3.4  
  KLWIg4360 KLWIg4360 undefined product 8889307:8890224 reverse       33.7    3.4  
  KLWIg3997 KLWIg3997 undefined product 8104735:8106777 reverse       33.7    3.4  
  KLWIg3756 KLWIg3756 undefined product 7611572:7613248 forward       33.7    3.4  
  KLWIg3387 KLWIg3387 undefined product 6860158:6862938 forward       33.7    3.4  
  KLWIg3337 KLWIg3337 undefined product 6766602:6767873 forward       33.7    3.4  
  KLWIg3276 KLWIg3276 undefined product 6637840:6640536 reverse       33.7    3.4  
  KLWIg3069 KLWIg3069 undefined product 6213745:6214956 reverse       33.7    3.4  
  KLWIg2823 KLWIg2823 undefined product 5752439:5753629 forward       33.7    3.4  
  KLWIg2655 KLWIg2655 undefined product 5416299:5417442 forward       33.7    3.4  
  KLWIg2534 KLWIg2534 undefined product 5187175:5189511 forward       33.7    3.4  
  KLAEg2130.t1 KLAEg2130.t1 undefined product 4499119:4502412 rev...  33.7    3.4  
  KLWIg1799 KLWIg1799 undefined product 3706055:3707011 reverse       33.7    3.4  
  KLWIg1433 KLWIg1433 undefined product 2903857:2905872 forward       33.7    3.4  
  KLWIg1252 KLWIg1252 undefined product 2559492:2560580 reverse       33.7    3.4  
  KLWIg1223 KLWIg1223 undefined product 2506494:2506898 forward       33.7    3.4  
  KLWIg911 KLWIg911 undefined product 1881015:1884776 forward         33.7    3.4  
  KLWIg715 KLWIg715 undefined product 1502831:1504750 forward         33.7    3.4  
  KLLA0F28083g KLLA0F28083g undefined product 10681233:10683329 r...  33.7    3.4  
  AEAS01000208  Kluyveromyces aestuarii ATCC 18862 contig00227, w...  33.7    3.4  
  KLLA0F16907g KLLA0F16907g undefined product 9642816:9644174 for...  33.7    3.4  
  KLLA0F15433g KLLA0F15433g undefined product 9513796:9514956 rev...  33.7    3.4  
  KLLA0F14817g KLLA0F14817g undefined product 9457068:9459251 rev...  33.7    3.4  
  KLLA0F06710g KLLA0F06710g undefined product 8732609:8735899 for...  33.7    3.4  
  KLLA0F03531g KLLA0F03531g undefined product 8415789:8420186 rev...  33.7    3.4  
  KLLA0E19339g KLLA0E19339g undefined product 7574634:7575662 rev...  33.7    3.4  
  KLLA0E19229g KLLA0E19229g undefined product 7565986:7568205 for...  33.7    3.4  
  KLLA0E07019g KLLA0E07019g undefined product 6494278:6495117 for...  33.7    3.4  
  KLLA0E05721g KLLA0E05721g undefined product 6364223:6365431 rev...  33.7    3.4  
  KLLA0E01035g KLLA0E01035g undefined product 5962708:5968344 for...  33.7    3.4  
  KLAEg2604 KLAEg2604 undefined product 5510989:5513343 forward       33.7    3.4  
  KLLA0D16093g KLLA0D16093g undefined product 5493437:5493805 rev...  33.7    3.4  
  KLLA0D08932g KLLA0D08932g undefined product 4889324:4890160 for...  33.7    3.4  
  KLLA0D01980g KLLA0D01980g undefined product 4308617:4309165 rev...  33.7    3.4  
  KLLA0D00792g KLLA0D00792g undefined product 4210803:4213865 for...  33.7    3.4  
  KLLA0C17578g KLLA0C17578g undefined product 3931314:3935891 for...  33.7    3.4  
  KLLA0C06633g KLLA0C06633g undefined product 2963773:2965668 for...  33.7    3.4  
  KLLA0B11385g KLLA0B11385g undefined product 2056008:2060390 rev...  33.7    3.4  
  KLLA0B06952g KLLA0B06952g undefined product 1669284:1671968 for...  33.7    3.4  
  KLLA0A09537g KLLA0A09537g undefined product 835653:838517 forward   33.7    3.4  
  KLLA0A02959g KLLA0A02959g undefined product 260627:262306 forward   33.7    3.4  
  AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, w...  33.7    3.4  
  AEAS01000272  Kluyveromyces aestuarii ATCC 18862 contig00584, w...  33.7    3.4  
  AEAS01000260  Kluyveromyces aestuarii ATCC 18862 contig00566, w...  33.7    3.4  
  AEAS01000256  Kluyveromyces aestuarii ATCC 18862 contig00560, w...  33.7    3.4  
  AEAS01000214  Kluyveromyces aestuarii ATCC 18862 contig00234, w...  33.7    3.4  
  AEAS01000207  Kluyveromyces aestuarii ATCC 18862 contig00226, w...  33.7    3.4  
  AEAS01000170  Kluyveromyces aestuarii ATCC 18862 contig00183, w...  33.7    3.4  
  AEAS01000160  Kluyveromyces aestuarii ATCC 18862 contig00171, w...  33.7    3.4  
  AEAS01000153  Kluyveromyces aestuarii ATCC 18862 contig00162, w...  33.7    3.4  
  KLWIg4784 KLWIg4784 undefined product 9762495:9763444 reverse       33.7    3.4  
  AEAS01000131  Kluyveromyces aestuarii ATCC 18862 contig00137, w...  33.7    3.4  
  AEAS01000108  Kluyveromyces aestuarii ATCC 18862 contig00113, w...  33.7    3.4  
  AEAS01000098  Kluyveromyces aestuarii ATCC 18862 contig00103, w...  33.7    3.4  
  AEAS01000072  Kluyveromyces aestuarii ATCC 18862 contig00076, w...  33.7    3.4  
  AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, w...  33.7    3.4  
  AEAS01000060  Kluyveromyces aestuarii ATCC 18862 contig00064, w...  33.7    3.4  
  AEAS01000058  Kluyveromyces aestuarii ATCC 18862 contig00062, w...  33.7    3.4  
  gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome...  33.7    3.4  
  KLAEg4549 KLAEg4549 undefined product 9700668:9701813 reverse       33.7    3.4  
  KLAEg4533 KLAEg4533 undefined product 9645406:9648078 forward       33.7    3.4  
  KLAEg4421 KLAEg4421 undefined product 9410726:9412635 reverse       33.7    3.4  
  KLAEg3977 KLAEg3977 undefined product 8439112:8440281 forward       33.7    3.4  
  KLAEg3934 KLAEg3934 undefined product 8351190:8352986 forward       33.7    3.4  
  KLAEg3476 KLAEg3476 undefined product 7314964:7317063 forward       33.7    3.4  
  KLAEg2928 KLAEg2928 undefined product 6167551:6170826 reverse       33.7    3.4  
  KLAEg2692 KLAEg2692 undefined product 5683439:5685088 reverse       33.7    3.4  
  KLAEg2503 KLAEg2503 undefined product 5305561:5306328 reverse       33.7    3.4  
  KLAEg2373 KLAEg2373 undefined product 5006713:5007576 forward       33.7    3.4  
  KLAEg2310 KLAEg2310 undefined product 4888219:4889111 forward       33.7    3.4  
  KLAEg1451 KLAEg1451 undefined product 3052051:3052995 reverse       33.7    3.4  
  KLAEg1344 KLAEg1344 undefined product 2851551:2853008 forward       33.7    3.4  
  KLAEg739 KLAEg739 undefined product 1617215:1621561 reverse         33.7    3.4  
  KLAEg444 KLAEg444 undefined product 955301:958585 forward           33.7    3.4  


> gi|6322960|ref|NC_001144.1| Saccharomyces cerevisiae chromosome 
XII, complete chromosome sequence
Length=1078172

 Score = 1294 bits (1434),  Expect = 0.0
 Identities = 717/717 (100%), Gaps = 0/717 (0%)
 Strand=Plus/Plus

Query  1       ATGCGTGCCACCACTTTATTATCTTCAGTCGTTTCTTTGGCATTGTTGTCGAAGGAAGTC  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  903722  ATGCGTGCCACCACTTTATTATCTTCAGTCGTTTCTTTGGCATTGTTGTCGAAGGAAGTC  903781

Query  61      TTAGCAACACCTCCAGCTTGTTTATTGGCCTGTGTTGCGCAAGTCGGCAAATCCTCTTCC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  903782  TTAGCAACACCTCCAGCTTGTTTATTGGCCTGTGTTGCGCAAGTCGGCAAATCCTCTTCC  903841

Query  121     ACATGTGACTCTTTGAATCAAGTCACCTGTTACTGTGAACACGAAAACTCCGCCGTCAAG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  903842  ACATGTGACTCTTTGAATCAAGTCACCTGTTACTGTGAACACGAAAACTCCGCCGTCAAG  903901

Query  181     AAATGTCTAGACTCCATCTGCCCAAACAATGACGCTGATGCTGCTTATTCTGCTTTCAAG  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  903902  AAATGTCTAGACTCCATCTGCCCAAACAATGACGCTGATGCTGCTTATTCTGCTTTCAAG  903961

Query  241     AGTTCTTGTTCCGAACAAAATGCTTCATTGGGCGATTCCAGCAGCAGTGCCTCCTCATCC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  903962  AGTTCTTGTTCCGAACAAAATGCTTCATTGGGCGATTCCAGCAGCAGTGCCTCCTCATCC  904021

Query  301     GCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCC  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  904022  GCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCC  904081

Query  361     TCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCT  420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  904082  TCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCT  904141

Query  421     GCCCCATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  904142  GCCCCATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  904201

Query  481     AAGGCTCCTTCCAGTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCC  540
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  904202  AAGGCTCCTTCCAGTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCC  904261

Query  541     TCCACTAGCGAGGCTCACTCTTCCAGTGCTGCCTCTTCGACCGTGTCCCAAGAAACAGTC  600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  904262  TCCACTAGCGAGGCTCACTCTTCCAGTGCTGCCTCTTCGACCGTGTCCCAAGAAACAGTC  904321

Query  601     TCCTCTGCTCTACCAACTTCTACCGCCGTTATTTCTACTTTCTCTGAAGGTTCTGGTAAT  660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  904322  TCCTCTGCTCTACCAACTTCTACCGCCGTTATTTCTACTTTCTCTGAAGGTTCTGGTAAT  904381

Query  661     GTTCTAGAGGCAGGAAAATCCGTTTTCATTGCTGCTGTTGCCGCTATGTTAATCTAA  717
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  904382  GTTCTAGAGGCAGGAAAATCCGTTTTCATTGCTGCTGTTGCCGCTATGTTAATCTAA  904438


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| |||||||||||
Sbjct  1031425  TCCTCTTCTTCTTCTTCTTCTTC  1031403


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
                ||||| || ||  ||| || ||||||||||| |||||
Sbjct  1038157  CTTCTCCCTCCTCATCTTCATCTTCCTCTTCCTCTTC  1038121


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCT  474
               ||||||||||| |||||||||
Sbjct  132254  TCCTCTTCTTCTTCTTCTTCT  132234


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||| ||||| |||||||||||
Sbjct  132257  TCCTCCTCTTCTTCTTCTTCTTC  132235


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               |||| ||| ||||||||||||||
Sbjct  132263  TCCTTTTCCTCCTCTTCTTCTTC  132241


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 32/41 (79%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
               ||| |||| ||   ||||| ||||||||||| | |||| ||
Sbjct  132292  CTTGTTCCTCCTCTTCCTCCTCTTCCTCTTCCTTTTCCTCC  132252


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1031419  TCTTCTTCTTCTTCTTCTTCTTC  1031397


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1031422  TCTTCTTCTTCTTCTTCTTCTTC  1031400


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||| || ||||||||||||||
Sbjct  1031434  TCCTCATCGTCCTCTTCTTCTTC  1031412


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1038176  TCTTCTTCTTCTTCTTCTTCTTC  1038154


> gi|6324406|ref|NC_001147.1| Saccharomyces cerevisiae chromosome 
XV, complete chromosome sequence
Length=1091283

 Score = 68.0 bits (74),  Expect = 2e-10
 Identities = 132/194 (69%), Gaps = 12/194 (6%)
 Strand=Plus/Minus

Query  305     CTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTA  364
               |||| |||||  |  |  |||||||| ||   ||||| ||||||   ||| | || ||| 
Sbjct  346555  CTTCCTCCAGTGAAACTACTTCTTCTGCCGTCGCTTCCTCCAGTGAAGCTACTTCTTCTG  346496

Query  365     CCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCC  424
               ||   ||||||||||||   ||||| || ||| ||    |||||||       |||| | 
Sbjct  346495  CCGTCGCTTCTTCCAGTGAAGCTTCTTCTTCTGCTGCTACTTCTTC------TGCTGTCG  346442

Query  425     CATCTTCTAGCAAGGCT---TCTTCCACCGAATCCTCTTCTTCC---TCTTCTTCTTCCA  478
               | ||||| ||  |||||   ||||||||||   | || ||| ||    || | |||||||
Sbjct  346441  CTTCTTCCAGTGAGGCTACCTCTTCCACCGTCGCTTCCTCTACCAAGGCTGCCTCTTCCA  346382

Query  479     CCAAGGCTCCTTCC  492
               | |||||| |||||
Sbjct  346381  CTAAGGCTTCTTCC  346368


 Score = 53.6 bits (58),  Expect = 4e-06
 Identities = 65/89 (74%), Gaps = 0/89 (0%)
 Strand=Plus/Minus

Query  323     CTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACCAAGGCTTCTTCCAGTA  382
               |||||||| |    ||||||||||||   ||| |||| || |||   ||||| || |  |
Sbjct  346456  CTTCTTCTGCTGTCGCTTCTTCCAGTGAGGCTACCTCTTCCACCGTCGCTTCCTCTACCA  346397

Query  383     GCGCTTCCTCCTCTACTAAAGCTTCTTCC  411
                 ||| |||| || ||||| |||||||||
Sbjct  346396  AGGCTGCCTCTTCCACTAAGGCTTCTTCC  346368


 Score = 51.8 bits (56),  Expect = 1e-05
 Identities = 85/119 (72%), Gaps = 9/119 (7%)
 Strand=Plus/Minus

Query  370     GCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCCCATCT  429
               ||||||||||||   ||| |||| || ||    ||||| || | ||  ||||||   |||
Sbjct  346442  GCTTCTTCCAGTGAGGCTACCTCTTCCACCGTCGCTTCCTCTACCAAGGCTGCC---TCT  346386

Query  430     TCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTC--CTCTT-CTTCTTCCACCAAGGC  485
               || |  |||||||||||| | |   |   ||||||  || || ||||||||||||| ||
Sbjct  346385  TCCACTAAGGCTTCTTCCTCTG---CTGTTTCTTCAGCTGTTGCTTCTTCCACCAAAGC  346330


 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 54/74 (73%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  305     CTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTA  364
               |||| |||||  ||||  | ||||| |||   ||||| || |  |  ||| |||| || |
Sbjct  346441  CTTCTTCCAGTGAGGCTACCTCTTCCACCGTCGCTTCCTCTACCAAGGCTGCCTCTTCCA  346382

Query  365     CCAAGGCTTCTTCC  378
               | ||||||||||||
Sbjct  346381  CTAAGGCTTCTTCC  346368


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453     ATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||||||||||||| |||||
Sbjct  269407  ATCCTCTTCTTCCTCTTCATCTTC  269430


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  442     TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||  |||  ||||||||||| |||||||| ||
Sbjct  553310  TCTTCATCCGCGTCCTCTTCTTCTTCTTCTTCCTC  553344


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||| ||||||||||||
Sbjct  53958  TCTTCTTCTTCTTCTTCTTCTTCC  53935


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||  ||  |||||||||||| || ||||| ||
Sbjct  229422  CTTCTTCTTCCTCATCCTCTTCTTCGTCGTCTTCATC  229386


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  31      GTTTCTTTGGCATTGTTGTCGAAG  54
               ||||| ||||| ||||||||||||
Sbjct  513166  GTTTCCTTGGCGTTGTTGTCGAAG  513143


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  322    TCTTCTTCTACCAAGGCTTCTTC  344
              ||||| |||||||||||||| ||
Sbjct  49061  TCTTCATCTACCAAGGCTTCGTC  49039


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||| ||||||||||| ||
Sbjct  269399  TCCTCTTCATCCTCTTCTTCCTC  269421


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 33/43 (77%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  467     CTTCTTCTTCCACCAAGGCTCCTTCCAGTGAAGAATCCTCTTC  509
               || |||||||  ||   ||| ||||||||||||  || |||||
Sbjct  346507  CTACTTCTTCTGCCGTCGCTTCTTCCAGTGAAGCTTCTTCTTC  346465


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  457     TCTTCTTCCTCTTCTTCTTCC  477
               ||||| |||||||||||||||
Sbjct  428102  TCTTCATCCTCTTCTTCTTCC  428122


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCT  474
                ||||||||| |||||||||||
Sbjct  1059889  TCCTCTTCTGCCTCTTCTTCT  1059909


> gsASS001Lm
Length=10741898

 Score = 64.4 bits (70),  Expect = 2e-09
 Identities = 102/146 (70%), Gaps = 9/146 (6%)
 Strand=Plus/Plus

Query  385       GCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCCCATCTTCTAGCAAGGCTTCT  444
                 || || || || ||| |||| ||||| | |   |  ||| | ||||| |   | || |||
Sbjct  10692251  GCCTCTTCTTCCACTGAAGCATCTTCAACC---GAAGCCTCTTCTTCCACTGAAGCATCT  10692307

Query  445       TCCACCGAATCCTCTTCTTCCTCT------TCTTCTTCCACCAAGGCTCCTTCCAGTGAA  498
                 |  |||||| ||||||||||| ||      |||||||||||  | ||  |||||| ||||
Sbjct  10692308  TTAACCGAAGCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACTGAA  10692367

Query  499       GAATCCTCTTCCACTTATGTCTCTTC  524
                 |  || ||||||||| | |  |||||
Sbjct  10692368  GCCTCTTCTTCCACTGAAGCATCTTC  10692393


 Score = 53.6 bits (58),  Expect = 4e-06
 Identities = 79/112 (71%), Gaps = 0/112 (0%)
 Strand=Plus/Plus

Query  301       GCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCC  360
                 || ||||| ||||   | ||||||||||| ||  | || ||||||| |   || || || 
Sbjct  10692317  GCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACTGAAGCCTCTTCT  10692376

Query  361       TCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCA  412
                 || ||  | || ||||||| |   || || || || ||| |||| |||||||
Sbjct  10692377  TCCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCA  10692428


 Score = 51.8 bits (56),  Expect = 1e-05
 Identities = 55/73 (76%), Gaps = 0/73 (0%)
 Strand=Plus/Minus

Query  32       TTTCTTTGGCATTGTTGTCGAAGGAAGTCTTAGCAACACCTCCAGCTTGTTTATTGGCCT  91
                ||||| | ||  | ||||| |  || ||  | ||  | |||||||||||||| ||||| |
Sbjct  5650710  TTTCTCTAGCTATTTTGTCAACCGAGGTTGTCGCTGCTCCTCCAGCTTGTTTGTTGGCAT  5650651

Query  92       GTGTTGCGCAAGT  104
                ||||||| |||||
Sbjct  5650650  GTGTTGCTCAAGT  5650638


 Score = 51.8 bits (56),  Expect = 1e-05
 Identities = 99/145 (69%), Gaps = 6/145 (4%)
 Strand=Plus/Plus

Query  440       CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCACCAAGGCTCCTTCCAGTG  496
                 |||||||||| ||| | |||||  ||    | |||||||||||  | ||  |||  |  |
Sbjct  10692255  CTTCTTCCACTGAAGCATCTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTTAACCG  10692314

Query  497       AAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACTAGCGAGGCTC  556
                 |||  || ||||||||| | | ||||||   ||   |||| || ||||||   || ||  
Sbjct  10692315  AAGCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT---GAAGCCT  10692371

Query  557       ACTCTTCCAGTGCTGCCTCTTCGAC  581
                   ||||||| ||  || ||||| ||
Sbjct  10692372  CTTCTTCCACTGAAGCATCTTCCAC  10692396


 Score = 51.8 bits (56),  Expect = 1e-05
 Identities = 101/145 (70%), Gaps = 12/145 (8%)
 Strand=Plus/Plus

Query  440       CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCAC-CAAGGCTC--CTTCCA  493
                 |||||||||| ||| | ||||   ||    | |||||||||||  ||| |||  ||||||
Sbjct  10692288  CTTCTTCCACTGAAGCATCTTTAACCGAAGCCTCTTCTTCCACTGAAGCCTCTTCTTCCA  10692347

Query  494       GTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACTAGCGAGG  553
                  |||||   | ||||||||| | | ||||||   ||   |||| || ||||||   || |
Sbjct  10692348  CTGAAG---CATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT---GAAG  10692401

Query  554       CTCACTCTTCCAGTGCTGCCTCTTC  578
                 |    ||||||| ||  || |||||
Sbjct  10692402  CCTCTTCTTCCACTGAAGCATCTTC  10692426


 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 139/211 (66%), Gaps = 12/211 (5%)
 Strand=Plus/Plus

Query  301      GCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCC  360
                || ||||| ||||   | ||||||||||| ||  | || ||||| |  |  |   | |  
Sbjct  5318483  GCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCTACCACAGAAGCATTT  5318542

Query  361      TCTACCA---AGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGC  417
                |||||||   | |  ||| ||  |   || || || ||| |  |||| ||||| | ||  
Sbjct  5318543  TCTACCACAGAAGTCTCTACCTCTGAAGCATCTTCTTCTGCCGAAGCCTCTTCTACCACT  5318602

Query  418      GCTGCCCCATCTTCTAGC-AAG--GCTTCTTCCACCGAATCCTCTTCTTCCTCT------  468
                |  ||| | ||||||  | |||   ||||| |||| ||| |||||||| || ||      
Sbjct  5318603  GAAGCCTCTTCTTCTGCCGAAGCCTCTTCTACCACTGAAGCCTCTTCTACCACTGAAGCC  5318662

Query  469      TCTTCTTCCACCAAGGCTCCTTCCAGTGAAG  499
                |||||||||||  | ||  |||||| |||||
Sbjct  5318663  TCTTCTTCCACTGAAGCATCTTCCACTGAAG  5318693


 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 66/89 (75%), Gaps = 6/89 (6%)
 Strand=Plus/Plus

Query  421       GCCCCATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCT---TCTTCTTCC  477
                 ||| | ||||| |   | || ||||| |||||| ||||||||||| ||    | ||||| 
Sbjct  10692218  GCCTCTTCTTCCACTGAAGCATCTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTCA  10692277

Query  478       ACC-AAGGCTC--CTTCCAGTGAAGAATC  503
                 ||| ||| |||  |||||| ||||| |||
Sbjct  10692278  ACCGAAGCCTCTTCTTCCACTGAAGCATC  10692306


 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 70/98 (72%), Gaps = 3/98 (3%)
 Strand=Plus/Plus

Query  371       CTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCCCATCTT  430
                 ||||||||| |   || || || || ||| |||| |||||||     |  ||| | ||||
Sbjct  10692321  CTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT---GAAGCCTCTTCTT  10692377

Query  431       CTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCT  468
                 | |   | || |||||||| ||| ||||||||||| ||
Sbjct  10692378  CCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACT  10692415


 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 64/88 (73%), Gaps = 3/88 (3%)
 Strand=Plus/Plus

Query  440       CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCACCAAGGCTCCTTCCAGTG  496
                 |||||||||| ||| | |||||  |     | |||||||||||  | ||  |||||| ||
Sbjct  10692339  CTTCTTCCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACTG  10692398

Query  497       AAGAATCCTCTTCCACTTATGTCTCTTC  524
                 |||  || ||||||||| | |  |||||
Sbjct  10692399  AAGCCTCTTCTTCCACTGAAGCATCTTC  10692426


 Score = 48.2 bits (52),  Expect = 2e-04
 Identities = 56/73 (77%), Gaps = 6/73 (8%)
 Strand=Plus/Plus

Query  440       CTTCTTCCACCGAATCCTCTTCTTCCTCT---TCTTCTTCCACC-AAGGCTC--CTTCCA  493
                 ||| ||| |||||| ||||||||||| ||    | ||||| ||| ||| |||  ||||||
Sbjct  10692204  CTTTTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTCAACCGAAGCCTCTTCTTCCA  10692263

Query  494       GTGAAGAATCCTC  506
                  ||||| ||| ||
Sbjct  10692264  CTGAAGCATCTTC  10692276


 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 81/118 (69%), Gaps = 13/118 (11%)
 Strand=Plus/Plus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCC---------TCTTCTTCTTCCACCAAGGCTC--C  488
                |||||||  ||||| |||||||| ||         ||||||||| |  | ||| |||  |
Sbjct  5318574  CTTCTTCTGCCGAAGCCTCTTCTACCACTGAAGCCTCTTCTTCTGC--CGAAGCCTCTTC  5318631

Query  489      TTCCAGTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACT  546
                | ||| |||||  || ||| ||||| | | ||||||   ||   |||| || ||||||
Sbjct  5318632  TACCACTGAAGCCTCTTCTACCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT  5318689


 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 34/40 (85%), Gaps = 3/40 (7%)
 Strand=Plus/Plus

Query  441      TTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
                ||||||| ||   || ||||||||||||||||||||| ||
Sbjct  5421234  TTCTTCCTCC---TCGTCTTCTTCCTCTTCTTCTTCCTCC  5421270


 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 80/115 (70%), Gaps = 8/115 (6%)
 Strand=Plus/Plus

Query  439       GCTTCTTCCACCGAATCCTCTTCTTCCTCT------TCTTCTTCCACCAAGGCTCCTTCC  492
                 || ||||| |||||| |||||| |||  |       |||||||||||  | ||  |||| 
Sbjct  10692185  GCATCTTCAACCGAAGCCTCTTTTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTCA  10692244

Query  493       AGTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGC-AAGCAAGCTTCCTCCACT  546
                 |  ||||  || ||||||||| | |  ||||| | | ||||   |||| ||||||
Sbjct  10692245  ACCGAAGCCTCTTCTTCCACTGAAGCATCTTCAACCGAAGC-CTCTTCTTCCACT  10692298


 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 28/30 (94%), Gaps = 2/30 (6%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTT--CCACCA  481
                ||||||||||||||||||||||  ||||||
Sbjct  5145454  TCCTCTTCTTCCTCTTCTTCTTCGCCACCA  5145425


 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 62/88 (71%), Gaps = 15/88 (17%)
 Strand=Plus/Plus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCC------------TCTTCTTCTTCCAC-CAAGGCT  486
                ||||| |||| ||| |||||||||||             | |||||||||||  ||| ||
Sbjct  5318445  CTTCTACCACAGAAGCCTCTTCTTCCACAGAAGCCGAAGCCTCTTCTTCCACTGAAGCCT  5318504

Query  487      C--CTTCCAGTGAAGAATCCTCTTCCAC  512
                |  |||||| ||||| ||| ||| ||||
Sbjct  5318505  CTTCTTCCACTGAAGCATCTTCTACCAC  5318532


 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 61/84 (73%), Gaps = 9/84 (10%)
 Strand=Plus/Minus

Query  439      GCTTCTTCCACCGAATCCTCTTC---TTCCTCTTCTTCTTCC-----ACCAAGG-CTCCT  489
                ||||| ||| ||  |||||| ||   ||||||||| |||||      |||||   || ||
Sbjct  5650393  GCTTCGTCCTCCTCATCCTCATCCGCTTCCTCTTCCTCTTCTGCTGAACCAACCACTTCT  5650334

Query  490      TCCAGTGAAGAATCCTCTTCCACT  513
                ||||||||| || | || ||||||
Sbjct  5650333  TCCAGTGAACAACCATCGTCCACT  5650310


 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 23/23 (100%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  455      CCTCTTCTTCCTCTTCTTCTTCC  477
                |||||||||||||||||||||||
Sbjct  6447511  CCTCTTCTTCCTCTTCTTCTTCC  6447489


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||| |    || ||||||||||||||||||||
Sbjct  164090  CTTCTTCCTCATCTTCTTCTTCTTCCTCTTCTTCTTC  164054


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  442      TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
                |||||| ||   || ||||||||||||||||||||
Sbjct  1952600  TCTTCCTCCACTTCTTCTTCTTCCTCTTCTTCTTC  1952634


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  455      CCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||||||||||||||
Sbjct  8250071  CCTCTTCTTCCTCTTCTTCTTC  8250050


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  457      TCTTCTTCCTCTTCTTCTTCC  477
                |||||||||||||||||||||
Sbjct  1375539  TCTTCTTCCTCTTCTTCTTCC  1375559


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 30/35 (86%), Gaps = 3/35 (8%)
 Strand=Plus/Minus

Query  442      TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
                |||||| ||   || ||||||||||||||||||||
Sbjct  1613107  TCTTCCTCC---TCTTCTTCTTCCTCTTCTTCTTC  1613076


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                |||||||| |||||||||||||||
Sbjct  1613110  TCCTCTTCCTCCTCTTCTTCTTCC  1613087


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                |||||||||||||| |||||||||
Sbjct  1613698  TCCTCTTCTTCCTCGTCTTCTTCC  1613675


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 32/38 (85%), Gaps = 1/38 (2%)
 Strand=Plus/Plus

Query  437      AGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
                ||||| ||||| ||   ||||||||||| |||||||||
Sbjct  1729251  AGGCT-CTTCCTCCTCTTCCTCTTCTTCTTCTTCTTCT  1729287


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453      ATCCTCTTCTTCCTCTTCTTCTTC  476
                ||| ||||||||||||||||||||
Sbjct  3172996  ATCTTCTTCTTCCTCTTCTTCTTC  3173019


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  456      CTCTTCTTCCTCTTCTTCTTC  476
                |||||||||||||||||||||
Sbjct  3798355  CTCTTCTTCCTCTTCTTCTTC  3798375


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                ||||||||||| ||||||||||||
Sbjct  6583654  TCCTCTTCTTCTTCTTCTTCTTCC  6583631


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 32/39 (83%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCA  478
                |||| ||| ||   || |||||||||||||||||| |||
Sbjct  8250047  CTTCCTCCTCCACTTCTTCTTCTTCCTCTTCTTCTGCCA  8250009


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  458      CTTCTTCCTCTTCTTCTTCCA  478
                |||||||||||||||||||||
Sbjct  8774642  CTTCTTCCTCTTCTTCTTCCA  8774662


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 39/50 (78%), Gaps = 6/50 (12%)
 Strand=Plus/Minus

Query  442     TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTC  491
               |||||| ||   |||||||||   ||||||||||  |||| |||| ||||
Sbjct  922077  TCTTCCTCC---TCCTCTTCT---TCTTCTTCTTGGACCACGGCTTCTTC  922034


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||| |||||||||||||||||
Sbjct  1729258  TCCTCCTCTTCCTCTTCTTCTTC  1729280


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| |||||||||||
Sbjct  2226790  TCCTCTTCTTCTTCTTCTTCTTC  2226768


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
                |||||||| |    || |||||||||||||| ||||||
Sbjct  2302308  CTTCTTCCTCGTCTTCTTCTTCTTCCTCTTCCTCTTCC  2302271


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                |||||||||||||| ||||||||
Sbjct  2302312  TCCTCTTCTTCCTCGTCTTCTTC  2302290


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  452      AATCCTCTTCTTCCTCTTCTTCTTC  476
                |||| |||||||| |||||||||||
Sbjct  2933396  AATCTTCTTCTTCGTCTTCTTCTTC  2933420


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  456      CTCTTCTTCCTCTTCTTCTT  475
                ||||||||||||||||||||
Sbjct  6084578  CTCTTCTTCCTCTTCTTCTT  6084559


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| |||||||||||
Sbjct  7987796  TCCTCTTCTTCTTCTTCTTCTTC  7987818


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 32/40 (80%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTCCA  493
                || || ||||||||||||||||| |  ||| || | ||||
Sbjct  8084567  TCTTCCTCTTCCTCTTCTTCTTCTAGTAAGTCTTCATCCA  8084606


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 51/72 (71%), Gaps = 6/72 (8%)
 Strand=Plus/Minus

Query  292      TCCTCATCCGCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGC  351
                ||||| ||| ||||||| ||        ||||||||||| |||  ||| |||| |   ||
Sbjct  8250045  TCCTCCTCCACTTCTTCTTCTT------CCTCTTCTTCTGCCAGCGCTACTTCTACCGGC  8249992

Query  352      GCTTCCTCCTCT  363
                 |||| ||||||
Sbjct  8249991  TCTTCATCCTCT  8249980


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 32/39 (83%), Gaps = 3/39 (7%)
 Strand=Plus/Plus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCA  478
                ||||||| ||    || |||||||||||||||| |||||
Sbjct  8432366  CTTCTTCTACT---TCTTCTTCTTCCTCTTCTTATTCCA  8432401


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 30/36 (84%), Gaps = 3/36 (8%)
 Strand=Plus/Plus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTT  475
                |||||||| ||   || ||||| |||||||||||||
Sbjct  8774984  CTTCTTCCTCC---TCTTCTTCATCCTCTTCTTCTT  8775016


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCCA  478
                || |||||||| |||||||||||||
Sbjct  9163621  TCGTCTTCTTCTTCTTCTTCTTCCA  9163597


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  454       TCCTCTTCTTCCTCTTCTTC  473
                 ||||||||||||||||||||
Sbjct  10161392  TCCTCTTCTTCCTCTTCTTC  10161373


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 37/48 (78%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  499       GAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACT  546
                 ||||| ||  ||||| ||||||||||||  |   |||||||  |||||
Sbjct  10707733  GAATCTTCAACCACTGATGTCTCTTCGACTACCGAAGCTTCTACCACT  10707686


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  454       TCCTCTTCTTCCTCTTCTTC  473
                 ||||||||||||||||||||
Sbjct  10721793  TCCTCTTCTTCCTCTTCTTC  10721774


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||  ||  ||| ||||| || |||||||||||
Sbjct  164105  CTTCTTCTTCCTCATCTTCTTCCTCATCTTCTTCTTC  164069


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || ||||||||||| |||||||||
Sbjct  164106  TCTTCTTCTTCCTCATCTTCTTCC  164083


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  455     CCTCTTCTTCCTCTTCTTCTTC  476
               |||||||||| |||||||||||
Sbjct  343938  CCTCTTCTTCTTCTTCTTCTTC  343917


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                || |||||||| ||||||||||||
Sbjct  1177889  TCTTCTTCTTCTTCTTCTTCTTCC  1177912


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453      ATCCTCTTCTTCCTCTTCTTCTTC  476
                ||| |||||||| |||||||||||
Sbjct  1297557  ATCTTCTTCTTCTTCTTCTTCTTC  1297534


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                || |||||||||||||||| ||||
Sbjct  1375548  TCTTCTTCTTCCTCTTCTTTTTCC  1375571


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
                |||||||| |    ||||||||||| || ||||||||
Sbjct  1613115  CTTCTTCCTCTTCCTCCTCTTCTTCTTCCTCTTCTTC  1613079


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCCACC  480
                || |||||||| |||||||||||| ||
Sbjct  3413699  TCGTCTTCTTCTTCTTCTTCTTCCTCC  3413673


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  453      ATCCTCTTCTTCCTCTTCTTCTTCCAC  479
                |||||||||||| || |||||||| ||
Sbjct  4920370  ATCCTCTTCTTCTTCATCTTCTTCGAC  4920396


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453      ATCCTCTTCTTCCTCTTCTTCTTC  476
                |||||| |||||||||||| ||||
Sbjct  5621002  ATCCTCATCTTCCTCTTCTACTTC  5620979


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  457      TCTTCTTCCTCTTCTTCTT  475
                |||||||||||||||||||
Sbjct  6055250  TCTTCTTCCTCTTCTTCTT  6055232


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                || || ||||||||||||||||||
Sbjct  6146515  TCTTCATCTTCCTCTTCTTCTTCC  6146492


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                ||||||||||| || |||||||||
Sbjct  6447503  TCCTCTTCTTCTTCCTCTTCTTCC  6447480


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 28/34 (83%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  443      CTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
                ||||  |||  || |||||||| |||||||||||
Sbjct  6559453  CTTCGCCCGTTTCTTCTTCTTCTTCTTCTTCTTC  6559486


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  455      CCTCTTCTTCCTCTTCTTCTTC  476
                |||||||||| |||||||||||
Sbjct  7360678  CCTCTTCTTCTTCTTCTTCTTC  7360699


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                || |||||||| ||||||||||||
Sbjct  7889622  TCTTCTTCTTCTTCTTCTTCTTCC  7889645


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  458      CTTCTTCCTCTTCTTCTTC  476
                |||||||||||||||||||
Sbjct  8774510  CTTCTTCCTCTTCTTCTTC  8774528


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453      ATCCTCTTCTTCCTCTTCTTCTTC  476
                |||||||||||| | |||||||||
Sbjct  8775003  ATCCTCTTCTTCTTTTTCTTCTTC  8775026


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453       ATCCTCTTCTTCCTCTTCTTCTTC  476
                 |||||||||||||||||| || ||
Sbjct  10473325  ATCCTCTTCTTCCTCTTCGTCGTC  10473348


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 33/42 (79%), Gaps = 0/42 (0%)
 Strand=Plus/Minus

Query  469       TCTTCTTCCACCAAGGCTCCTTCCAGTGAAGAATCCTCTTCC  510
                 |||||||||||  | ||  |||||  ||||| ||| ||||||
Sbjct  10602124  TCTTCTTCCACTGAAGCATCTTCCGTTGAAGCATCTTCTTCC  10602083


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 60/86 (70%), Gaps = 6/86 (6%)
 Strand=Plus/Plus

Query  440       CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCACCAAGGCTCCTTCCAGTG  496
                 |||||||||| ||| | |||||  |     | |||||||||||  | ||  ||||||   
Sbjct  10692372  CTTCTTCCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCA---  10692428

Query  497       AAGAATCCTCTTCCACTTATGTCTCT  522
                  |||| | ||| ||||  | ||||||
Sbjct  10692429  TAGAAGCATCTACCACAGAAGTCTCT  10692454


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 34/43 (80%), Gaps = 3/43 (6%)
 Strand=Plus/Minus

Query  440       CTTCTTCCACCGAATCCTCTTCTTCCTCTTCT---TCTTCCAC  479
                 |||||||| |    |||||||||||| |||||   ||||||||
Sbjct  10721798  CTTCTTCCTCTTCTTCCTCTTCTTCCGCTTCTGCATCTTCCAC  10721756


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 32/41 (79%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
               |||||||  ||   || |||||||||||||| || ||| ||
Sbjct  164075  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCGTCCTCCTCC  164035


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  456     CTCTTCTTCCTCTTCTTCTTC  476
               ||||||||| |||||||||||
Sbjct  172443  CTCTTCTTCTTCTTCTTCTTC  172463


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  172444  TCTTCTTCTTCTTCTTCTTCTTC  172466


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  172447  TCTTCTTCTTCTTCTTCTTCTTC  172469


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  172450  TCTTCTTCTTCTTCTTCTTCTTC  172472


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  343930  TCTTCTTCTTCTTCTTCTTCTTC  343908


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  343933  TCTTCTTCTTCTTCTTCTTCTTC  343911


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  343936  TCTTCTTCTTCTTCTTCTTCTTC  343914


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457     TCTTCTTCCTCTTCTTCTTCC  477
               ||||||||||||| |||||||
Sbjct  343990  TCTTCTTCCTCTTTTTCTTCC  343970


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1067091  TCTTCTTCTTCTTCTTCTTCTTC  1067069


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1067094  TCTTCTTCTTCTTCTTCTTCTTC  1067072


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1067097  TCTTCTTCTTCTTCTTCTTCTTC  1067075


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||||||||| |||||
Sbjct  1177901  TCTTCTTCTTCCTCTTCCTCTTC  1177923


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/32 (85%), Gaps = 3/32 (9%)
 Strand=Plus/Plus

Query  458      CTTCTTCCTCTTCTTCT---TCCACCAAGGCT  486
                || |||||||| |||||   ||||||||||||
Sbjct  1395305  CTGCTTCCTCTACTTCTACCTCCACCAAGGCT  1395336


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||||||||| |||||
Sbjct  1613686  TCGTCTTCTTCCTCTTCCTCTTC  1613664


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                |||||||| || |||||||||||
Sbjct  1729261  TCCTCTTCCTCTTCTTCTTCTTC  1729283


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 28/34 (83%), Gaps = 3/34 (8%)
 Strand=Plus/Plus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
                ||||||||| |   ||||||||||| ||||| ||
Sbjct  1840890  CTTCTTCCAGC---TCCTCTTCTTCTTCTTCCTC  1840920


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  458      CTTCTTCCTCTTCTTCTT  475
                ||||||||||||||||||
Sbjct  1952640  CTTCTTCCTCTTCTTCTT  1952657


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| | |||||||||
Sbjct  1952645  TCCTCTTCTTCTTTTTCTTCTTC  1952667


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||| ||||| |||||||||||
Sbjct  2226793  TCCTCCTCTTCTTCTTCTTCTTC  2226771


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  455      CCTCTTCTTCCTCTTCTTCTTCCACC  480
                |||||||| | ||| |||||||||||
Sbjct  2236851  CCTCTTCTGCTTCTACTTCTTCCACC  2236826


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||||||||| |||||
Sbjct  2436677  TCTTCTTCTTCCTCTTCCTCTTC  2436655


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2680853  TCGTCTTCTTCTTCTTCTTCTTC  2680875


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2933407  TCGTCTTCTTCTTCTTCTTCTTC  2933429


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2933410  TCTTCTTCTTCTTCTTCTTCTTC  2933432


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCT  474
                |||||||| ||||||||||||
Sbjct  3121292  TCCTCTTCCTCCTCTTCTTCT  3121312


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  73       CCAGCTTGTTTATTGGCCTGTGT  95
                |||||||||||||||  ||||||
Sbjct  4089420  CCAGCTTGTTTATTGAGCTGTGT  4089442


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  4516369  TCTTCTTCTTCTTCTTCTTCTTC  4516347


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  4516372  TCTTCTTCTTCTTCTTCTTCTTC  4516350


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  4516375  TCTTCTTCTTCTTCTTCTTCTTC  4516353


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456      CTCTTCTTCCTCTTCTTCTTC  476
                ||||||||| |||||||||||
Sbjct  4516376  CTCTTCTTCTTCTTCTTCTTC  4516356


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  4556378  TCTTCTTCTTCTTCTTCTTCTTC  4556400


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  4556381  TCTTCTTCTTCTTCTTCTTCTTC  4556403


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  4556384  TCTTCTTCTTCTTCTTCTTCTTC  4556406


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456      CTCTTCTTCCTCTTCTTCTTC  476
                ||||||||| |||||||||||
Sbjct  5070338  CTCTTCTTCTTCTTCTTCTTC  5070318


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  5159403  TCTTCTTCTTCATCTTCTTCTTC  5159381


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| ||||| |||||
Sbjct  5159409  TCCTCTTCTTCTTCTTCATCTTC  5159387


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || ||||||||||||||||| ||
Sbjct  6447500  TCTTCTTCTTCCTCTTCTTCCTC  6447478


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 28/34 (83%), Gaps = 3/34 (8%)
 Strand=Plus/Plus

Query  443      CTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||   || |||||| | |||||||||||
Sbjct  6549959  CTTCCACC---TCTTCTTCTGCTTCTTCTTCTTC  6549989


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  6559467  TCTTCTTCTTCTTCTTCTTCTTC  6559489


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  6559470  TCTTCTTCTTCTTCTTCTTCTTC  6559492


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||| ||||| |||||||||||
Sbjct  6583657  TCCTCCTCTTCTTCTTCTTCTTC  6583635


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
                || || ||||| ||||||||||||| ||
Sbjct  6788425  TCTTCATCTTCATCTTCTTCTTCCAACA  6788398


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  6860919  TCGTCTTCTTCGTCTTCTTCTTC  6860897


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || ||||||| ||||||||||||
Sbjct  7137545  TCTTCTTCTTTCTCTTCTTCTTC  7137567


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  7360680  TCTTCTTCTTCTTCTTCTTCTTC  7360702


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  7360683  TCTTCTTCTTCTTCTTCTTCTTC  7360705


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  7360686  TCTTCTTCTTCTTCTTCTTCTTC  7360708


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  7853771  TCTTCTTCTTCTTCTTCTTCTTC  7853749


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  7853774  TCTTCTTCTTCTTCTTCTTCTTC  7853752


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  7853777  TCTTCTTCTTCTTCTTCTTCTTC  7853755


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456      CTCTTCTTCCTCTTCTTCTTC  476
                ||||||||| |||||||||||
Sbjct  7853778  CTCTTCTTCTTCTTCTTCTTC  7853758


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || ||| ||||||||||||||||
Sbjct  7987787  TCGTCTCCTTCCTCTTCTTCTTC  7987809


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
                ||||||||||| || ||||| ||| |||
Sbjct  8250063  TCCTCTTCTTCTTCATCTTCCTCCTCCA  8250036


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCT  486
                ||||| ||||| | |||||||||||  ||| ||
Sbjct  8276075  TCCTCATCTTCTTGTTCTTCTTCCATGAAGTCT  8276043


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  8628525  TCTTCTTCTTCTTCTTCTTCTTC  8628547


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  8628528  TCTTCTTCTTCTTCTTCTTCTTC  8628550


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  8628531  TCTTCTTCTTCTTCTTCTTCTTC  8628553


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  8628534  TCTTCTTCTTCTTCTTCTTCTTC  8628556


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  8628537  TCTTCTTCTTCTTCTTCTTCTTC  8628559


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| || ||||||||
Sbjct  8774992  TCCTCTTCTTCATCCTCTTCTTC  8775014


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                |||||||||||||||||  ||||
Sbjct  9342718  TCCTCTTCTTCCTCTTCCCCTTC  9342696


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454       TCCTCTTCTTCCTCTTCTTCTTC  476
                 ||||||||||| || ||||||||
Sbjct  10473353  TCCTCTTCTTCGTCGTCTTCTTC  10473375


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 45/62 (73%), Gaps = 3/62 (4%)
 Strand=Plus/Plus

Query  421       GCCCCATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCT---TCTTCTTCC  477
                 ||| | ||||| |   | || ||| |||| ||| ||||||||||| ||    | ||||||
Sbjct  10692056  GCCTCTTCTTCAACTGAAGCATCTACCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCC  10692115

Query  478       AC  479
                 ||
Sbjct  10692116  AC  10692117


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  437       AGGCTTCTTCCACCGAATCCTCTTCT  462
                 || |||||||||||||| ||||| ||
Sbjct  10707654  AGTCTTCTTCCACCGAAGCCTCTACT  10707629


> KLDOg4824
Length=1929

 Score = 64.4 bits (70),  Expect = 2e-09
 Identities = 102/146 (70%), Gaps = 9/146 (6%)
 Strand=Plus/Plus

Query  385   GCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCCCATCTTCTAGCAAGGCTTCT  444
             || || || || ||| |||| ||||| | |   |  ||| | ||||| |   | || |||
Sbjct  1309  GCCTCTTCTTCCACTGAAGCATCTTCAACC---GAAGCCTCTTCTTCCACTGAAGCATCT  1365

Query  445   TCCACCGAATCCTCTTCTTCCTCT------TCTTCTTCCACCAAGGCTCCTTCCAGTGAA  498
             |  |||||| ||||||||||| ||      |||||||||||  | ||  |||||| ||||
Sbjct  1366  TTAACCGAAGCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACTGAA  1425

Query  499   GAATCCTCTTCCACTTATGTCTCTTC  524
             |  || ||||||||| | |  |||||
Sbjct  1426  GCCTCTTCTTCCACTGAAGCATCTTC  1451


 Score = 53.6 bits (58),  Expect = 4e-06
 Identities = 79/112 (71%), Gaps = 0/112 (0%)
 Strand=Plus/Plus

Query  301   GCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCC  360
             || ||||| ||||   | ||||||||||| ||  | || ||||||| |   || || || 
Sbjct  1375  GCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACTGAAGCCTCTTCT  1434

Query  361   TCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCA  412
             || ||  | || ||||||| |   || || || || ||| |||| |||||||
Sbjct  1435  TCCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCA  1486


 Score = 51.8 bits (56),  Expect = 1e-05
 Identities = 99/145 (69%), Gaps = 6/145 (4%)
 Strand=Plus/Plus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCACCAAGGCTCCTTCCAGTG  496
             |||||||||| ||| | |||||  ||    | |||||||||||  | ||  |||  |  |
Sbjct  1313  CTTCTTCCACTGAAGCATCTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTTAACCG  1372

Query  497   AAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACTAGCGAGGCTC  556
             |||  || ||||||||| | | ||||||   ||   |||| || ||||||   || ||  
Sbjct  1373  AAGCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT---GAAGCCT  1429

Query  557   ACTCTTCCAGTGCTGCCTCTTCGAC  581
               ||||||| ||  || ||||| ||
Sbjct  1430  CTTCTTCCACTGAAGCATCTTCCAC  1454


 Score = 51.8 bits (56),  Expect = 1e-05
 Identities = 101/145 (70%), Gaps = 12/145 (8%)
 Strand=Plus/Plus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCAC-CAAGGCTC--CTTCCA  493
             |||||||||| ||| | ||||   ||    | |||||||||||  ||| |||  ||||||
Sbjct  1346  CTTCTTCCACTGAAGCATCTTTAACCGAAGCCTCTTCTTCCACTGAAGCCTCTTCTTCCA  1405

Query  494   GTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACTAGCGAGG  553
              |||||   | ||||||||| | | ||||||   ||   |||| || ||||||   || |
Sbjct  1406  CTGAAG---CATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT---GAAG  1459

Query  554   CTCACTCTTCCAGTGCTGCCTCTTC  578
             |    ||||||| ||  || |||||
Sbjct  1460  CCTCTTCTTCCACTGAAGCATCTTC  1484


 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 66/89 (75%), Gaps = 6/89 (6%)
 Strand=Plus/Plus

Query  421   GCCCCATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCT---TCTTCTTCC  477
             ||| | ||||| |   | || ||||| |||||| ||||||||||| ||    | ||||| 
Sbjct  1276  GCCTCTTCTTCCACTGAAGCATCTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTCA  1335

Query  478   ACC-AAGGCTC--CTTCCAGTGAAGAATC  503
             ||| ||| |||  |||||| ||||| |||
Sbjct  1336  ACCGAAGCCTCTTCTTCCACTGAAGCATC  1364


 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 70/98 (72%), Gaps = 3/98 (3%)
 Strand=Plus/Plus

Query  371   CTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCCCATCTT  430
             ||||||||| |   || || || || ||| |||| |||||||     |  ||| | ||||
Sbjct  1379  CTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT---GAAGCCTCTTCTT  1435

Query  431   CTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCT  468
             | |   | || |||||||| ||| ||||||||||| ||
Sbjct  1436  CCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACT  1473


 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 64/88 (73%), Gaps = 3/88 (3%)
 Strand=Plus/Plus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCACCAAGGCTCCTTCCAGTG  496
             |||||||||| ||| | |||||  |     | |||||||||||  | ||  |||||| ||
Sbjct  1397  CTTCTTCCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACTG  1456

Query  497   AAGAATCCTCTTCCACTTATGTCTCTTC  524
             |||  || ||||||||| | |  |||||
Sbjct  1457  AAGCCTCTTCTTCCACTGAAGCATCTTC  1484


 Score = 48.2 bits (52),  Expect = 2e-04
 Identities = 56/73 (77%), Gaps = 6/73 (8%)
 Strand=Plus/Plus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCT---TCTTCTTCCACC-AAGGCTC--CTTCCA  493
             ||| ||| |||||| ||||||||||| ||    | ||||| ||| ||| |||  ||||||
Sbjct  1262  CTTTTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTCAACCGAAGCCTCTTCTTCCA  1321

Query  494   GTGAAGAATCCTC  506
              ||||| ||| ||
Sbjct  1322  CTGAAGCATCTTC  1334


 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 80/115 (70%), Gaps = 8/115 (6%)
 Strand=Plus/Plus

Query  439   GCTTCTTCCACCGAATCCTCTTCTTCCTCT------TCTTCTTCCACCAAGGCTCCTTCC  492
             || ||||| |||||| |||||| |||  |       |||||||||||  | ||  |||| 
Sbjct  1243  GCATCTTCAACCGAAGCCTCTTTTTCAACCGAAGCCTCTTCTTCCACTGAAGCATCTTCA  1302

Query  493   AGTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGC-AAGCAAGCTTCCTCCACT  546
             |  ||||  || ||||||||| | |  ||||| | | ||||   |||| ||||||
Sbjct  1303  ACCGAAGCCTCTTCTTCCACTGAAGCATCTTCAACCGAAGC-CTCTTCTTCCACT  1356


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 60/86 (70%), Gaps = 6/86 (6%)
 Strand=Plus/Plus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCT---CTTCTTCTTCCACCAAGGCTCCTTCCAGTG  496
             |||||||||| ||| | |||||  |     | |||||||||||  | ||  ||||||   
Sbjct  1430  CTTCTTCCACTGAAGCATCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCA---  1486

Query  497   AAGAATCCTCTTCCACTTATGTCTCT  522
              |||| | ||| ||||  | ||||||
Sbjct  1487  TAGAAGCATCTACCACAGAAGTCTCT  1512


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 45/62 (73%), Gaps = 3/62 (4%)
 Strand=Plus/Plus

Query  421   GCCCCATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCT---TCTTCTTCC  477
             ||| | ||||| |   | || ||| |||| ||| ||||||||||| ||    | ||||||
Sbjct  1114  GCCTCTTCTTCAACTGAAGCATCTACCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCC  1173

Query  478   AC  479
             ||
Sbjct  1174  AC  1175


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 53.6 bits (58),  Expect = 4e-06
 Identities = 37/42 (89%), Gaps = 0/42 (0%)
 Strand=Plus/Minus

Query  64      GCAACACCTCCAGCTTGTTTATTGGCCTGTGTTGCGCAAGTC  105
               || || || ||||||||||||||||| |||||||| ||||||
Sbjct  441572  GCTACTCCACCAGCTTGTTTATTGGCATGTGTTGCTCAAGTC  441531


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  452     AATCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||| |||||||||||||||||
Sbjct  214214  AATCCTCATCTTCCTCTTCTTCTTC  214238


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCCAC  479
              ||||||||||| ||||||||||| ||
Sbjct  78540  TCCTCTTCTTCTTCTTCTTCTTCTAC  78565


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTC  473
                ||||||||||||||||||||
Sbjct  1343304  TCCTCTTCTTCCTCTTCTTC  1343323


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTC  473
                ||||||||||||||||||||
Sbjct  2044867  TCCTCTTCTTCCTCTTCTTC  2044886


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              ||||||||||| ||||| ||||||
Sbjct  78600  TCCTCTTCTTCTTCTTCATCTTCC  78623


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  457     TCTTCTTCCTCTTCTTCTTCCACC  480
               || |||||||||||||| ||||||
Sbjct  441239  TCATCTTCCTCTTCTTCATCCACC  441216


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  456      CTCTTCTTCCTCTTCTTCTTCCAC  479
                ||||||||| ||||||||||| ||
Sbjct  1110434  CTCTTCTTCTTCTTCTTCTTCAAC  1110457


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                || || ||||||||||||||||||
Sbjct  2044846  TCTTCATCTTCCTCTTCTTCTTCC  2044869


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                ||||||||||| || |||||||||
Sbjct  2044855  TCCTCTTCTTCTTCCTCTTCTTCC  2044878


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||| || ||||||||||||||
Sbjct  78531  TCCTCCTCCTCCTCTTCTTCTTC  78553


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||| ||||| |||||||||||
Sbjct  78537  TCCTCCTCTTCTTCTTCTTCTTC  78559


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || || |||||||||||||||||
Sbjct  78591  TCTTCATCTTCCTCTTCTTCTTC  78613


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 36/48 (75%), Gaps = 0/48 (0%)
 Strand=Plus/Plus

Query  442     TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCT  489
               |||||||||||| |  || ||||  ||   ||||||||| | ||| ||
Sbjct  113247  TCTTCCACCGAAGCTACTACTTCAACTGAATCTTCCACCGAAGCTACT  113294


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  193     TCCATCTGCCCAAACAATGACGCTGATGCTGCT  225
               || ||||| ||| ||  ||| ||||||||||||
Sbjct  441446  TCTATCTGTCCAGACGGTGAGGCTGATGCTGCT  441414


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  511862  TCGTCTTCTTCATCTTCTTCTTC  511884


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  641845  TCTTCTTCTTCTTCTTCTTCTTC  641823


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 32/41 (79%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  436      AAGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
                || ||||||||  |    || || |||||||||||||||||
Sbjct  1344222  AAAGCTTCTTCATCGCCTTCTTCCTCTTCCTCTTCTTCTTC  1344262


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 28/34 (83%), Gaps = 3/34 (8%)
 Strand=Plus/Plus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
                |||||||| |    ||||||||||| ||||||||
Sbjct  1344238  CTTCTTCCTCT---TCCTCTTCTTCTTCTTCTTC  1344268


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                |||||||| || |||||||||||
Sbjct  1344243  TCCTCTTCCTCTTCTTCTTCTTC  1344265


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456      CTCTTCTTCCTCTTCTTCTTC  476
                |||||||| ||||||||||||
Sbjct  1713536  CTCTTCTTGCTCTTCTTCTTC  1713516


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1722285  TCTTCTTCTTCATCTTCTTCTTC  1722307


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  455      CCTCTTCTTCCTCTTCTTCTTCC  477
                ||||||| || ||||||||||||
Sbjct  1722457  CCTCTTCCTCTTCTTCTTCTTCC  1722479


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || ||||||||||||||||| ||
Sbjct  2044858  TCTTCTTCTTCCTCTTCTTCCTC  2044880


> KLLA0E04995g KLLA0E04995g undefined product 6293776:6294522 reverse
Length=747

 Score = 53.6 bits (58),  Expect = 4e-06
 Identities = 37/42 (89%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  64   GCAACACCTCCAGCTTGTTTATTGGCCTGTGTTGCGCAAGTC  105
            || || || ||||||||||||||||| |||||||| ||||||
Sbjct  64   GCTACTCCACCAGCTTGTTTATTGGCATGTGTTGCTCAAGTC  105


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  457  TCTTCTTCCTCTTCTTCTTCCACC  480
            || |||||||||||||| ||||||
Sbjct  397  TCATCTTCCTCTTCTTCATCCACC  420


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  193  TCCATCTGCCCAAACAATGACGCTGATGCTGCT  225
            || ||||| ||| ||  ||| ||||||||||||
Sbjct  190  TCTATCTGTCCAGACGGTGAGGCTGATGCTGCT  222


> KLDOg2586
Length=717

 Score = 51.8 bits (56),  Expect = 1e-05
 Identities = 55/73 (76%), Gaps = 0/73 (0%)
 Strand=Plus/Plus

Query  32   TTTCTTTGGCATTGTTGTCGAAGGAAGTCTTAGCAACACCTCCAGCTTGTTTATTGGCCT  91
            ||||| | ||  | ||||| |  || ||  | ||  | |||||||||||||| ||||| |
Sbjct  32   TTTCTCTAGCTATTTTGTCAACCGAGGTTGTCGCTGCTCCTCCAGCTTGTTTGTTGGCAT  91

Query  92   GTGTTGCGCAAGT  104
            ||||||| |||||
Sbjct  92   GTGTTGCTCAAGT  104


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 45/58 (78%), Gaps = 2/58 (3%)
 Strand=Plus/Plus

Query  457  TCTTCTTCCTCTTCTTCTTCCACCAA-GGCTCCTTCCAGTGAAGAATCCTCTTCCACT  513
            || |||||||||||| | |  |||||   || ||||||||||| || | || ||||||
Sbjct  376  TCCTCTTCCTCTTCTGC-TGAACCAACCACTTCTTCCAGTGAACAACCATCGTCCACT  432


> KLDOg2424
Length=3360

 Score = 50.0 bits (54),  Expect = 4e-05
 Identities = 139/211 (66%), Gaps = 12/211 (5%)
 Strand=Plus/Plus

Query  301   GCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCC  360
             || ||||| ||||   | ||||||||||| ||  | || ||||| |  |  |   | |  
Sbjct  1807  GCCTCTTCTTCCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCTACCACAGAAGCATTT  1866

Query  361   TCTACCA---AGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGC  417
             |||||||   | |  ||| ||  |   || || || ||| |  |||| ||||| | ||  
Sbjct  1867  TCTACCACAGAAGTCTCTACCTCTGAAGCATCTTCTTCTGCCGAAGCCTCTTCTACCACT  1926

Query  418   GCTGCCCCATCTTCTAGC-AAG--GCTTCTTCCACCGAATCCTCTTCTTCCTCT------  468
             |  ||| | ||||||  | |||   ||||| |||| ||| |||||||| || ||      
Sbjct  1927  GAAGCCTCTTCTTCTGCCGAAGCCTCTTCTACCACTGAAGCCTCTTCTACCACTGAAGCC  1986

Query  469   TCTTCTTCCACCAAGGCTCCTTCCAGTGAAG  499
             |||||||||||  | ||  |||||| |||||
Sbjct  1987  TCTTCTTCCACTGAAGCATCTTCCACTGAAG  2017


 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 81/118 (69%), Gaps = 13/118 (11%)
 Strand=Plus/Plus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCC---------TCTTCTTCTTCCACCAAGGCTC--C  488
             |||||||  ||||| |||||||| ||         ||||||||| |  | ||| |||  |
Sbjct  1898  CTTCTTCTGCCGAAGCCTCTTCTACCACTGAAGCCTCTTCTTCTGC--CGAAGCCTCTTC  1955

Query  489   TTCCAGTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACT  546
             | ||| |||||  || ||| ||||| | | ||||||   ||   |||| || ||||||
Sbjct  1956  TACCACTGAAGCCTCTTCTACCACTGAAGCCTCTTCTTCCACTGAAGCATCTTCCACT  2013


 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 62/88 (71%), Gaps = 15/88 (17%)
 Strand=Plus/Plus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCC------------TCTTCTTCTTCCAC-CAAGGCT  486
             ||||| |||| ||| |||||||||||             | |||||||||||  ||| ||
Sbjct  1769  CTTCTACCACAGAAGCCTCTTCTTCCACAGAAGCCGAAGCCTCTTCTTCCACTGAAGCCT  1828

Query  487   C--CTTCCAGTGAAGAATCCTCTTCCAC  512
             |  |||||| ||||| ||| ||| ||||
Sbjct  1829  CTTCTTCCACTGAAGCATCTTCTACCAC  1856


> KLWIg852 KLWIg852 undefined product 1774503:1776416 reverse
Length=1809

 Score = 48.2 bits (52),  Expect = 2e-04
 Identities = 26/26 (100%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCAC  479
             ||||||||||||||||||||||||||
Sbjct  1577  TCCTCTTCTTCCTCTTCTTCTTCCAC  1552


> KLDOg2477
Length=1257

 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 34/40 (85%), Gaps = 3/40 (7%)
 Strand=Plus/Minus

Query  441   TTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
             ||||||| ||   || ||||||||||||||||||||| ||
Sbjct  1074  TTCTTCCTCC---TCGTCTTCTTCCTCTTCTTCTTCCTCC  1038


> KLWIg4784 KLWIg4784 undefined product 9762495:9763444 reverse
Length=741

 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 27/29 (94%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCAA  482
            |||||||||||||||||||| || |||||
Sbjct  619  TCCTCTTCTTCCTCTTCTTCCTCAACCAA  647


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 32/37 (87%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||    ||||||||||| |||||||||||
Sbjct  78486  CTTCTTCCACTTCTTCCTCTTCTTCTTCTTCTTCTTC  78522


 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 35/41 (86%), Gaps = 4/41 (9%)
 Strand=Plus/Minus

Query  442     TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAA  482
               |||||| ||   ||||||||||| |||||||||| ||||||
Sbjct  351376  TCTTCCTCC---TCCTCTTCTTCTTCTTCTTCTT-CACCAA  351340


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
               || |||||||| |||||||||||| |||
Sbjct  615041  TCTTCTTCTTCTTCTTCTTCTTCCTCCA  615068


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               ||||| ||||||||||| ||||||
Sbjct  351406  TCCTCCTCTTCCTCTTCCTCTTCC  351383


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  452      AATCCTCTTCTTCCTCTTCTTC  473
                |||||| |||||||||||||||
Sbjct  1298817  AATCCTTTTCTTCCTCTTCTTC  1298796


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  460      TCTTCCTCTTCTTCTTCCA  478
                |||||||||||||||||||
Sbjct  1322587  TCTTCCTCTTCTTCTTCCA  1322605


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  444    TTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              ||| || | |||||| || ||||||||||| ||
Sbjct  75563  TTCAACAGCATCCTCGTCGTCCTCTTCTTCATC  75531


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  171358  TCTTCTTCTTCTTCTTCTTCTTC  171380


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  356     CCTCCTCTACCAAGGCTTCTTCC  378
               ||||||||||| |||| ||||||
Sbjct  351988  CCTCCTCTACCGAGGCCTCTTCC  352010


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456     CTCTTCTTCCTCTTCTTCTTC  476
               ||||||||| |||||||||||
Sbjct  752088  CTCTTCTTCTTCTTCTTCTTC  752068


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || ||||||||||||||||| ||
Sbjct  1356315  TCATCTTCTTCCTCTTCTTCATC  1356337


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||||||||| |||||
Sbjct  1406244  TCTTCTTCTTCCTCTTCATCTTC  1406222


> KLLA0D00836g KLLA0D00836g undefined product 4215583:4217505 reverse
Length=1923

 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 32/37 (87%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             ||||||||||    ||||||||||| |||||||||||
Sbjct  1639  CTTCTTCCACTTCTTCCTCTTCTTCTTCTTCTTCTTC  1603


> AEAS01000121  Kluyveromyces aestuarii ATCC 18862 contig00127, 
whole genome shotgun sequence
Length=59122

 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              ||||||||||||||||||||||||
Sbjct  48935  TCCTCTTCTTCCTCTTCTTCTTCC  48912


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||||||||||||||||
Sbjct  48923  TCTTCTTCTTCCTCTTCTTCTTCC  48900


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||| |||||||||||
Sbjct  48959  TCCTCTTCTTCTTCTTCTTCTTC  48937


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||| ||||||||||||
Sbjct  48956  TCTTCTTCTTCTTCTTCTTCTTCC  48933


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || ||||||||||||||||| ||
Sbjct  48944  TCTTCTTCTTCCTCTTCTTCCTC  48922


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||| ||||| |||||||||||
Sbjct  48962  TCCTCCTCTTCTTCTTCTTCTTC  48940


> KLAEg3779 KLAEg3779 undefined product 7980251:7980970 forward
Length=720

 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||||||||||||||||
Sbjct  581  TCCTCTTCTTCCTCTTCTTCTTCC  558


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||||||||||||||||
Sbjct  569  TCTTCTTCTTCCTCTTCTTCTTCC  546


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  605  TCCTCTTCTTCTTCTTCTTCTTC  583


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||| ||||||||||||
Sbjct  602  TCTTCTTCTTCTTCTTCTTCTTCC  579


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||||||||||| ||
Sbjct  590  TCTTCTTCTTCCTCTTCTTCCTC  568


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| ||||| |||||||||||
Sbjct  608  TCCTCCTCTTCTTCTTCTTCTTC  586


> KLAEg687 KLAEg687 undefined product 1507295:1509007 forward
Length=1713

 Score = 44.6 bits (48),  Expect = 0.002
 Identities = 32/37 (87%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             |||||||| |    |||||||||||||||||||||||
Sbjct  1252  CTTCTTCCTCTTCTTCCTCTTCTTCCTCTTCTTCTTC  1216


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             |||||||| |    ||||||||||| |||||||||||
Sbjct  1243  CTTCTTCCTCTTCTTCCTCTTCTTCTTCTTCTTCTTC  1207


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  455   CCTCTTCTTCCTCTTCTTCTTC  476
             ||||||||||||||||||| ||
Sbjct  1255  CCTCTTCTTCCTCTTCTTCCTC  1234


> gi|6319354|ref|NC_001134.1| Saccharomyces cerevisiae chromosome 
II, complete chromosome sequence
Length=813140

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 32/38 (85%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               |||||||  ||   || |||||||||||||||||||||
Sbjct  205753  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTCC  205716


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || ||||||||||||||||||||
Sbjct  205754  TCTTCTTCTTCCTCTTCTTCTTC  205732


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               |||||||  | ||  |||| ||||| ||||||||||||
Sbjct  760681  CTTCTTCTTCGGATACCTCGTCTTCTTCTTCTTCTTCC  760644


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 31/38 (82%), Gaps = 3/38 (7%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               |||||||  ||   || |||||||||||||| ||||||
Sbjct  205738  CTTCTTCTTCC---TCTTCTTCTTCCTCTTCCTCTTCC  205704


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  456     CTCTTCTTCCTCTTCTTCT  474
               |||||||||||||||||||
Sbjct  394597  CTCTTCTTCCTCTTCTTCT  394615


> KLDOg2960
Length=2958

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 23/23 (100%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  455   CCTCTTCTTCCTCTTCTTCTTCC  477
             |||||||||||||||||||||||
Sbjct  2116  CCTCTTCTTCCTCTTCTTCTTCC  2094


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             ||||||||||| || |||||||||
Sbjct  2108  TCCTCTTCTTCTTCCTCTTCTTCC  2085


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || ||||||||||||||||| ||
Sbjct  2105  TCTTCTTCTTCCTCTTCTTCCTC  2083


> KLDOg2359
Length=1389

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 28/30 (94%), Gaps = 2/30 (6%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTT--CCACCA  481
             ||||||||||||||||||||||  ||||||
Sbjct  1151  TCCTCTTCTTCCTCTTCTTCTTCGCCACCA  1122


> KLWIg4661 KLWIg4661 undefined product 9494270:9495514 reverse
Length=1245

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 23/23 (100%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||||||||||||||||||
Sbjct  919  TCCTCTTCTTCCTCTTCTTCTTC  941


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| |    || ||||||||||||| ||||||
Sbjct  923  CTTCTTCCTCTTCTTCTTCTTCTTCCTCTTGTTCTTC  959


> KLWIg908 KLWIg908 undefined product 1870356:1873343 reverse
Length=2988

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
            ||||| | ||||||||||||||||||||
Sbjct  329  TCCTCCTGTTCCTCTTCTTCTTCCACCA  302


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTC  473
            |||||||||||||||||||||
Sbjct  426  ATCCTCTTCTTCCTCTTCTTC  406


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||| ||||| |||||||||||
Sbjct  360  ATCCTCATCTTCTTCTTCTTCTTC  337


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  442     TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
               |||||| ||   |||||||||||||||||||||
Sbjct  740017  TCTTCCTCCTCCTCCTCTTCTTCCTCTTCTTCT  739985


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  453     ATCCTCTTCTTCCTCTTCTTCTTCC  477
               ||||||||||||||| |||||||||
Sbjct  739475  ATCCTCTTCTTCCTCCTCTTCTTCC  739451


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               ||||||||||| ||||||||||||
Sbjct  768631  TCCTCTTCTTCTTCTTCTTCTTCC  768608


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 30/36 (84%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  442     TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               |||||| ||   ||||| ||||| ||||||||||||
Sbjct  850990  TCTTCCTCCACTTCCTCCTCTTCTTCTTCTTCTTCC  851025


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  444     TTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||   || |||||||| |||||||||||
Sbjct  651269  TTCCACCCGTTCGTCTTCTTCTTCTTCTTCTTC  651237


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||| ||||||||||||||
Sbjct  768571  TCCTCTTCCTCCTCTTCTTCTTC  768549


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACC  480
               || |||||||| |||||||||||| ||
Sbjct  516370  TCTTCTTCTTCTTCTTCTTCTTCCTCC  516344


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACC  480
               ||||||||||||||||| || ||| ||
Sbjct  739462  TCCTCTTCTTCCTCTTCGTCCTCCTCC  739436


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACC  480
               ||||||||||| || ||||||||| ||
Sbjct  739486  TCCTCTTCTTCATCCTCTTCTTCCTCC  739460


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACC  480
               || |||||||||||||||||| || ||
Sbjct  740044  TCTTCTTCTTCCTCTTCTTCTCCCTCC  740018


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 28/34 (83%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
               |||| |||||    ||||||||||| ||||||||
Sbjct  850991  CTTCCTCCACTTCCTCCTCTTCTTCTTCTTCTTC  851024


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516373  TCTTCTTCTTCTTCTTCTTCTTC  516351


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516376  TCTTCTTCTTCTTCTTCTTCTTC  516354


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516379  TCTTCTTCTTCTTCTTCTTCTTC  516357


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516382  TCTTCTTCTTCTTCTTCTTCTTC  516360


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516385  TCTTCTTCTTCTTCTTCTTCTTC  516363


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516388  TCTTCTTCTTCTTCTTCTTCTTC  516366


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516391  TCTTCTTCTTCTTCTTCTTCTTC  516369


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516394  TCTTCTTCTTCTTCTTCTTCTTC  516372


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  516397  TCTTCTTCTTCTTCTTCTTCTTC  516375


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456     CTCTTCTTCCTCTTCTTCTTC  476
               ||||||||| |||||||||||
Sbjct  516398  CTCTTCTTCTTCTTCTTCTTC  516378


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  457     TCTTCTTCCTCTTCTTCT  474
               ||||||||||||||||||
Sbjct  608287  TCTTCTTCCTCTTCTTCT  608304


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  651250  TCTTCTTCTTCTTCTTCTTCTTC  651228


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  651253  TCTTCTTCTTCTTCTTCTTCTTC  651231


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  651256  TCTTCTTCTTCTTCTTCTTCTTC  651234


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||||||| || ||||||||
Sbjct  740047  TCCTCTTCTTCTTCCTCTTCTTC  740025


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457     TCTTCTTCCTCTTCTTCTTCC  477
               || ||||||||||||||||||
Sbjct  740053  TCCTCTTCCTCTTCTTCTTCC  740033


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||| || |||||||||||
Sbjct  768637  TCCTCTTCCTCTTCTTCTTCTTC  768615


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  459     TTCTTCCTCTTCTTCTTC  476
               ||||||||||||||||||
Sbjct  997282  TTCTTCCTCTTCTTCTTC  997299


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  1237217  TCTTCTTCTTCTTCTTCTTCTTC  1237239


> KLLA0D04136g KLLA0D04136g undefined product 4488357:4489505 forward
Length=1149

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 35/41 (86%), Gaps = 4/41 (9%)
 Strand=Plus/Minus

Query  442  TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAA  482
            |||||| ||   ||||||||||| |||||||||| ||||||
Sbjct  401  TCTTCCTCC---TCCTCTTCTTCTTCTTCTTCTT-CACCAA  365


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||| ||||||||||| ||||||
Sbjct  431  TCCTCCTCTTCCTCTTCCTCTTCC  408


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  356   CCTCCTCTACCAAGGCTTCTTCC  378
             ||||||||||| |||| ||||||
Sbjct  1013  CCTCCTCTACCGAGGCCTCTTCC  1035


> KLLA0B08305g KLLA0B08305g undefined product 1800557:1802764 forward
Length=2208

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  442   TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
             |||||| ||   |||||||||||||||||||||
Sbjct  2051  TCTTCCTCCTCCTCCTCTTCTTCCTCTTCTTCT  2019


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTCC  477
             ||||||||||||||| |||||||||
Sbjct  1509  ATCCTCTTCTTCCTCCTCTTCTTCC  1485


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACC  480
             ||||||||||||||||| || ||| ||
Sbjct  1496  TCCTCTTCTTCCTCTTCGTCCTCCTCC  1470


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACC  480
             ||||||||||| || ||||||||| ||
Sbjct  1520  TCCTCTTCTTCATCCTCTTCTTCCTCC  1494


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACC  480
             || |||||||||||||||||| || ||
Sbjct  2078  TCTTCTTCTTCCTCTTCTTCTCCCTCC  2052


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||||||||| || ||||||||
Sbjct  2081  TCCTCTTCTTCTTCCTCTTCTTC  2059


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457   TCTTCTTCCTCTTCTTCTTCC  477
             || ||||||||||||||||||
Sbjct  2087  TCCTCTTCCTCTTCTTCTTCC  2067


> AEAS01000147  Kluyveromyces aestuarii ATCC 18862 contig00156, 
whole genome shotgun sequence
Length=14676

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 31/36 (87%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  442    TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
              ||||| ||||||||||||  ||| ||||||||| ||
Sbjct  12595  TCTTCAACCGAATCCTCTCTTTCGTCTTCTTCTCCC  12560


> KLAEg4455 KLAEg4455 undefined product 9490784:9492928 forward
Length=2145

 Score = 42.8 bits (46),  Expect = 0.007
 Identities = 31/36 (87%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  442  TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||| ||||||||||||  ||| ||||||||| ||
Sbjct  107  TCTTCAACCGAATCCTCTCTTTCGTCTTCTTCTCCC  72


> gi|6322623|ref|NC_001143.1| Saccharomyces cerevisiae chromosome 
XI, complete chromosome sequence
Length=666445

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  456     CTCTTCTTCCTCTTCTTCTTCC  477
               ||||||||||||||||||||||
Sbjct  386571  CTCTTCTTCCTCTTCTTCTTCC  386550


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               |||||||  ||  |||||||||||| ||||| || |||
Sbjct  386560  CTTCTTCTTCCTCATCCTCTTCTTCTTCTTCCTCCTCC  386523


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTT  475
              ||||||||||| ||||||||||
Sbjct  38660  TCCTCTTCTTCTTCTTCTTCTT  38639


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || |||||||| ||||||||||||
Sbjct  126128  TCTTCTTCTTCTTCTTCTTCTTCC  126105


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  126131  TCTTCTTCTTCTTCTTCTTCTTC  126109


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  126134  TCTTCTTCTTCTTCTTCTTCTTC  126112


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||||||| |||||||| ||
Sbjct  220592  TCCTCTTCTTCATCTTCTTCATC  220570


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  290     CCTCCTCATCCGCTTCTTCATCC  312
               ||||||||||| |||| ||||||
Sbjct  276542  CCTCCTCATCCTCTTCGTCATCC  276520


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||| |||||||||||||| ||
Sbjct  519449  TCCTCCTCTTCCTCTTCTTCCTC  519471


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||| || ||||||||||||||
Sbjct  613417  TCCTCCTCCTCCTCTTCTTCTTC  613395


> gi|6322236|ref|NC_001142.1| Saccharomyces cerevisiae chromosome 
X, complete chromosome sequence
Length=745440

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACC  480
               ||||||||||| |||||||||||| ||
Sbjct  188728  TCCTCTTCTTCTTCTTCTTCTTCCTCC  188754


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTC  473
              ||||||||||||||||||||
Sbjct  78981  TCCTCTTCTTCCTCTTCTTC  79000


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||| || ||||||||||||||
Sbjct  188719  TCCTCCTCCTCCTCTTCTTCTTC  188741


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||| ||||| |||||||||||
Sbjct  188725  TCCTCCTCTTCTTCTTCTTCTTC  188747


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || ||||||||||| ||||||||
Sbjct  188740  TCTTCTTCTTCCTCCTCTTCTTC  188762


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || ||||| ||||||||||||||
Sbjct  188743  TCTTCTTCCTCCTCTTCTTCTTC  188765


> gi|6321173|ref|NC_001139.1| Saccharomyces cerevisiae chromosome 
VII, complete chromosome sequence
Length=1090936

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||||||   || ||||| ||||||||||| ||
Sbjct  458419  CTTCTTCCACCACGTCGTCTTCGTCCTCTTCTTCATC  458383


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  451     GAATCCTCTTCTTCCTCTTCTTCT  474
               |||||||||||||| || ||||||
Sbjct  807458  GAATCCTCTTCTTCATCGTCTTCT  807435


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457    TCTTCTTCCTCTTCTTCTTCC  477
              |||||||| ||||||||||||
Sbjct  69275  TCTTCTTCGTCTTCTTCTTCC  69255


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/25 (92%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  452     AATCCTCTT-CTTCCTCTTCTTCTT  475
               ||||||||| ||| |||||||||||
Sbjct  257457  AATCCTCTTTCTTGCTCTTCTTCTT  257481


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  445     TCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               ||| | | ||| ||||||||||| ||||| |||
Sbjct  633921  TCCTCAGTATCGTCTTCTTCCTCGTCTTCCTCC  633953


> KLDOg3775
Length=1227

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  455  CCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||||||||||||||
Sbjct  320  CCTCTTCTTCCTCTTCTTCTTC  341


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 32/39 (83%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCA  478
            |||| ||| ||   || |||||||||||||||||| |||
Sbjct  344  CTTCCTCCTCCACTTCTTCTTCTTCCTCTTCTTCTGCCA  382


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 51/72 (71%), Gaps = 6/72 (8%)
 Strand=Plus/Plus

Query  292  TCCTCATCCGCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGC  351
            ||||| ||| ||||||| ||        ||||||||||| |||  ||| |||| |   ||
Sbjct  346  TCCTCCTCCACTTCTTCTTCTT------CCTCTTCTTCTGCCAGCGCTACTTCTACCGGC  399

Query  352  GCTTCCTCCTCT  363
             |||| ||||||
Sbjct  400  TCTTCATCCTCT  411


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
            ||||||||||| || ||||| ||| |||
Sbjct  328  TCCTCTTCTTCTTCATCTTCCTCCTCCA  355


> KLDOg899
Length=3087

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  442  TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||| ||   || ||||||||||||||||||||
Sbjct  452  TCTTCCTCCACTTCTTCTTCTTCCTCTTCTTCTTC  418


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| | |||||||||
Sbjct  407  TCCTCTTCTTCTTTTTCTTCTTC  385


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  458  CTTCTTCCTCTTCTTCTT  475
            ||||||||||||||||||
Sbjct  412  CTTCTTCCTCTTCTTCTT  395


> KLDOg73
Length=501

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| |    || ||||||||||||||||||||
Sbjct  374  CTTCTTCCTCATCTTCTTCTTCTTCCTCTTCTTCTTC  410


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || ||||||||||| |||||||||
Sbjct  358  TCTTCTTCTTCCTCATCTTCTTCC  381


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||  ||  ||| ||||| || |||||||||||
Sbjct  359  CTTCTTCTTCCTCATCTTCTTCCTCATCTTCTTCTTC  395


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 32/41 (79%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
            |||||||  ||   || |||||||||||||| || ||| ||
Sbjct  389  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCGTCCTCCTCC  429


> KLWIg656 KLWIg656 undefined product 1388799:1390553 reverse
Length=1755

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| |    |||||||||||||||||||| ||
Sbjct  901  CTTCTTCCTCTTCTTCCTCTTCTTCCTCTTCTTCCTC  865


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  455  CCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||||||||||| ||
Sbjct  904  CCTCTTCTTCCTCTTCTTCCTC  883


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  1440  ATCTTCTTCTTCTTCTTCTTCTTC  1417


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1424  TCTTCTTCTTCTTCTTCTTCTTC  1402


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1427  TCTTCTTCTTCTTCTTCTTCTTC  1405


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1430  TCTTCTTCTTCTTCTTCTTCTTC  1408


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1433  TCTTCTTCTTCTTCTTCTTCTTC  1411


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1436  TCTTCTTCTTCTTCTTCTTCTTC  1414


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 32/38 (85%), Gaps = 3/38 (7%)
 Strand=Plus/Minus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
                |||||||| |    ||||||||||| ||||||||||||
Sbjct  1360616  CTTCTTCCTCT---TCCTCTTCTTCTTCTTCTTCTTCC  1360582


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||  ||   || ||||||||||||||||||||
Sbjct  964767  CTTCTTCTTCC---TCTTCTTCTTCCTCTTCTTCTTC  964734


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || |||||||||||||||||||||
Sbjct  964768  TCTTCTTCTTCCTCTTCTTCTTCC  964745


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 33/41 (81%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  440      CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
                |||||||| ||   || ||||||||  ||||||||||| ||
Sbjct  1468678  CTTCTTCCTCCTCCTCTTCTTCTTCAGCTTCTTCTTCCTCC  1468638


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||||||| |||||||||||
Sbjct  373648  TCCTCTTCTTCTTCTTCTTCTTC  373670


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  458     CTTCTTCCTCTTCTTCTTC  476
               |||||||||||||||||||
Sbjct  373379  CTTCTTCCTCTTCTTCTTC  373397


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  485     CTCCTTCCAGTGAAGAATCCTCTTCCACT  513
               || |||| | ||||||||||||||| |||
Sbjct  450109  CTACTTCTACTGAAGAATCCTCTTCTACT  450137


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  485     CTCCTTCCAGTGAAGAATCCTCTTCCACT  513
               || |||||  ||||||||||||||| |||
Sbjct  450157  CTTCTTCCGCTGAAGAATCCTCTTCTACT  450185


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  453     ATCCTCTTCTTCCTCTTCTTCT  474
               ||||||||||||||| ||||||
Sbjct  456174  ATCCTCTTCTTCCTCCTCTTCT  456153


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 43/56 (77%), Gaps = 6/56 (10%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTCCAGTGAAGAATCCTCTTC  509
               || |||||||| |||||||||||  |  ||  || ||  ||||||||| | |||||
Sbjct  819761  TCGTCTTCTTCTTCTTCTTCTTCTGC--AG--TCGTT--AGTGAAGAACCATCTTC  819810


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  451      GAATCCTCTTCTTCCTCTTCTTCTTCCAC  479
                |||||  |||||||  |||||||||||||
Sbjct  1209218  GAATCTACTTCTTCTACTTCTTCTTCCAC  1209190


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||| ||||| |||||||||||
Sbjct  373645  TCCTCCTCTTCTTCTTCTTCTTC  373667


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  488     CTTCCAGTGAAGAATCCTCTTCCACT  513
               |||| | ||||||||||||||| |||
Sbjct  450067  CTTCTACTGAAGAATCCTCTTCTACT  450092


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||| ||||||||||||| |||||
Sbjct  582051  TCCACTTCTTCCTCTTCATCTTC  582029


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703596  TCTTCTTCTTCTTCTTCTTCTTC  703618


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703599  TCTTCTTCTTCTTCTTCTTCTTC  703621


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703602  TCTTCTTCTTCTTCTTCTTCTTC  703624


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703605  TCTTCTTCTTCTTCTTCTTCTTC  703627


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703608  TCTTCTTCTTCTTCTTCTTCTTC  703630


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703611  TCTTCTTCTTCTTCTTCTTCTTC  703633


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703614  TCTTCTTCTTCTTCTTCTTCTTC  703636


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703617  TCTTCTTCTTCTTCTTCTTCTTC  703639


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  703620  TCTTCTTCTTCTTCTTCTTCTTC  703642


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||||||||| |||||
Sbjct  1360593  TCTTCTTCTTCCTCTTCCTCTTC  1360571


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || ||||||||||||||||| ||
Sbjct  1548095  TCTTCTTCTTCCTCTTCTTCGTC  1548073


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| || ||||||||
Sbjct  1548098  TCCTCTTCTTCTTCCTCTTCTTC  1548076


> KLLA0E02311g KLLA0E02311g undefined product 6066919:6068172 reverse
Length=1254

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  452   AATCCTCTTCTTCCTCTTCTTCTTC  476
             ||||||| |||||||||||||||||
Sbjct  1072  AATCCTCATCTTCCTCTTCTTCTTC  1048


> KLLA0C15697g KLLA0C15697g undefined product 3743713:3744627 forward
Length=915

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 32/38 (85%), Gaps = 3/38 (7%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            |||||||| |    ||||||||||| ||||||||||||
Sbjct  328  CTTCTTCCTCT---TCCTCTTCTTCTTCTTCTTCTTCC  294


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||||||||| |||||
Sbjct  305  TCTTCTTCTTCCTCTTCCTCTTC  283


> AEAS01000317  Kluyveromyces aestuarii ATCC 18862 contig00649, 
whole genome shotgun sequence
Length=24690

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              |||||||  ||   || ||||||||||||||||||||
Sbjct  18133  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTC  18169


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              |||||||  ||   || ||||||||||||||||||||
Sbjct  18148  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTC  18184


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              |||||||  ||   || ||||||||||||||||||||
Sbjct  18163  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTC  18199


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              ||||||||||||||||| ||||||
Sbjct  18213  TCCTCTTCTTCCTCTTCCTCTTCC  18236


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || ||||||||||||||||||||
Sbjct  18132  TCTTCTTCTTCCTCTTCTTCTTC  18154


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
              |||||||  ||   || |||||||||||||| ||||||
Sbjct  18178  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCCTCTTCC  18215


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||||||||| |||||
Sbjct  18234  TCCTCTTCTTCCTCTTCCTCTTC  18256


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
              |||||||| |    || ||||| || ||||||||||||
Sbjct  18136  CTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTCTTCC  18173


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
              |||||||| |    || ||||| || ||||||||||||
Sbjct  18151  CTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTCTTCC  18188


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
              |||||||| |    || ||||| || ||||||||||||
Sbjct  18166  CTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTCTTCC  18203


> AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, 
whole genome shotgun sequence
Length=84350

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 32/37 (87%), Gaps = 1/37 (2%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCCACCAAGG-CTCCT  489
              || ||||||||||||||||||||  ||| || |||||
Sbjct  50196  TCTTCTTCTTCCTCTTCTTCTTCTTCCACGGCCTCCT  50232


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 29/36 (81%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  441    TTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              |||| |||   | ||||||||||| |||||||| ||
Sbjct  50174  TTCTACCAATTATTCCTCTTCTTCTTCTTCTTCCTC  50209


> KLAEg4576 KLAEg4576 undefined product 9761141:9763135 forward
Length=1995

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 32/37 (87%), Gaps = 1/37 (2%)
 Strand=Plus/Plus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACCAAGG-CTCCT  489
             || ||||||||||||||||||||  ||| || |||||
Sbjct  1816  TCTTCTTCTTCCTCTTCTTCTTCTTCCACGGCCTCCT  1852


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 29/36 (81%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  441   TTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             |||| |||   | ||||||||||| |||||||| ||
Sbjct  1794  TTCTACCAATTATTCCTCTTCTTCTTCTTCTTCCTC  1829


> KLAEg2012 KLAEg2012 undefined product 4253223:4255067 reverse
Length=1845

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||  ||   || ||||||||||||||||||||
Sbjct  382  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTC  346


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||  ||   || ||||||||||||||||||||
Sbjct  397  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTC  361


 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||  ||   || ||||||||||||||||||||
Sbjct  412  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTC  376


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||||||||| ||||||
Sbjct  332  TCCTCTTCTTCCTCTTCCTCTTCC  309


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||||||||| |||||
Sbjct  311  TCCTCTTCTTCCTCTTCCTCTTC  289


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            |||||||  ||   || |||||||||||||| ||||||
Sbjct  367  CTTCTTCTTCCTCTTCTTCTTCTTCCTCTTCCTCTTCC  330


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||||||||||||||
Sbjct  413  TCTTCTTCTTCCTCTTCTTCTTC  391


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            |||||||| |    || ||||| || ||||||||||||
Sbjct  379  CTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTCTTCC  342


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            |||||||| |    || ||||| || ||||||||||||
Sbjct  394  CTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTCTTCC  357


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            |||||||| |    || ||||| || ||||||||||||
Sbjct  409  CTTCTTCCTCTTCTTCTTCTTCCTCTTCTTCTTCTTCC  372


> KLAEg1369 KLAEg1369 undefined product 2896279:2899001 forward
Length=2652

 Score = 41.0 bits (44),  Expect = 0.023
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTT  475
            ||||||||||||||||||||||
Sbjct  176  TCCTCTTCTTCCTCTTCTTCTT  155


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/37 (82%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| |    || ||||||||||||||||| ||
Sbjct  196  CTTCTTCCTCT---TCGTCTTCTTCCTCTTCTTCCTC  163


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||||||||| |||||
Sbjct  200  TCGTCTTCTTCCTCTTCGTCTTC  178


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 29/36 (81%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTT  475
            |||||||| |    || |||||||||||||| ||||
Sbjct  304  CTTCTTCCCCTTCCTCGTCTTCTTCCTCTTCGTCTT  269


> gi|6324971|ref|NC_001148.1| Saccharomyces cerevisiae chromosome 
XVI, complete chromosome sequence
Length=948061

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453     ATCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||||||||||||||||| ||
Sbjct  187377  ATCCTCTTCTTCCTCTTCTTCCTC  187400


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || ||||||||||||||||||||
Sbjct  536740  TCTTCTTCTTCCTCTTCTTCTTC  536762


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||||||| |||||||||||
Sbjct  536749  TCCTCTTCTTCTTCTTCTTCTTC  536771


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  452     AATCCTCTTCTTCCTCTTCTTC  473
               ||||||||||||| ||||||||
Sbjct  304752  AATCCTCTTCTTCTTCTTCTTC  304731


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || |||||||| ||||||||||||
Sbjct  536728  TCTTCTTCTTCTTCTTCTTCTTCC  536751


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  187315  TCTTCTTCTTCTTCTTCTTCTTC  187337


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  187318  TCTTCTTCTTCTTCTTCTTCTTC  187340


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  187321  TCTTCTTCTTCTTCTTCTTCTTC  187343


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  276663  TCTTCTTCTTCTTCTTCTTCTTC  276685


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  276666  TCTTCTTCTTCTTCTTCTTCTTC  276688


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  398021  TCTTCTTCTTCTTCTTCTTCTTC  398043


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  398024  TCTTCTTCTTCTTCTTCTTCTTC  398046


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536704  TCTTCTTCTTCTTCTTCTTCTTC  536726


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536707  TCTTCTTCTTCTTCTTCTTCTTC  536729


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536710  TCTTCTTCTTCTTCTTCTTCTTC  536732


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536713  TCTTCTTCTTCTTCTTCTTCTTC  536735


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536716  TCTTCTTCTTCTTCTTCTTCTTC  536738


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536719  TCTTCTTCTTCTTCTTCTTCTTC  536741


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536722  TCTTCTTCTTCTTCTTCTTCTTC  536744


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  536725  TCTTCTTCTTCTTCTTCTTCTTC  536747


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/37 (82%), Gaps = 3/37 (8%)
 Strand=Plus/Plus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||  ||   || |||||||| |||||||||||
Sbjct  536741  CTTCTTCTTCC---TCTTCTTCTTCTTCTTCTTCTTC  536774


> gi|6862570|ref|NC_001140.2| Saccharomyces cerevisiae chromosome 
VIII, complete chromosome sequence
Length=562639

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               ||||||||||| ||||||||||||
Sbjct  552052  TCCTCTTCTTCTTCTTCTTCTTCC  552029


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  386099  TCTTCTTCTTCTTCTTCTTCTTC  386121


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCT  471
               ||||||||||||||||||
Sbjct  527584  TCCTCTTCTTCCTCTTCT  527601


> gi|6319247|ref|NC_001133.1| Saccharomyces cerevisiae chromosome 
I, complete chromosome sequence
Length=230203

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               ||||||||||| ||||||||||||
Sbjct  225403  TCCTCTTCTTCTTCTTCTTCTTCC  225380


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  77537  TCTTCTTCTTCTTCTTCTTCTTC  77515


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  77540  TCTTCTTCTTCTTCTTCTTCTTC  77518


> KLDOg4018
Length=1815

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  458   CTTCTTCCTCTTCTTCTTCCA  478
             |||||||||||||||||||||
Sbjct  1399  CTTCTTCCTCTTCTTCTTCCA  1379


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 30/36 (84%), Gaps = 3/36 (8%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTT  475
             |||||||| ||   || ||||| |||||||||||||
Sbjct  1057  CTTCTTCCTCC---TCTTCTTCATCCTCTTCTTCTT  1025


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             |||||||||||| | |||||||||
Sbjct  1038  ATCCTCTTCTTCTTTTTCTTCTTC  1015


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  458   CTTCTTCCTCTTCTTCTTC  476
             |||||||||||||||||||
Sbjct  1531  CTTCTTCCTCTTCTTCTTC  1513


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||||||||| || ||||||||
Sbjct  1049  TCCTCTTCTTCATCCTCTTCTTC  1027


> KLDOg3021
Length=3204

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             ||||||||||| ||||||||||||
Sbjct  1142  TCCTCTTCTTCTTCTTCTTCTTCC  1119


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||| ||||| |||||||||||
Sbjct  1145  TCCTCCTCTTCTTCTTCTTCTTC  1123


> KLDOg1733
Length=1923

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456   CTCTTCTTCCTCTTCTTCTTC  476
             |||||||||||||||||||||
Sbjct  1632  CTCTTCTTCCTCTTCTTCTTC  1612


> KLDOg1475
Length=1830

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            ||| ||||||||||||||||||||
Sbjct  768  ATCTTCTTCTTCCTCTTCTTCTTC  745


> KLDOg798
Length=1365

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 32/38 (85%), Gaps = 1/38 (2%)
 Strand=Plus/Plus

Query  437  AGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
            ||||| ||||| ||   ||||||||||| |||||||||
Sbjct  510  AGGCT-CTTCCTCCTCTTCCTCTTCTTCTTCTTCTTCT  546


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| |||||||||||||||||
Sbjct  517  TCCTCCTCTTCCTCTTCTTCTTC  539


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| || |||||||||||
Sbjct  520  TCCTCTTCCTCTTCTTCTTCTTC  542


> KLDOg743
Length=2178

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 30/35 (86%), Gaps = 3/35 (8%)
 Strand=Plus/Minus

Query  442   TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             |||||| ||   || ||||||||||||||||||||
Sbjct  1439  TCTTCCTCC---TCTTCTTCTTCCTCTTCTTCTTC  1408


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             |||||||| |||||||||||||||
Sbjct  1442  TCCTCTTCCTCCTCTTCTTCTTCC  1419


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             |||||||||||||| |||||||||
Sbjct  2030  TCCTCTTCTTCCTCGTCTTCTTCC  2007


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             |||||||| |    ||||||||||| || ||||||||
Sbjct  1447  CTTCTTCCTCTTCCTCCTCTTCTTCTTCCTCTTCTTC  1411


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||||||||| |||||
Sbjct  2018  TCGTCTTCTTCCTCTTCCTCTTC  1996


> KLDOg632
Length=1671

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457   TCTTCTTCCTCTTCTTCTTCC  477
             |||||||||||||||||||||
Sbjct  1310  TCTTCTTCCTCTTCTTCTTCC  1290


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || |||||||||||||||| ||||
Sbjct  1301  TCTTCTTCTTCCTCTTCTTTTTCC  1278


> KLWIg3760 KLWIg3760 undefined product 7617774:7619237 forward
Length=1464

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 32/39 (83%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  438  GGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            || ||| ||| |||  || |||||||| |||||||||||
Sbjct  414  GGTTTCCTCCGCCGCTTCTTCTTCTTCTTCTTCTTCTTC  376


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  389  TCTTCTTCTTCTTCTTCTTCTTC  367


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  392  TCTTCTTCTTCTTCTTCTTCTTC  370


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  395  TCTTCTTCTTCTTCTTCTTCTTC  373


> KLWIg2334 KLWIg2334 undefined product 4771564:4773369 forward
Length=1806

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  452   AATCCTCTTCTTCCTCTTCTTCTTCCACC  480
             |||||| ||||||||||||||||  ||||
Sbjct  1657  AATCCTTTTCTTCCTCTTCTTCTGTCACC  1629


> KLWIg1928 KLWIg1928 undefined product 3977301:3978368 forward
Length=1068

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 29/34 (86%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
            |||||||| ||   ||||| ||||||||||||||
Sbjct  304  CTTCTTCCTCCTCTTCCTCCTCTTCCTCTTCTTC  271


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| | |||||||||
Sbjct  323  TCCTCTTCTTCTTGTTCTTCTTC  301


> KLWIg1318 KLWIg1318 undefined product 2688152:2690893 forward
Length=2742

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTC  473
            |||||||||||||||||||||
Sbjct  708  ATCCTCTTCTTCCTCTTCTTC  688


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456     CTCTTCTTCCTCTTCTTCTTC  476
               |||||||||||||||||||||
Sbjct  608429  CTCTTCTTCCTCTTCTTCTTC  608409


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  32      TTTCTTTGGCATTGTTGTCGAAGGAA  57
               ||||||||| |||||||||||| |||
Sbjct  664542  TTTCTTTGGGATTGTTGTCGAAAGAA  664517


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               ||||||||||| ||||||||||||
Sbjct  686850  TCCTCTTCTTCTTCTTCTTCTTCC  686873


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||| ||||||||||||
Sbjct  72483  TCTTCTTCTTCTTCTTCTTCTTCC  72460


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || |||||||| ||||||||||||
Sbjct  608575  TCTTCTTCTTCTTCTTCTTCTTCC  608552


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  78979  TCTTCTTCTTCTTCTTCTTCTTC  78957


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  78982  TCTTCTTCTTCTTCTTCTTCTTC  78960


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  78985  TCTTCTTCTTCTTCTTCTTCTTC  78963


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  78988  TCTTCTTCTTCTTCTTCTTCTTC  78966


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  459     TTCTTCCTCTTCTTCTTC  476
               ||||||||||||||||||
Sbjct  261646  TTCTTCCTCTTCTTCTTC  261629


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457     TCTTCTTCCTCTTCTTCTTCC  477
               |||||||| ||||||||||||
Sbjct  608464  TCTTCTTCTTCTTCTTCTTCC  608444


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || ||||||||||||||||| ||
Sbjct  608563  TCTTCTTCTTCCTCTTCTTCATC  608541


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  608578  TCTTCTTCTTCTTCTTCTTCTTC  608556


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  608581  TCTTCTTCTTCTTCTTCTTCTTC  608559


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  608584  TCTTCTTCTTCTTCTTCTTCTTC  608562


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  608587  TCTTCTTCTTCTTCTTCTTCTTC  608565


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  608590  TCTTCTTCTTCTTCTTCTTCTTC  608568


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               |||| |||||| |||||||||||
Sbjct  608596  TCCTTTTCTTCTTCTTCTTCTTC  608574


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  291     CTCCTCATCCGCTTCTTCATCCA  313
               ||| |||||| ||||||||||||
Sbjct  835865  CTCTTCATCCACTTCTTCATCCA  835843


> KLLA0E00771g KLLA0E00771g undefined product 5930908:5932248 forward
Length=1341

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCAC  479
            ||||||||||| ||||||||||| ||
Sbjct  520  TCCTCTTCTTCTTCTTCTTCTTCTAC  545


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||| ||||| ||||||
Sbjct  580  TCCTCTTCTTCTTCTTCATCTTCC  603


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| || ||||||||||||||
Sbjct  511  TCCTCCTCCTCCTCTTCTTCTTC  533


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| ||||| |||||||||||
Sbjct  517  TCCTCCTCTTCTTCTTCTTCTTC  539


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || || |||||||||||||||||
Sbjct  571  TCTTCATCTTCCTCTTCTTCTTC  593


> KLLA0C16797g KLLA0C16797g undefined product 3850407:3853349 forward
Length=2943

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 33/41 (81%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC  480
             |||||||| ||   || ||||||||  ||||||||||| ||
Sbjct  1696  CTTCTTCCTCCTCCTCTTCTTCTTCAGCTTCTTCTTCCTCC  1656


> KLLA0C11209g KLLA0C11209g undefined product 3346412:3348295 forward
Length=1884

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             |||||||  ||   || ||||||||||||||||||||
Sbjct  1780  CTTCTTCTTCC---TCTTCTTCTTCCTCTTCTTCTTC  1747


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || |||||||||||||||||||||
Sbjct  1781  TCTTCTTCTTCCTCTTCTTCTTCC  1758


> KLLA0B09746g KLLA0B09746g undefined product 1912992:1914365 forward
Length=1374

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 30/36 (84%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  442  TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            |||||| ||   ||||| ||||| ||||||||||||
Sbjct  589  TCTTCCTCCACTTCCTCCTCTTCTTCTTCTTCTTCC  624


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 28/34 (83%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
            |||| |||||    ||||||||||| ||||||||
Sbjct  590  CTTCCTCCACTTCCTCCTCTTCTTCTTCTTCTTC  623


> KLLA0B08679g KLLA0B08679g undefined product 1830398:1831489 forward
Length=1092

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||| ||||||||||||
Sbjct  824  TCCTCTTCTTCTTCTTCTTCTTCC  801


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| ||||||||||||||
Sbjct  764  TCCTCTTCCTCCTCTTCTTCTTC  742


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| || |||||||||||
Sbjct  830  TCCTCTTCCTCTTCTTCTTCTTC  808


> KLLA0A07689g KLLA0A07689g undefined product 686738:687457 reverse
Length=720

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||| ||||||||||||
Sbjct  608  TCCTCTTCTTCTTCTTCTTCTTCC  585


> KLLA0A07425g KLLA0A07425g undefined product 663956:668764 reverse
Length=4809

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  32    TTTCTTTGGCATTGTTGTCGAAGGAA  57
             ||||||||| |||||||||||| |||
Sbjct  4223  TTTCTTTGGGATTGTTGTCGAAAGAA  4248


> KLLA0A06710g KLLA0A06710g undefined product 608103:609374 forward
Length=1272

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            |||||||||||||||||||||
Sbjct  327  CTCTTCTTCCTCTTCTTCTTC  307


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||| ||||||||||||
Sbjct  473  TCTTCTTCTTCTTCTTCTTCTTCC  450


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457  TCTTCTTCCTCTTCTTCTTCC  477
            |||||||| ||||||||||||
Sbjct  362  TCTTCTTCTTCTTCTTCTTCC  342


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||||||||||| ||
Sbjct  461  TCTTCTTCTTCCTCTTCTTCATC  439


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  476  TCTTCTTCTTCTTCTTCTTCTTC  454


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  479  TCTTCTTCTTCTTCTTCTTCTTC  457


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  482  TCTTCTTCTTCTTCTTCTTCTTC  460


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  485  TCTTCTTCTTCTTCTTCTTCTTC  463


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  488  TCTTCTTCTTCTTCTTCTTCTTC  466


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||| |||||| |||||||||||
Sbjct  494  TCCTTTTCTTCTTCTTCTTCTTC  472


> AEAS01000336  Kluyveromyces aestuarii ATCC 18862 contig00682, 
whole genome shotgun sequence
Length=139775

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  453    ATCCTCTTCTTCCTCTTCTTC  473
              |||||||||||||||||||||
Sbjct  33735  ATCCTCTTCTTCCTCTTCTTC  33755


> AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, 
whole genome shotgun sequence
Length=165313

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 29/34 (86%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  443    CTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              ||||| | |  ||||||||||| |||||||||||
Sbjct  87504  CTTCCTCTGTTTCCTCTTCTTCTTCTTCTTCTTC  87471


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||  ||   || ||||||||||||||||||||
Sbjct  106783  CTTCTTCTTCC---TCTTCTTCTTCCTCTTCTTCTTC  106750


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || |||||||||||||||||||||
Sbjct  106784  TCTTCTTCTTCCTCTTCTTCTTCC  106761


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457     TCTTCTTCCTCTTCTTCTTCC  477
               |||||||||||||||||||||
Sbjct  106793  TCTTCTTCCTCTTCTTCTTCC  106773


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTC  473
               ||||||||||||||||||||
Sbjct  101132  TCCTCTTCTTCCTCTTCTTC  101113


> AEAS01000110  Kluyveromyces aestuarii ATCC 18862 contig00115, 
whole genome shotgun sequence
Length=72341

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
              |||||||| |    ||||||||||| |||||||||||
Sbjct  37378  CTTCTTCCTCT---TCCTCTTCTTCTTCTTCTTCTTC  37411


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTC  476
              ||| |||||||| |||||||||||
Sbjct  32625  ATCTTCTTCTTCTTCTTCTTCTTC  32602


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTC  476
              ||| |||||||| |||||||||||
Sbjct  32628  ATCATCTTCTTCTTCTTCTTCTTC  32605


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  1    TCTTCTTCTTCTTCTTCTTCTTC  23


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  4    TCTTCTTCTTCTTCTTCTTCTTC  26


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  7    TCTTCTTCTTCTTCTTCTTCTTC  29


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  10   TCTTCTTCTTCTTCTTCTTCTTC  32


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  13   TCTTCTTCTTCTTCTTCTTCTTC  35


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  16   TCTTCTTCTTCTTCTTCTTCTTC  38


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  19   TCTTCTTCTTCTTCTTCTTCTTC  41


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  22   TCTTCTTCTTCTTCTTCTTCTTC  44


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  25   TCTTCTTCTTCTTCTTCTTCTTC  47


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  28   TCTTCTTCTTCTTCTTCTTCTTC  50


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  31   TCTTCTTCTTCTTCTTCTTCTTC  53


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  34   TCTTCTTCTTCTTCTTCTTCTTC  56


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  32621  TCTTCTTCTTCTTCTTCTTCTTC  32599


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  456    CTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||||||| |||||
Sbjct  37376  CTCTTCTTCCTCTTCCTCTTC  37396


> AEAS01000093  Kluyveromyces aestuarii ATCC 18862 contig00098, 
whole genome shotgun sequence
Length=61115

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||||||||||||||||
Sbjct  36104  TCTTCTTCTTCCTCTTCTTCTTCC  36081


> AEAS01000051  Kluyveromyces aestuarii ATCC 18862 contig00053, 
whole genome shotgun sequence
Length=130892

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             ||||||||||||||||| ||||||
Sbjct  7220  TCCTCTTCTTCCTCTTCCTCTTCC  7197


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 32/39 (83%), Gaps = 1/39 (2%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCT-CCTTC  491
               || |||||||| |||||||||||| | | || | |||||
Sbjct  124270  TCTTCTTCTTCTTCTTCTTCTTCCTCGACGGTTGCCTTC  124308


> KLAEg3293 KLAEg3293 undefined product 6935842:6936411 forward
Length=570

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTC  473
            |||||||||||||||||||||
Sbjct  540  ATCCTCTTCTTCCTCTTCTTC  520


> KLAEg2282 KLAEg2282 undefined product 4821687:4822259 forward
Length=573

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||  ||   || ||||||||||||||||||||
Sbjct  280  CTTCTTCTTCC---TCTTCTTCTTCCTCTTCTTCTTC  247


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||||||||||||||||
Sbjct  281  TCTTCTTCTTCCTCTTCTTCTTCC  258


 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457  TCTTCTTCCTCTTCTTCTTCC  477
            |||||||||||||||||||||
Sbjct  290  TCTTCTTCCTCTTCTTCTTCC  270


> KLAEg2271 KLAEg2271 undefined product 4802384:4803172 forward
Length=789

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 29/34 (86%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  443  CTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| | |  ||||||||||| |||||||||||
Sbjct  304  CTTCCTCTGTTTCCTCTTCTTCTTCTTCTTCTTC  271


> KLAEg1377 KLAEg1377 undefined product 2918005:2919279 reverse
Length=1275

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||||||||| ||||||
Sbjct  373  TCCTCTTCTTCCTCTTCCTCTTCC  396


> KLAEg980 KLAEg980 undefined product 2122928:2124976 reverse
Length=2049

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || |||||||||||||||||||||
Sbjct  1214  TCTTCTTCTTCCTCTTCTTCTTCC  1191


> KLAEg581 KLAEg581 undefined product 1256115:1257290 reverse
Length=1176

 Score = 39.2 bits (42),  Expect = 0.081
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| |    ||||||||||| |||||||||||
Sbjct  865  CTTCTTCCTCT---TCCTCTTCTTCTTCTTCTTCTTC  832


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||||||| |||||
Sbjct  867  CTCTTCTTCCTCTTCCTCTTC  847


> gi|6323989|ref|NC_001146.1| Saccharomyces cerevisiae chromosome 
XIV, complete chromosome sequence
Length=784328

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||||||||| |||||
Sbjct  55706  TCCTCTTCTTCCTCTTCGTCTTC  55728


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 27/31 (88%), Gaps = 1/31 (3%)
 Strand=Plus/Plus

Query  447    CACCG-AATCCTCTTCTTCCTCTTCTTCTTC  476
              ||||| |||| ||||| ||||||||||| ||
Sbjct  55689  CACCGTAATCATCTTCCTCCTCTTCTTCCTC  55719


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  457     TCTTCTTCCTCTTCTTCTTCCACC  480
               ||||||||||||||||| ||| ||
Sbjct  290423  TCTTCTTCCTCTTCTTCCTCCTCC  290400


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  460    TCTTCCTCTTCTTCTTCCACC  480
              |||||||||||||||||| ||
Sbjct  51605  TCTTCCTCTTCTTCTTCCTCC  51625


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  456     CTCTTCTTCCTCTTCTTCTTC  476
               ||||||||| |||||||||||
Sbjct  515981  CTCTTCTTCTTCTTCTTCTTC  516001


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  515982  TCTTCTTCTTCTTCTTCTTCTTC  516004


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  515985  TCTTCTTCTTCTTCTTCTTCTTC  516007


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 25/28 (90%), Gaps = 1/28 (3%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
               ||||| ||||| |||||||||| |||||
Sbjct  536955  TCCTCGTCTTCATCTTCTTCTT-CACCA  536981


> gi|6322016|ref|NC_001141.1| Saccharomyces cerevisiae chromosome 
IX, complete chromosome sequence
Length=439885

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  442     TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||| ||   ||||| ||||| |||||||||||
Sbjct  128712  TCTTCCTCCTCCTCCTCCTCTTCTTCTTCTTCTTC  128746


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
               |||| ||| ||   ||||||||||| |||||||||
Sbjct  128713  CTTCCTCCTCCTCCTCCTCTTCTTCTTCTTCTTCT  128747


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  460     TCTTCCTCTTCTTCTTCCACCAAGGCTC  487
               || ||||||||||| |||  ||||||||
Sbjct  416449  TCGTCCTCTTCTTCCTCCTTCAAGGCTC  416422


> gi|7276232|ref|NC_001137.2| Saccharomyces cerevisiae chromosome 
V, complete chromosome sequence
Length=576869

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTCC  477
              ||| |||||||| ||||||||||||
Sbjct  79234  ATCTTCTTCTTCTTCTTCTTCTTCC  79258


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTC  476
              ||| |||||||| |||||||||||
Sbjct  79231  ATCATCTTCTTCTTCTTCTTCTTC  79254


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||| ||| |||||||||||
Sbjct  245637  TCCTCTTTTTCTTCTTCTTCTTC  245659


> gi|7839148|ref|NC_001136.2| Saccharomyces cerevisiae chromosome 
IV, complete chromosome sequence
Length=1531929

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||||||| |||||||||||
Sbjct  801671  TCCTCTTCTTCTTCTTCTTCTTC  801693


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                ||||||||||| |||||||||||
Sbjct  1059937  TCCTCTTCTTCTTCTTCTTCTTC  1059915


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  457      TCTTCTTCCTCTTCTTCTTC  476
                ||||||||||||||||||||
Sbjct  1059943  TCTTCTTCCTCTTCTTCTTC  1059924


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 27/32 (85%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  439     GCTTCTTCCACCGAATCCTCTTCTTCCTCTTC  470
               ||||||||||||||   | |||| ||||||||
Sbjct  600862  GCTTCTTCCACCGATGTCACTTCCTCCTCTTC  600893


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  149038  TCTTCTTCTTCTTCTTCTTCTTC  149016


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  457     TCTTCTTCCTCTTCTTCTTCC  477
               || ||||||||||||||||||
Sbjct  182763  TCCTCTTCCTCTTCTTCTTCC  182783


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  801674  TCTTCTTCTTCTTCTTCTTCTTC  801696


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  801677  TCTTCTTCTTCTTCTTCTTCTTC  801699


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  801680  TCTTCTTCTTCTTCTTCTTCTTC  801702


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  801683  TCTTCTTCTTCTTCTTCTTCTTC  801705


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  801686  TCTTCTTCTTCTTCTTCTTCTTC  801708


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  801689  TCTTCTTCTTCTTCTTCTTCTTC  801711


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/25 (92%), Gaps = 1/25 (4%)
 Strand=Plus/Minus

Query  453     ATCCT-CTTCTTCCTCTTCTTCTTC  476
               ||||| ||||||| |||||||||||
Sbjct  812810  ATCCTTCTTCTTCTTCTTCTTCTTC  812786


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  457      TCTTCTTCCTCTTCTTCTTCC  477
                |||||||||||||| ||||||
Sbjct  1167487  TCTTCTTCCTCTTCATCTTCC  1167507


> KLDOg4829
Length=477

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTC  473
            ||||||||||||||||||||
Sbjct  346  TCCTCTTCTTCCTCTTCTTC  365


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 34/43 (80%), Gaps = 3/43 (6%)
 Strand=Plus/Plus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCT---TCTTCCAC  479
            |||||||| |    |||||||||||| |||||   ||||||||
Sbjct  341  CTTCTTCCTCTTCTTCCTCTTCTTCCGCTTCTGCATCTTCCAC  383


> KLDOg4613
Length=4959

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTC  473
            ||||||||||||||||||||
Sbjct  884  TCCTCTTCTTCCTCTTCTTC  865


> KLDOg4198
Length=1128

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCA  478
            || |||||||| |||||||||||||
Sbjct  377  TCGTCTTCTTCTTCTTCTTCTTCCA  353


> KLDOg3707
Length=1668

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 32/40 (80%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTCCA  493
             || || ||||||||||||||||| |  ||| || | ||||
Sbjct  1507  TCTTCCTCTTCCTCTTCTTCTTCTAGTAAGTCTTCATCCA  1546


> KLDOg3669
Length=1044

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  581  TCCTCTTCTTCTTCTTCTTCTTC  559


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||| ||||||||||||||||
Sbjct  590  TCGTCTCCTTCCTCTTCTTCTTC  568


> KLDOg2778
Length=1677

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  456   CTCTTCTTCCTCTTCTTCTT  475
             ||||||||||||||||||||
Sbjct  1020  CTCTTCTTCCTCTTCTTCTT  1001


> KLDOg1064
Length=4086

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            |||||||| |    || |||||||||||||| ||||||
Sbjct  913  CTTCTTCCTCGTCTTCTTCTTCTTCCTCTTCCTCTTCC  876


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||||||||| ||||||||
Sbjct  917  TCCTCTTCTTCCTCGTCTTCTTC  895


> KLDOg1027
Length=1014

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  905  TCCTCTTCTTCTTCTTCTTCTTC  883


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| ||||| |||||||||||
Sbjct  908  TCCTCCTCTTCTTCTTCTTCTTC  886


> KLDOg430
Length=2691

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 39/50 (78%), Gaps = 6/50 (12%)
 Strand=Plus/Minus

Query  442   TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTC  491
             |||||| ||   |||||||||   ||||||||||  |||| |||| ||||
Sbjct  2624  TCTTCCTCC---TCCTCTTCT---TCTTCTTCTTGGACCACGGCTTCTTC  2581


> KLWIg3854 KLWIg3854 undefined product 7792505:7794346 reverse
Length=1842

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||| |||||||||||||||||
Sbjct  1067  TCCTCCTCTTCCTCTTCTTCTTC  1045


> KLWIg3581 KLWIg3581 undefined product 7254822:7255235 forward
Length=414

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||||||||||||||| ||
Sbjct  413  TCCTCTTCTTCCTCTTCTTCGTC  391


> KLWIg2304 KLWIg2304 undefined product 4704623:4706095 reverse
Length=1473

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  448  ACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||| |||||||||||  |||||
Sbjct  79   ACTGAATCCTCATCTTCCTCTTCCGCTTCC  108


> KLWIg786 KLWIg786 undefined product 1639387:1642512 reverse
Length=3126

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTCC  477
             ||| || ||||||||||||||||||
Sbjct  2688  ATCATCATCTTCCTCTTCTTCTTCC  2664


> KLWIg756 KLWIg756 undefined product 1582687:1584023 forward
Length=1209

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  538  TCCTCTTCTTCTTCTTCTTCTTC  560


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  541  TCTTCTTCTTCTTCTTCTTCTTC  563


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               ||||||||||| |||||||||||
Sbjct  425368  TCCTCTTCTTCTTCTTCTTCTTC  425346


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 31/39 (80%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  439     GCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               ||||||||| |    || || ||||||||||| ||||||
Sbjct  944829  GCTTCTTCCTCTTCCTCTTCCTCTTCCTCTTCCTCTTCC  944867


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCC  477
                || |||||||| ||||||||||||
Sbjct  1327921  TCTTCTTCTTCTTCTTCTTCTTCC  1327898


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  457      TCTTCTTCCTCTTCTTCTT  475
                |||||||||||||||||||
Sbjct  1841729  TCTTCTTCCTCTTCTTCTT  1841747


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTCCACCAA  482
                || |||||||| ||||||||||| || ||
Sbjct  2352837  TCTTCTTCTTCTTCTTCTTCTTCTACTAA  2352809


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330487  TCTTCTTCTTCTTCTTCTTCTTC  330509


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330490  TCTTCTTCTTCTTCTTCTTCTTC  330512


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330493  TCTTCTTCTTCTTCTTCTTCTTC  330515


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330496  TCTTCTTCTTCTTCTTCTTCTTC  330518


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330499  TCTTCTTCTTCTTCTTCTTCTTC  330521


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330502  TCTTCTTCTTCTTCTTCTTCTTC  330524


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330505  TCTTCTTCTTCTTCTTCTTCTTC  330527


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330508  TCTTCTTCTTCTTCTTCTTCTTC  330530


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330511  TCTTCTTCTTCTTCTTCTTCTTC  330533


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330514  TCTTCTTCTTCTTCTTCTTCTTC  330536


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330517  TCTTCTTCTTCTTCTTCTTCTTC  330539


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330520  TCTTCTTCTTCTTCTTCTTCTTC  330542


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330523  TCTTCTTCTTCTTCTTCTTCTTC  330545


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330526  TCTTCTTCTTCTTCTTCTTCTTC  330548


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330529  TCTTCTTCTTCTTCTTCTTCTTC  330551


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330532  TCTTCTTCTTCTTCTTCTTCTTC  330554


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330535  TCTTCTTCTTCTTCTTCTTCTTC  330557


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330538  TCTTCTTCTTCTTCTTCTTCTTC  330560


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  330541  TCTTCTTCTTCTTCTTCTTCTTC  330563


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  425365  TCTTCTTCTTCTTCTTCTTCTTC  425343


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  451     GAATCCTCTTCTTCCTCTTCTTCTTC  476
               ||||| || ||||| |||||||||||
Sbjct  425374  GAATCTTCCTCTTCTTCTTCTTCTTC  425349


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  473578  TCTTCTTCTTCTTCTTCTTCTTC  473600


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  473581  TCTTCTTCTTCTTCTTCTTCTTC  473603


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  473584  TCTTCTTCTTCTTCTTCTTCTTC  473606


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456     CTCTTCTTCCTCTTCTTCTTC  476
               ||| |||||||||||||||||
Sbjct  646015  CTCCTCTTCCTCTTCTTCTTC  645995


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  455      CCTCTTCTTCCTCTTCTTCTTCC  477
                || ||||||||||||| ||||||
Sbjct  1372085  CCGCTTCTTCCTCTTCCTCTTCC  1372107


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  451      GAATCCTCTTCTTCCTCTTCTTCTTC  476
                || || |||||||| |||||||||||
Sbjct  1426874  GACTCTTCTTCTTCTTCTTCTTCTTC  1426899


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  459      TTCTTCCTCTTCTTCTTC  476
                ||||||||||||||||||
Sbjct  1556915  TTCTTCCTCTTCTTCTTC  1556932


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2233882  TCTTCTTCTTCTTCTTCTTCTTC  2233904


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2233885  TCTTCTTCTTCTTCTTCTTCTTC  2233907


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2233888  TCTTCTTCTTCTTCTTCTTCTTC  2233910


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2233891  TCTTCTTCTTCTTCTTCTTCTTC  2233913


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2233894  TCTTCTTCTTCTTCTTCTTCTTC  2233916


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  460      TCTTCCTCTTCTTCTTCC  477
                ||||||||||||||||||
Sbjct  2268683  TCTTCCTCTTCTTCTTCC  2268666


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454      TCCTCTTCTTCCTCTTCTTCTTC  476
                || |||||||| |||||||||||
Sbjct  2352840  TCTTCTTCTTCTTCTTCTTCTTC  2352818


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  457      TCTTCTTCCTCTTCTTCTTCC  477
                |||||||| ||||||||||||
Sbjct  2594731  TCTTCTTCTTCTTCTTCTTCC  2594751


> KLLA0F04433g KLLA0F04433g undefined product 8511386:8512627 reverse
Length=1242

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  301  TCCTCTTCTTCTTCTTCTTCTTC  323


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  451  GAATCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| || ||||| |||||||||||
Sbjct  295  GAATCTTCCTCTTCTTCTTCTTCTTC  320


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  304  TCTTCTTCTTCTTCTTCTTCTTC  326


> KLLA0E22969g KLLA0E22969g undefined product 7897210:7899666 reverse
Length=2457

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTC  473
             ||||||||||||||||||||
Sbjct  1913  TCCTCTTCTTCCTCTTCTTC  1894


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             ||||||||||| || |||||||||
Sbjct  1925  TCCTCTTCTTCTTCCTCTTCTTCC  1902


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || || ||||||||||||||||||
Sbjct  1934  TCTTCATCTTCCTCTTCTTCTTCC  1911


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || ||||||||||||||||| ||
Sbjct  1922  TCTTCTTCTTCCTCTTCTTCCTC  1900


> KLLA0E15049g KLLA0E15049g undefined product 7196130:7197383 reverse
Length=1254

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTC  473
             ||||||||||||||||||||
Sbjct  1193  TCCTCTTCTTCCTCTTCTTC  1174


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 28/34 (83%), Gaps = 3/34 (8%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
            |||||||| |    ||||||||||| ||||||||
Sbjct  259  CTTCTTCCTCT---TCCTCTTCTTCTTCTTCTTC  229


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| || |||||||||||
Sbjct  254  TCCTCTTCCTCTTCTTCTTCTTC  232


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 32/41 (79%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  436  AAGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||  |    || || |||||||||||||||||
Sbjct  275  AAAGCTTCTTCATCGCCTTCTTCCTCTTCCTCTTCTTCTTC  235


> KLLA0D07216g KLLA0D07216g undefined product 4751831:4755667 forward
Length=3837

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
            || |||||||| |||||||||||| |||
Sbjct  592  TCTTCTTCTTCTTCTTCTTCTTCCTCCA  619


> KLLA0C04103g KLLA0C04103g undefined product 2756177:2757871 reverse
Length=1695

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  800  TCCTCTTCTTCTTCTTCTTCTTC  778


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  458   CTTCTTCCTCTTCTTCTTC  476
             |||||||||||||||||||
Sbjct  1069  CTTCTTCCTCTTCTTCTTC  1051


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| ||||| |||||||||||
Sbjct  803  TCCTCCTCTTCTTCTTCTTCTTC  781


> KLLA0B07491g KLLA0B07491g undefined product 1711837:1713936 reverse
Length=2100

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  444  TTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||   || |||||||| |||||||||||
Sbjct  78   TTCCACCCGTTCGTCTTCTTCTTCTTCTTCTTC  110


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  91   TCTTCTTCTTCTTCTTCTTCTTC  113


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  94   TCTTCTTCTTCTTCTTCTTCTTC  116


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  97   TCTTCTTCTTCTTCTTCTTCTTC  119


> AEAS01000324  Kluyveromyces aestuarii ATCC 18862 contig00661, 
whole genome shotgun sequence
Length=33218

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 41/54 (76%), Gaps = 3/54 (5%)
 Strand=Plus/Plus

Query  427   TCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTT---CTTCCTCTTCTTCTTCC  477
             |||||||  | | ||||||||||     ||||||   |||||||||| ||||||
Sbjct  2504  TCTTCTAAGACGCCTTCTTCCACTCTCCCCTCTTTCTCTTCCTCTTCCTCTTCC  2557


> AEAS01000322  Kluyveromyces aestuarii ATCC 18862 contig00658, 
whole genome shotgun sequence
Length=103820

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  457    TCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTC  491
              |||||||| |||||||||||| | ||  ||| |||
Sbjct  77537  TCTTCTTCTTCTTCTTCTTCCTCGAATTCTCTTTC  77503


> AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, 
whole genome shotgun sequence
Length=151927

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
              ||||||||||| |||||||| ||| |||
Sbjct  22255  TCCTCTTCTTCTTCTTCTTCCTCCTCCA  22228


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTC  476
              ||| |||||||| |||||||||||
Sbjct  22556  ATCTTCTTCTTCATCTTCTTCTTC  22533


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              |||||||| || |||||||||||
Sbjct  22261  TCCTCTTCCTCTTCTTCTTCTTC  22239


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || || |||||||||||||||||
Sbjct  22264  TCTTCCTCTTCCTCTTCTTCTTC  22242


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  22525  TCTTCTTCTTCATCTTCTTCTTC  22503


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  22540  TCTTCTTCTTCATCTTCTTCTTC  22518


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || ||||||||||||||||| ||
Sbjct  22588  TCTTCTTCTTCCTCTTCTTCATC  22566


> AEAS01000251  Kluyveromyces aestuarii ATCC 18862 contig00552, 
whole genome shotgun sequence
Length=8438

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  455   CCTCTTCTTCCTCTTCTTCTTCC  477
             |||||||||| ||||||||||||
Sbjct  1602  CCTCTTCTTCTTCTTCTTCTTCC  1624


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  458   CTTCTTCCTCTTCTTCTTC  476
             |||||||||||||||||||
Sbjct  1572  CTTCTTCCTCTTCTTCTTC  1590


> AEAS01000137  Kluyveromyces aestuarii ATCC 18862 contig00143, 
whole genome shotgun sequence
Length=78594

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||| |||||||||||
Sbjct  13209  TCCTCTTCTTCTTCTTCTTCTTC  13231


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||| ||||||||||||
Sbjct  13218  TCTTCTTCTTCTTCTTCTTCTTCC  13241


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||| || ||||||||||||||
Sbjct  13200  TCCTCCTCCTCCTCTTCTTCTTC  13222


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||| ||||| |||||||||||
Sbjct  13206  TCCTCCTCTTCTTCTTCTTCTTC  13228


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  13212  TCTTCTTCTTCTTCTTCTTCTTC  13234


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  13215  TCTTCTTCTTCTTCTTCTTCTTC  13237


> AEAS01000136  Kluyveromyces aestuarii ATCC 18862 contig00142, 
whole genome shotgun sequence
Length=38619

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
              || |||||||| ||||||||||||| ||
Sbjct  26229  TCTTCTTCTTCTTCTTCTTCTTCCATCA  26256


 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              |||||||||||||||||||| ||
Sbjct  38595  TCCTCTTCTTCCTCTTCTTCCTC  38617


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  455    CCTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||||||||||| ||
Sbjct  38587  CCTCTTCTTCCTCTTCTTCCTC  38608


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  456    CTCTTCTTCCTCTTCTTCTTC  476
              ||||||||| |||||||||||
Sbjct  26219  CTCTTCTTCTTCTTCTTCTTC  26239


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26220  TCTTCTTCTTCTTCTTCTTCTTC  26242


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26223  TCTTCTTCTTCTTCTTCTTCTTC  26245


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26226  TCTTCTTCTTCTTCTTCTTCTTC  26248


> AEAS01000092  Kluyveromyces aestuarii ATCC 18862 contig00097, 
whole genome shotgun sequence
Length=15894

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||||||||| |||||||||||
Sbjct  2574  TCCTCTTCTTCTTCTTCTTCTTC  2552


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2559  TCTTCTTCTTCTTCTTCTTCTTC  2537


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2562  TCTTCTTCTTCTTCTTCTTCTTC  2540


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2565  TCTTCTTCTTCTTCTTCTTCTTC  2543


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2568  TCTTCTTCTTCTTCTTCTTCTTC  2546


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2571  TCTTCTTCTTCTTCTTCTTCTTC  2549


> AEAS01000018  Kluyveromyces aestuarii ATCC 18862 contig00020, 
whole genome shotgun sequence
Length=17326

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  661  TCCTCTTCTTCTTCTTCTTCTTC  639


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  643  TCTTCTTCTTCTTCTTCTTCTTC  621


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  646  TCTTCTTCTTCTTCTTCTTCTTC  624


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  649  TCTTCTTCTTCTTCTTCTTCTTC  627


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  652  TCTTCTTCTTCTTCTTCTTCTTC  630


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  655  TCTTCTTCTTCTTCTTCTTCTTC  633


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  658  TCTTCTTCTTCTTCTTCTTCTTC  636


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || || |||||||||||||||||
Sbjct  670  TCTTCGTCTTCCTCTTCTTCTTC  648


> KLAEg4046 KLAEg4046 undefined product 8580590:8582968 forward
Length=2379

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  176  TCCTCTTCTTCTTCTTCTTCTTC  154


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  161  TCTTCTTCTTCTTCTTCTTCTTC  139


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  164  TCTTCTTCTTCTTCTTCTTCTTC  142


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  167  TCTTCTTCTTCTTCTTCTTCTTC  145


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  170  TCTTCTTCTTCTTCTTCTTCTTC  148


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  173  TCTTCTTCTTCTTCTTCTTCTTC  151


> KLAEg3658 KLAEg3658 undefined product 7715783:7717285 forward
Length=1503

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  455  CCTCTTCTTCCTCTTCTTCTTCC  477
            |||||||||| ||||||||||||
Sbjct  391  CCTCTTCTTCTTCTTCTTCTTCC  369


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  458  CTTCTTCCTCTTCTTCTTC  476
            |||||||||||||||||||
Sbjct  421  CTTCTTCCTCTTCTTCTTC  403


> KLAEg2758 KLAEg2758 undefined product 5823454:5826465 reverse
Length=3012

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| |||||||||||
Sbjct  413  TCCTCTTCTTCTTCTTCTTCTTC  391


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  395  TCTTCTTCTTCTTCTTCTTCTTC  373


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  398  TCTTCTTCTTCTTCTTCTTCTTC  376


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  401  TCTTCTTCTTCTTCTTCTTCTTC  379


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  404  TCTTCTTCTTCTTCTTCTTCTTC  382


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  407  TCTTCTTCTTCTTCTTCTTCTTC  385


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  410  TCTTCTTCTTCTTCTTCTTCTTC  388


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || || |||||||||||||||||
Sbjct  422  TCTTCGTCTTCCTCTTCTTCTTC  400


> KLAEg2604 KLAEg2604 undefined product 5510989:5513343 forward
Length=2355

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  457   TCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTC  491
             |||||||| |||||||||||| | ||  ||| |||
Sbjct  1625  TCTTCTTCTTCTTCTTCTTCCTCGAATTCTCTTTC  1591


> KLAEg2348 KLAEg2348 undefined product 4958927:4960270 forward
Length=1344

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||||||||| |||||||||||
Sbjct  1112  TCCTCTTCTTCTTCTTCTTCTTC  1090


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || |||||||| ||||||||||||
Sbjct  1103  TCTTCTTCTTCTTCTTCTTCTTCC  1080


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1106  TCTTCTTCTTCTTCTTCTTCTTC  1084


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1109  TCTTCTTCTTCTTCTTCTTCTTC  1087


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||| ||||| |||||||||||
Sbjct  1115  TCCTCCTCTTCTTCTTCTTCTTC  1093


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||| || ||||||||||||||
Sbjct  1121  TCCTCCTCCTCCTCTTCTTCTTC  1099


> KLAEg2278 KLAEg2278 undefined product 4813758:4816394 forward
Length=2637

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTC  473
             ||||||||||||||||||||
Sbjct  2558  TCCTCTTCTTCCTCTTCTTC  2539


> KLAEg2130.t2 KLAEg2130.t2 undefined product 4499119:4502412 reverse
Length=2952

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
             ||||||||||| |||||||| ||| |||
Sbjct  2204  TCCTCTTCTTCTTCTTCTTCCTCCTCCA  2177


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  2505  ATCTTCTTCTTCATCTTCTTCTTC  2482


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             |||||||| || |||||||||||
Sbjct  2210  TCCTCTTCCTCTTCTTCTTCTTC  2188


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || || |||||||||||||||||
Sbjct  2213  TCTTCCTCTTCCTCTTCTTCTTC  2191


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2474  TCTTCTTCTTCATCTTCTTCTTC  2452


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2489  TCTTCTTCTTCATCTTCTTCTTC  2467


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || ||||||||||||||||| ||
Sbjct  2537  TCTTCTTCTTCCTCTTCTTCATC  2515


> KLAEg2130.t1 KLAEg2130.t1 undefined product 4499119:4502412 reverse
Length=2901

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
             ||||||||||| |||||||| ||| |||
Sbjct  2153  TCCTCTTCTTCTTCTTCTTCCTCCTCCA  2126


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  2454  ATCTTCTTCTTCATCTTCTTCTTC  2431


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             |||||||| || |||||||||||
Sbjct  2159  TCCTCTTCCTCTTCTTCTTCTTC  2137


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || || |||||||||||||||||
Sbjct  2162  TCTTCCTCTTCCTCTTCTTCTTC  2140


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2423  TCTTCTTCTTCATCTTCTTCTTC  2401


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2438  TCTTCTTCTTCATCTTCTTCTTC  2416


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || ||||||||||||||||| ||
Sbjct  2486  TCTTCTTCTTCCTCTTCTTCATC  2464


> KLAEg1598 KLAEg1598 undefined product 3370331:3371875 reverse
Length=1545

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 41/54 (76%), Gaps = 3/54 (5%)
 Strand=Plus/Minus

Query  427   TCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTT---CTTCCTCTTCTTCTTCC  477
             |||||||  | | ||||||||||     ||||||   |||||||||| ||||||
Sbjct  1091  TCTTCTAAGACGCCTTCTTCCACTCTCCCCTCTTTCTCTTCCTCTTCCTCTTCC  1038


> KLAEg692 KLAEg692 undefined product 1520720:1521676 forward
Length=957

 Score = 37.4 bits (40),  Expect = 0.28
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
            || |||||||| ||||||||||||| ||
Sbjct  188  TCTTCTTCTTCTTCTTCTTCTTCCATCA  161


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  191  TCTTCTTCTTCTTCTTCTTCTTC  169


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  194  TCTTCTTCTTCTTCTTCTTCTTC  172


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  197  TCTTCTTCTTCTTCTTCTTCTTC  175


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||| |||||||||||
Sbjct  198  CTCTTCTTCTTCTTCTTCTTC  178


> gi|6323501|ref|NC_001145.1| Saccharomyces cerevisiae chromosome 
XIII, complete chromosome sequence
Length=924430

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || |||||||| ||||||||||||
Sbjct  143081  TCTTCTTCTTCGTCTTCTTCTTCC  143058


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453     ATCCTCTTCTTCCTCTTCTTCTTC  476
               ||| |||||||| |||||||||||
Sbjct  175909  ATCGTCTTCTTCTTCTTCTTCTTC  175932


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || |||||||| ||||||||||||
Sbjct  175913  TCTTCTTCTTCTTCTTCTTCTTCC  175936


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  425     CATCTTCTAGCAAGGCTTCTTC  446
               ||| ||||||||||||||||||
Sbjct  496632  CATTTTCTAGCAAGGCTTCTTC  496653


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 31/38 (82%), Gaps = 3/38 (7%)
 Strand=Plus/Plus

Query  440     CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
               |||| |||||   ||||||||   ||||||||||||||
Sbjct  722782  CTTCGTCCACTTCATCCTCTT---CCTCTTCTTCTTCC  722816


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTCC  477
               || || ||||||||||||||||||
Sbjct  722811  TCTTCCTCTTCCTCTTCTTCTTCC  722834


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  456    CTCTTCTTCCTCTTCTTCTTC  476
              |||||||||||||| ||||||
Sbjct  78677  CTCTTCTTCCTCTTTTTCTTC  78697


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 33/40 (83%), Gaps = 2/40 (5%)
 Strand=Plus/Plus

Query  440     CTTCTTCCAC-CGAATCCTCTTCTTCCTCTTCTTCTTCCA  478
               ||||||| |  |||| | |||||||||||||| || ||||
Sbjct  120670  CTTCTTCAATACGAA-CTTCTTCTTCCTCTTCGTCATCCA  120708


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  459     TTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTC  491
               || |||||||||||||||| |  ||| | ||||
Sbjct  121061  TTTTTCCTCTTCTTCTTCCTCAGAGGATTCTTC  121093


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||||||||| |||||
Sbjct  722805  TCTTCTTCTTCCTCTTCCTCTTC  722827


> gi|6321039|ref|NC_001138.1| Saccharomyces cerevisiae chromosome 
VI, complete chromosome sequence
Length=270148

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  450     CGAATCCTCTTCTTCCTCTTCTTCTTC  476
               |||||  |||||||| |||||||||||
Sbjct  179298  CGAATTTTCTTCTTCTTCTTCTTCTTC  179324


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  179305  TCTTCTTCTTCTTCTTCTTCTTC  179327


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  179308  TCTTCTTCTTCTTCTTCTTCTTC  179330


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  179311  TCTTCTTCTTCTTCTTCTTCTTC  179333


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               |||||||||||||| ||||| ||
Sbjct  224542  TCCTCTTCTTCCTCATCTTCGTC  224564


> KLDOg4752
Length=669

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||||||||||||| || ||
Sbjct  342  ATCCTCTTCTTCCTCTTCGTCGTC  319


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| || ||||||||
Sbjct  314  TCCTCTTCTTCGTCGTCTTCTTC  292


> KLDOg3622
Length=789

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||| ||||||||||||
Sbjct  560  TCTTCTTCTTCTTCTTCTTCTTCC  537


> KLDOg3374
Length=2481

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  455   CCTCTTCTTCCTCTTCTTCTTC  476
             |||||||||| |||||||||||
Sbjct  1888  CCTCTTCTTCTTCTTCTTCTTC  1867


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1880  TCTTCTTCTTCTTCTTCTTCTTC  1858


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1883  TCTTCTTCTTCTTCTTCTTCTTC  1861


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1886  TCTTCTTCTTCTTCTTCTTCTTC  1864


> KLDOg3008
Length=1242

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 28/34 (83%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  443  CTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            ||||  |||  || |||||||| |||||||||||
Sbjct  535  CTTCGCCCGTTTCTTCTTCTTCTTCTTCTTCTTC  502


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  518  TCTTCTTCTTCTTCTTCTTCTTC  496


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  521  TCTTCTTCTTCTTCTTCTTCTTC  499


> KLDOg2810
Length=1209

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || || ||||||||||||||||||
Sbjct  797  TCTTCATCTTCCTCTTCTTCTTCC  774


> KLDOg2571
Length=1161

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||| |||||||||||| ||||
Sbjct  594  ATCCTCATCTTCCTCTTCTACTTC  571


> KLDOg2254
Length=369

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTCCAC  479
            |||||||||||| || |||||||| ||
Sbjct  105  ATCCTCTTCTTCTTCATCTTCTTCGAC  79


> KLDOg1586
Length=3825

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACC  480
             || |||||||| |||||||||||| ||
Sbjct  1697  TCGTCTTCTTCTTCTTCTTCTTCCTCC  1671


> KLDOg1356
Length=459

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            ||| |||||||| |||||||||||
Sbjct  459  ATCTTCTTCTTCGTCTTCTTCTTC  436


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  446  TCTTCTTCTTCTTCTTCTTCTTC  424


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  449  TCGTCTTCTTCTTCTTCTTCTTC  427


> KLDOg596
Length=3237

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  1242  ATCTTCTTCTTCTTCTTCTTCTTC  1219


> KLDOg542
Length=1281

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||| ||||||||||||
Sbjct  794  TCTTCTTCTTCTTCTTCTTCTTCC  771


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||||||||| |||||
Sbjct  782  TCTTCTTCTTCCTCTTCCTCTTC  760


> KLDOg162
Length=1248

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  455  CCTCTTCTTCCTCTTCTTCTTC  476
            |||||||||| |||||||||||
Sbjct  439  CCTCTTCTTCTTCTTCTTCTTC  418


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  431  TCTTCTTCTTCTTCTTCTTCTTC  409


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  434  TCTTCTTCTTCTTCTTCTTCTTC  412


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  437  TCTTCTTCTTCTTCTTCTTCTTC  415


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457  TCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||||| |||||||
Sbjct  491  TCTTCTTCCTCTTTTTCTTCC  471


> KLWIg2468 KLWIg2468 undefined product 5030457:5031887 forward
Length=1431

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  1158  ATCTTCTTCTTCTTCTTCTTCTTC  1135


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  1161  ATCATCTTCTTCTTCTTCTTCTTC  1138


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1124  TCTTCTTCTTCTTCTTCTTCTTC  1102


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1127  TCTTCTTCTTCTTCTTCTTCTTC  1105


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1130  TCTTCTTCTTCTTCTTCTTCTTC  1108


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1133  TCTTCTTCTTCTTCTTCTTCTTC  1111


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1136  TCTTCTTCTTCTTCTTCTTCTTC  1114


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1139  TCTTCTTCTTCTTCTTCTTCTTC  1117


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1142  TCTTCTTCTTCTTCTTCTTCTTC  1120


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1145  TCTTCTTCTTCTTCTTCTTCTTC  1123


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1148  TCTTCTTCTTCTTCTTCTTCTTC  1126


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1151  TCTTCTTCTTCTTCTTCTTCTTC  1129


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1154  TCTTCTTCTTCTTCTTCTTCTTC  1132


> KLWIg2431 KLWIg2431 undefined product 4962276:4964168 forward
Length=1893

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  457   TCTTCTTCCTCTTCTTCTT  475
             |||||||||||||||||||
Sbjct  1820  TCTTCTTCCTCTTCTTCTT  1802


> KLWIg2429 KLWIg2429 undefined product 4959719:4960623 forward
Length=735

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 26/29 (90%), Gaps = 1/29 (3%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC-CACCA  481
            || |||||||| ||||||||||| |||||
Sbjct  703  TCTTCTTCTTCTTCTTCTTCTTCTCACCA  675


> KLWIg1789 KLWIg1789 undefined product 3684083:3686017 reverse
Length=1935

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             |||| |||||    | ||||||||| |||||||||||
Sbjct  1654  CTTCCTCCACTTCTTGCTCTTCTTCTTCTTCTTCTTC  1618


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1631  TCTTCTTCTTCTTCTTCTTCTTC  1609


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1634  TCTTCTTCTTCTTCTTCTTCTTC  1612


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1637  TCTTCTTCTTCTTCTTCTTCTTC  1615


> KLWIg1653 KLWIg1653 undefined product 3359668:3361461 forward
Length=1794

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  459   TTCTTCCTCTTCTTCTTCC  477
             |||||||||||||||||||
Sbjct  1056  TTCTTCCTCTTCTTCTTCC  1038


> KLWIg1610 KLWIg1610 undefined product 3268818:3270836 reverse
Length=2019

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || |||||||| ||||||||||||
Sbjct  1583  TCTTCTTCTTCTTCTTCTTCTTCC  1560


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1586  TCTTCTTCTTCTTCTTCTTCTTC  1564


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456   CTCTTCTTCCTCTTCTTCTTC  476
             ||||||||| |||||||||||
Sbjct  1587  CTCTTCTTCTTCTTCTTCTTC  1567


> KLWIg1560 KLWIg1560 undefined product 3168194:3172582 forward
Length=4389

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  451   GAATCCTCTTCTTCCTCTT  469
             |||||||||||||||||||
Sbjct  2408  GAATCCTCTTCTTCCTCTT  2390


> KLWIg963 KLWIg963 undefined product 1974256:1978641 forward
Length=4386

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 29/35 (83%), Gaps = 3/35 (8%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
            |||||||| ||   || || |||||||||||||||
Sbjct  244  CTTCTTCCTCC---TCTTCCTCTTCCTCTTCTTCT  213


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| ||||||||||| |||||
Sbjct  239  TCCTCCTCTTCCTCTTCCTCTTC  217


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  451  GAATCCTCTTCTTCCTCTTCTTCTTC  476
            ||| ||||||||||||| ||||| ||
Sbjct  251  GAAACCTCTTCTTCCTCCTCTTCCTC  226


> KLWIg789 KLWIg789 undefined product 1646434:1648663 reverse
Length=2142

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTCCAC  479
             ||| |||||||| ||||||||||| ||
Sbjct  1902  ATCATCTTCTTCTTCTTCTTCTTCGAC  1876


> KLWIg527 KLWIg527 undefined product 1116982:1118943 reverse
Length=1962

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 28/34 (83%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
             |||||||| |    ||| ||||||||||||||||
Sbjct  1279  CTTCTTCCCCTTCTTCCCCTTCTTCCTCTTCTTC  1246


> KLLA0F19888g KLLA0F19888g undefined product 9926641:9941388 reverse
Length=14748

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  457    TCTTCTTCCTCTTCTTCTT  475
              |||||||||||||||||||
Sbjct  12701  TCTTCTTCCTCTTCTTCTT  12683


> KLLA0F10175g KLLA0F10175g undefined product 9031460:9033190 reverse
Length=1731

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 31/39 (80%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  439   GCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCC  477
             ||||||||| |    || || ||||||||||| ||||||
Sbjct  1403  GCTTCTTCCTCTTCCTCTTCCTCTTCCTCTTCCTCTTCC  1365


> KLLA0E12519g KLLA0E12519g undefined product 6960735:6963755 reverse
Length=3021

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTCCAC  479
            ||||||||| ||||||||||| ||
Sbjct  435  CTCTTCTTCTTCTTCTTCTTCAAC  412


> KLLA0D15631g KLLA0D15631g undefined product 5456566:5460078 forward
Length=3513

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  460   TCTTCCTCTTCTTCTTCCA  478
             |||||||||||||||||||
Sbjct  3403  TCTTCCTCTTCTTCTTCCA  3421


> KLLA0D15268g KLLA0D15268g undefined product 5434536:5436353 forward
Length=1818

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  452   AATCCTCTTCTTCCTCTTCTTC  473
             |||||| |||||||||||||||
Sbjct  1663  AATCCTTTTCTTCCTCTTCTTC  1642


> KLLA0C14047g KLLA0C14047g undefined product 3591797:3592933 reverse
Length=1137

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  451  GAATCCTCTTCTTCCTCTTCTTCTTCCAC  479
            |||||  |||||||  |||||||||||||
Sbjct  292  GAATCTACTTCTTCTACTTCTTCTTCCAC  320


> KLLA0C09394g KLLA0C09394g undefined product 3201349:3204903 forward
Length=3555

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 43/56 (77%), Gaps = 6/56 (10%)
 Strand=Plus/Plus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTCCAGTGAAGAATCCTCTTC  509
             || |||||||| |||||||||||  |  ||  || ||  ||||||||| | |||||
Sbjct  1837  TCGTCTTCTTCTTCTTCTTCTTCTGC--AG--TCGTT--AGTGAAGAACCATCTTC  1886


> KLLA0C05016g KLLA0C05016g undefined product 2839472:2839951 reverse
Length=480

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  453  ATCCTCTTCTTCCTCTTCTTCT  474
            ||||||||||||||| ||||||
Sbjct  354  ATCCTCTTCTTCCTCCTCTTCT  375


> KLLA0C04928g KLLA0C04928g undefined product 2833244:2833768 forward
Length=525

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  485  CTCCTTCCAGTGAAGAATCCTCTTCCACT  513
            || |||| | ||||||||||||||| |||
Sbjct  290  CTACTTCTACTGAAGAATCCTCTTCTACT  318


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  485  CTCCTTCCAGTGAAGAATCCTCTTCCACT  513
            || |||||  ||||||||||||||| |||
Sbjct  338  CTTCTTCCGCTGAAGAATCCTCTTCTACT  366


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  488  CTTCCAGTGAAGAATCCTCTTCCACT  513
            |||| | ||||||||||||||| |||
Sbjct  248  CTTCTACTGAAGAATCCTCTTCTACT  273


> KLLA0A00737g KLLA0A00737g undefined product 72233:73981 forward
Length=1749

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||| ||||||||||||
Sbjct  251  TCTTCTTCTTCTTCTTCTTCTTCC  228


> AEAS01000318  Kluyveromyces aestuarii ATCC 18862 contig00650, 
whole genome shotgun sequence
Length=22783

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            ||| |||||||| |||||||||||
Sbjct  38   ATCTTCTTCTTCTTCTTCTTCTTC  15


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  25   TCTTCTTCTTCTTCTTCTTCTTC  3


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  28   TCTTCTTCTTCTTCTTCTTCTTC  6


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  31   TCTTCTTCTTCTTCTTCTTCTTC  9


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  34   TCTTCTTCTTCTTCTTCTTCTTC  12


> AEAS01000285  Kluyveromyces aestuarii ATCC 18862 contig00611, 
whole genome shotgun sequence
Length=21617

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             ||||| ||||||||||| ||||||
Sbjct  3280  TCCTCCTCTTCCTCTTCCTCTTCC  3257


> AEAS01000234  Kluyveromyces aestuarii ATCC 18862 contig00534, 
whole genome shotgun sequence
Length=70289

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || ||||||||||| |||||||||
Sbjct  51683  TCATCTTCTTCCTCATCTTCTTCC  51706


> AEAS01000208  Kluyveromyces aestuarii ATCC 18862 contig00227, 
whole genome shotgun sequence
Length=28736

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||| ||||||||||||
Sbjct  26341  TCTTCTTCTTCTTCTTCTTCTTCC  26318


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26344  TCTTCTTCTTCTTCTTCTTCTTC  26322


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26347  TCTTCTTCTTCTTCTTCTTCTTC  26325


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26350  TCTTCTTCTTCTTCTTCTTCTTC  26328


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26353  TCTTCTTCTTCTTCTTCTTCTTC  26331


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  26356  TCGTCTTCTTCTTCTTCTTCTTC  26334


> AEAS01000182  Kluyveromyces aestuarii ATCC 18862 contig00195, 
whole genome shotgun sequence
Length=12696

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 36/46 (79%), Gaps = 2/46 (4%)
 Strand=Plus/Minus

Query  440   CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTT--CCACCAAG  483
             |||||||| |    || || ||||| ||||||||||  ||||||||
Sbjct  3357  CTTCTTCCTCGTCTTCATCGTCTTCTTCTTCTTCTTCACCACCAAG  3312


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457   TCTTCTTCCTCTTCTTCTTCC  477
             |||||||| ||||||||||||
Sbjct  3370  TCTTCTTCTTCTTCTTCTTCC  3350


> AEAS01000145  Kluyveromyces aestuarii ATCC 18862 contig00154, 
whole genome shotgun sequence
Length=39160

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              || |||||||| ||||||||||||
Sbjct  34393  TCTTCTTCTTCGTCTTCTTCTTCC  34416


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  453    ATCCTCTTCTTCCTCTTCTTC  473
              ||||||||||||||| |||||
Sbjct  19316  ATCCTCTTCTTCCTCATCTTC  19336


> AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, 
whole genome shotgun sequence
Length=148475

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTCC  477
              ||||||||||| |||||||| |||
Sbjct  96008  TCCTCTTCTTCATCTTCTTCCTCC  95985


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || ||||||||||| ||||||||
Sbjct  96080  TCGTCTTCTTCCTCGTCTTCTTC  96058


> AEAS01000081  Kluyveromyces aestuarii ATCC 18862 contig00085, 
whole genome shotgun sequence
Length=21186

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTC  476
              || ||||||||| |||||||||||
Sbjct  15362  ATTCTCTTCTTCTTCTTCTTCTTC  15385


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  15366  TCTTCTTCTTCTTCTTCTTCTTC  15388


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  15369  TCTTCTTCTTCTTCTTCTTCTTC  15391


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  15372  TCTTCTTCTTCTTCTTCTTCTTC  15394


> AEAS01000080  Kluyveromyces aestuarii ATCC 18862 contig00084, 
whole genome shotgun sequence
Length=84524

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTC  476
              ||| |||||||| |||||||||||
Sbjct  79354  ATCATCTTCTTCTTCTTCTTCTTC  79331


> AEAS01000061  Kluyveromyces aestuarii ATCC 18862 contig00065, 
whole genome shotgun sequence
Length=34095

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  453    ATCCTCTTCTTCCTCTTCTTCT  474
              |||||||||||| |||||||||
Sbjct  30149  ATCCTCTTCTTCTTCTTCTTCT  30128


> AEAS01000032  Kluyveromyces aestuarii ATCC 18862 contig00034, 
whole genome shotgun sequence
Length=106698

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  457    TCTTCTTCCTCTTCTTCTTCCACC  480
              ||||| |||||||||||||| |||
Sbjct  36677  TCTTCATCCTCTTCTTCTTCTACC  36700


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  457    TCTTCTTCCTCTTCTTCTTCC  477
              || ||||||||||||||||||
Sbjct  14535  TCATCTTCCTCTTCTTCTTCC  14555


> AEAS01000031  Kluyveromyces aestuarii ATCC 18862 contig00033, 
whole genome shotgun sequence
Length=124751

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 28/34 (83%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  441    TTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
              ||||||  | || ||  |||||||||||||||||
Sbjct  81875  TTCTTCTCCAGATTCTACTTCTTCCTCTTCTTCT  81908


> KLAEg4525 KLAEg4525 undefined product 9630420:9631691 forward
Length=1272

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || |||||||| ||||||||||||
Sbjct  1052  TCTTCTTCTTCTTCTTCTTCTTCC  1029


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1055  TCTTCTTCTTCTTCTTCTTCTTC  1033


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1058  TCTTCTTCTTCTTCTTCTTCTTC  1036


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1061  TCTTCTTCTTCTTCTTCTTCTTC  1039


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1064  TCTTCTTCTTCTTCTTCTTCTTC  1042


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1067  TCGTCTTCTTCTTCTTCTTCTTC  1045


> KLAEg4306 KLAEg4306 undefined product 9177855:9179654 forward
Length=1800

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCT  474
             |||||||||||| |||||||||
Sbjct  1020  ATCCTCTTCTTCTTCTTCTTCT  999


> KLAEg4071.t2 KLAEg4071.t2 undefined product 8627381:8627860 forward
Length=480

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            ||| |||||||| |||||||||||
Sbjct  300  ATCATCTTCTTCTTCTTCTTCTTC  323


> KLAEg4071.t1 KLAEg4071.t1 undefined product 8627366:8627860 forward
Length=495

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            ||| |||||||| |||||||||||
Sbjct  315  ATCATCTTCTTCTTCTTCTTCTTC  338


> KLAEg3468 KLAEg3468 undefined product 7300506:7302302 forward
Length=1797

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            || |||||||| ||||||||||||
Sbjct  932  TCTTCTTCTTCGTCTTCTTCTTCC  909


> KLAEg3017 KLAEg3017 undefined product 6344266:6345810 reverse
Length=1545

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 28/34 (83%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  441   TTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCT  474
             ||||||  | || ||  |||||||||||||||||
Sbjct  1395  TTCTTCTCCAGATTCTACTTCTTCCTCTTCTTCT  1362


> KLAEg2939 KLAEg2939 undefined product 6192501:6193079 reverse
Length=579

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  457  TCTTCTTCCTCTTCTTCTTCCACC  480
            ||||| |||||||||||||| |||
Sbjct  560  TCTTCATCCTCTTCTTCTTCTACC  537


> KLAEg2551 KLAEg2551 undefined product 5416414:5417724 forward
Length=1311

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||| ||||||||||| ||||||
Sbjct  326  TCCTCCTCTTCCTCTTCCTCTTCC  303


> KLAEg1883 KLAEg1883 undefined product 4023098:4025677 forward
Length=2580

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCC  477
             || ||||||||||| |||||||||
Sbjct  2051  TCATCTTCTTCCTCATCTTCTTCC  2028


> KLAEg1699.t1 KLAEg1699.t1 undefined product 3621657:3625428 reverse
Length=3342

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||| |||||||||||
Sbjct  867  ATTCTCTTCTTCTTCTTCTTCTTC  844


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  857  TCTTCTTCTTCTTCTTCTTCTTC  835


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  860  TCTTCTTCTTCTTCTTCTTCTTC  838


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  863  TCTTCTTCTTCTTCTTCTTCTTC  841


> KLAEg1699.t2 KLAEg1699.t2 undefined product 3621657:3625338 reverse
Length=3252

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||| |||||||||||
Sbjct  777  ATTCTCTTCTTCTTCTTCTTCTTC  754


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  767  TCTTCTTCTTCTTCTTCTTCTTC  745


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  770  TCTTCTTCTTCTTCTTCTTCTTC  748


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  773  TCTTCTTCTTCTTCTTCTTCTTC  751


> KLAEg1441 KLAEg1441 undefined product 3034324:3036138 reverse
Length=1815

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 32/39 (83%), Gaps = 1/39 (2%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCT-CCTTC  491
            || |||||||| |||||||||||| | | || | |||||
Sbjct  182  TCTTCTTCTTCTTCTTCTTCTTCCTCGACGGTTGCCTTC  144


> KLAEg960 KLAEg960 undefined product 2063400:2067530 forward
Length=4131

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 36/46 (79%), Gaps = 2/46 (4%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTT--CCACCAAG  483
            |||||||| |    || || ||||| ||||||||||  ||||||||
Sbjct  883  CTTCTTCCTCGTCTTCATCGTCTTCTTCTTCTTCTTCACCACCAAG  838


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457  TCTTCTTCCTCTTCTTCTTCC  477
            |||||||| ||||||||||||
Sbjct  896  TCTTCTTCTTCTTCTTCTTCC  876


> KLAEg863 KLAEg863 undefined product 1858616:1859554 forward
Length=939

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||||||| |||||||| |||
Sbjct  419  TCCTCTTCTTCATCTTCTTCCTCC  396


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||||| ||||||||
Sbjct  491  TCGTCTTCTTCCTCGTCTTCTTC  469


> KLAEg644 KLAEg644 undefined product 1397832:1398647 forward
Length=816

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453  ATCCTCTTCTTCCTCTTCTTCTTC  476
            ||| |||||||| |||||||||||
Sbjct  63   ATCTTCTTCTTCTTCTTCTTCTTC  40


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 26/31 (84%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCAAGG  484
            || |||||||| |||||||||||   |||||
Sbjct  50   TCTTCTTCTTCTTCTTCTTCTTCTTTCAAGG  20


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  53   TCTTCTTCTTCTTCTTCTTCTTC  31


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  56   TCTTCTTCTTCTTCTTCTTCTTC  34


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  59   TCTTCTTCTTCTTCTTCTTCTTC  37


> KLAEg578 KLAEg578 undefined product 1250498:1253404 forward
Length=2907

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  1176  ATCTTCTTCTTCTTCTTCTTCTTC  1153


 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| |||||||| |||||||||||
Sbjct  1179  ATCATCTTCTTCTTCTTCTTCTTC  1156


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1172  TCTTCTTCTTCTTCTTCTTCTTC  1150


> KLAEg563 KLAEg563 undefined product 1218052:1219341 reverse
Length=1290

 Score = 35.6 bits (38),  Expect = 0.98
 Identities = 30/37 (82%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| |    || |||||||| |||||||||||
Sbjct  304  CTTCTTCCTCGTCTTCTTCTTCTTCTTCTTCTTCTTC  268


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  260  TCTTCTTCTTCTTCTTCTTCTTC  238


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  263  TCTTCTTCTTCTTCTTCTTCTTC  241


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  266  TCTTCTTCTTCTTCTTCTTCTTC  244


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  269  TCTTCTTCTTCTTCTTCTTCTTC  247


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  272  TCTTCTTCTTCTTCTTCTTCTTC  250


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  275  TCTTCTTCTTCTTCTTCTTCTTC  253


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  278  TCTTCTTCTTCTTCTTCTTCTTC  256


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  281  TCTTCTTCTTCTTCTTCTTCTTC  259


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  284  TCTTCTTCTTCTTCTTCTTCTTC  262


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  287  TCTTCTTCTTCTTCTTCTTCTTC  265


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||||| ||||||||
Sbjct  308  TCGTCTTCTTCCTCGTCTTCTTC  286


> gi|6319780|ref|NC_001135.1| Saccharomyces cerevisiae chromosome 
III, complete chromosome sequence
Length=315339

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  233644  TCTTCTTCTTCTTCTTCTTCTTC  233622


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  233647  TCTTCTTCTTCTTCTTCTTCTTC  233625


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454     TCCTCTTCTTCCTCTTCTTCTTC  476
               || |||||||| |||||||||||
Sbjct  233650  TCTTCTTCTTCTTCTTCTTCTTC  233628


> KLDOg4277
Length=3327

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||||||||||||  ||||
Sbjct  434  TCCTCTTCTTCCTCTTCCCCTTC  412


> KLDOg3953
Length=1536

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1358  TCTTCTTCTTCTTCTTCTTCTTC  1336


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1361  TCTTCTTCTTCTTCTTCTTCTTC  1339


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1364  TCTTCTTCTTCTTCTTCTTCTTC  1342


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1367  TCTTCTTCTTCTTCTTCTTCTTC  1345


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1370  TCTTCTTCTTCTTCTTCTTCTTC  1348


> KLDOg3782
Length=6786

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCT  486
             ||||| ||||| | |||||||||||  ||| ||
Sbjct  6770  TCCTCATCTTCTTGTTCTTCTTCCATGAAGTCT  6738


> KLDOg3602
Length=591

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  181  TCTTCTTCTTCTTCTTCTTCTTC  159


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  184  TCTTCTTCTTCTTCTTCTTCTTC  162


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  187  TCTTCTTCTTCTTCTTCTTCTTC  165


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||| |||||||||||
Sbjct  188  CTCTTCTTCTTCTTCTTCTTC  168


> KLDOg3151
Length=1770

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1586  TCGTCTTCTTCGTCTTCTTCTTC  1564


> KLDOg3116
Length=3303

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  454  TCCTCTTCTTCCTCTTCTTCTTCCACCA  481
            || || ||||| ||||||||||||| ||
Sbjct  787  TCTTCATCTTCATCTTCTTCTTCCAACA  814


> KLDOg3003
Length=1167

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 28/34 (83%), Gaps = 3/34 (8%)
 Strand=Plus/Plus

Query  443  CTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||   || |||||| | |||||||||||
Sbjct  248  CTTCCACC---TCTTCTTCTGCTTCTTCTTCTTC  278


> KLDOg2318
Length=735

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||| |||||||||||
Sbjct  701  CTCTTCTTCTTCTTCTTCTTC  681


> KLDOg2060
Length=1422

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  917  TCTTCTTCTTCTTCTTCTTCTTC  895


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  920  TCTTCTTCTTCTTCTTCTTCTTC  898


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  923  TCTTCTTCTTCTTCTTCTTCTTC  901


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||| |||||||||||
Sbjct  924  CTCTTCTTCTTCTTCTTCTTC  904


> KLDOg1862
Length=1758

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  73    CCAGCTTGTTTATTGGCCTGTGT  95
             |||||||||||||||  ||||||
Sbjct  1201  CCAGCTTGTTTATTGAGCTGTGT  1179


> KLDOg1444
Length=3573

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  454   TCCTCTTCTTCCTCTTCTTCT  474
             |||||||| ||||||||||||
Sbjct  1843  TCCTCTTCCTCCTCTTCTTCT  1863


> KLDOg1236.t2
Length=363

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  359  TCGTCTTCTTCTTCTTCTTCTTC  337


> KLDOg1236.t1
Length=351

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  347  TCGTCTTCTTCTTCTTCTTCTTC  325


> KLDOg1119
Length=2721

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||||||||| |||||
Sbjct  728  TCTTCTTCTTCCTCTTCCTCTTC  706


> KLDOg1034
Length=1356

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  455  CCTCTTCTTCCTCTTCTTCTTCCACC  480
            |||||||| | ||| |||||||||||
Sbjct  773  CCTCTTCTGCTTCTACTTCTTCCACC  798


> KLDOg849
Length=4368

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 28/34 (83%), Gaps = 3/34 (8%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTC  473
            ||||||||| |   ||||||||||| ||||| ||
Sbjct  526  CTTCTTCCAGC---TCCTCTTCTTCTTCTTCCTC  496


> KLDOg640
Length=1050

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/32 (85%), Gaps = 3/32 (9%)
 Strand=Plus/Plus

Query  458  CTTCTTCCTCTTCTTCT---TCCACCAAGGCT  486
            || |||||||| |||||   ||||||||||||
Sbjct  212  CTGCTTCCTCTACTTCTACCTCCACCAAGGCT  243


> KLDOg492
Length=2067

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1763  TCTTCTTCTTCTTCTTCTTCTTC  1741


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1766  TCTTCTTCTTCTTCTTCTTCTTC  1744


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  1769  TCTTCTTCTTCTTCTTCTTCTTC  1747


> KLDOg78
Length=591

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  181  TCTTCTTCTTCTTCTTCTTCTTC  159


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  184  TCTTCTTCTTCTTCTTCTTCTTC  162


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  187  TCTTCTTCTTCTTCTTCTTCTTC  165


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||| |||||||||||
Sbjct  188  CTCTTCTTCTTCTTCTTCTTC  168


> KLWIg4360 KLWIg4360 undefined product 8889307:8890224 reverse
Length=918

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||||||||| || ||
Sbjct  782  TCCTCTTCTTCCTCTTCGTCCTC  760


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||||| ||||||||||| ||
Sbjct  791  TCCTCTTCCTCCTCTTCTTCCTC  769


> KLWIg3997 KLWIg3997 undefined product 8104735:8106777 reverse
Length=2043

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 29/36 (81%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  440  CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTT  475
            |||||||  |  |||  || ||||||||||||||||
Sbjct  877  CTTCTTCTTCATAATAATCATCTTCCTCTTCTTCTT  842


> KLWIg3756 KLWIg3756 undefined product 7611572:7613248 forward
Length=1677

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 29/36 (81%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  441  TTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||| ||   ||||| ||||||||||| || ||
Sbjct  918  TTCTTCCTCCTCTTCCTCCTCTTCCTCTTCCTCCTC  883


> KLWIg3387 KLWIg3387 undefined product 6860158:6862938 forward
Length=2781

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  453   ATCCTCTTCTTCCTCTTCTTCTTCCACC  480
             ||| || |||||||||||||| || |||
Sbjct  1764  ATCATCCTCTTCCTCTTCTTCGTCAACC  1737


> KLWIg3337 KLWIg3337 undefined product 6766602:6767873 forward
Length=1272

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  160  TCTTCTTCTTCTTCTTCTTCTTC  138


> KLWIg3276 KLWIg3276 undefined product 6637840:6640536 reverse
Length=2697

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  451   GAATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| | |||||||| |||||||||||
Sbjct  2656  GAACCTTCTTCTTCTTCTTCTTCTTC  2631


> KLWIg3069 KLWIg3069 undefined product 6213745:6214956 reverse
Length=1212

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||| || ||||||||||||||
Sbjct  497  TCCTCCTCCTCCTCTTCTTCTTC  475


> KLWIg2823 KLWIg2823 undefined product 5752439:5753629 forward
Length=1191

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  806  TCTTCTTCTTCTTCTTCTTCTTC  784


> KLWIg2655 KLWIg2655 undefined product 5416299:5417442 forward
Length=1032

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  407  TCTTCTTCTTCTTCTTCTTCTTC  385


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  410  TCTTCTTCTTCTTCTTCTTCTTC  388


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||| |||||||||||
Sbjct  411  CTCTTCTTCTTCTTCTTCTTC  391


> KLWIg2534 KLWIg2534 undefined product 5187175:5189511 forward
Length=2337

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             |||| |||||| |||||||||||
Sbjct  1616  TCCTTTTCTTCTTCTTCTTCTTC  1594


> KLWIg2139 KLWIg2139 undefined product 4380997:4382835 reverse
Length=1839

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  380  TCTTCTTCTTCTTCTTCTTCTTC  358


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  383  TCGTCTTCTTCTTCTTCTTCTTC  361


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  392  TCGTCTTCTTCGTCTTCTTCTTC  370


> KLWIg1799 KLWIg1799 undefined product 3706055:3707011 reverse
Length=957

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  866  TCTTCTTCTTCTTCTTCTTCTTC  844


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  869  TCTTCTTCTTCTTCTTCTTCTTC  847


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  872  TCTTCTTCTTCTTCTTCTTCTTC  850


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  875  TCTTCTTCTTCTTCTTCTTCTTC  853


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  878  TCTTCTTCTTCTTCTTCTTCTTC  856


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  881  TCTTCTTCTTCTTCTTCTTCTTC  859


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  884  TCTTCTTCTTCTTCTTCTTCTTC  862


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  887  TCTTCTTCTTCTTCTTCTTCTTC  865


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  890  TCTTCTTCTTCTTCTTCTTCTTC  868


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  893  TCTTCTTCTTCTTCTTCTTCTTC  871


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  896  TCTTCTTCTTCTTCTTCTTCTTC  874


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  899  TCTTCTTCTTCTTCTTCTTCTTC  877


> KLWIg1433 KLWIg1433 undefined product 2903857:2905872 forward
Length=2016

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||| || |||||||||||||
Sbjct  146  TCCTCTACTACCTCTTCTTCTTC  124


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            |||||| || |||||||||||||
Sbjct  173  TCCTCTACTACCTCTTCTTCTTC  151


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  200  TCTTCTTCTTCATCTTCTTCTTC  178


> KLWIg1252 KLWIg1252 undefined product 2559492:2560580 reverse
Length=1089

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  256  CAAAATGCTTCATTGGGCGATTC  278
            ||||||||  |||||||||||||
Sbjct  88   CAAAATGCCACATTGGGCGATTC  110


> KLWIg1223 KLWIg1223 undefined product 2506494:2506898 forward
Length=405

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  458  CTTCTTCCTCTTCTTCTTCCACC  480
            ||| ||||||||||||||| |||
Sbjct  345  CTTGTTCCTCTTCTTCTTCTACC  367


> KLWIg911 KLWIg911 undefined product 1881015:1884776 forward
Length=3762

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457   TCTTCTTCCTCTTCTTCTTCC  477
             || ||||||||||||||||||
Sbjct  1625  TCATCTTCCTCTTCTTCTTCC  1605


> KLWIg715 KLWIg715 undefined product 1502831:1504750 forward
Length=1920

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||||| || ||||||||||||||
Sbjct  1409  TCCTCGTCCTCCTCTTCTTCTTC  1387


> KLLA0F28083g KLLA0F28083g undefined product 10681233:10683329 
reverse
Length=2097

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  457   TCTTCTTCCTCTTCTTCTTCC  477
             |||||||| ||||||||||||
Sbjct  1640  TCTTCTTCTTCTTCTTCTTCC  1620


> KLLA0F24332g KLLA0F24332g undefined product 10355350:10356033 
forward
Length=684

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  460  TCTTCCTCTTCTTCTTCC  477
            ||||||||||||||||||
Sbjct  293  TCTTCCTCTTCTTCTTCC  276


> KLLA0F16907g KLLA0F16907g undefined product 9642816:9644174 forward
Length=1359

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  459   TTCTTCCTCTTCTTCTTC  476
             ||||||||||||||||||
Sbjct  1059  TTCTTCCTCTTCTTCTTC  1076


> KLLA0F15433g KLLA0F15433g undefined product 9513796:9514956 reverse
Length=1161

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  451   GAATCCTCTTCTTCCTCTTCTTCTTC  476
             || || |||||||| |||||||||||
Sbjct  1124  GACTCTTCTTCTTCTTCTTCTTCTTC  1099


> KLLA0F14817g KLLA0F14817g undefined product 9457068:9459251 reverse
Length=2184

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  455  CCTCTTCTTCCTCTTCTTCTTCC  477
            || ||||||||||||| ||||||
Sbjct  208  CCGCTTCTTCCTCTTCCTCTTCC  186


> KLLA0F06710g KLLA0F06710g undefined product 8732609:8735899 forward
Length=3291

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||| |||||||||||||||||
Sbjct  366  CTCCTCTTCCTCTTCTTCTTC  346


> KLLA0F03531g KLLA0F03531g undefined product 8415789:8420186 reverse
Length=4398

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2687  TCTTCTTCTTCTTCTTCTTCTTC  2665


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2690  TCTTCTTCTTCTTCTTCTTCTTC  2668


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2693  TCTTCTTCTTCTTCTTCTTCTTC  2671


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2696  TCTTCTTCTTCTTCTTCTTCTTC  2674


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2699  TCTTCTTCTTCTTCTTCTTCTTC  2677


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2702  TCTTCTTCTTCTTCTTCTTCTTC  2680


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2705  TCTTCTTCTTCTTCTTCTTCTTC  2683


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2708  TCTTCTTCTTCTTCTTCTTCTTC  2686


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2711  TCTTCTTCTTCTTCTTCTTCTTC  2689


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2714  TCTTCTTCTTCTTCTTCTTCTTC  2692


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2717  TCTTCTTCTTCTTCTTCTTCTTC  2695


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2720  TCTTCTTCTTCTTCTTCTTCTTC  2698


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2723  TCTTCTTCTTCTTCTTCTTCTTC  2701


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2726  TCTTCTTCTTCTTCTTCTTCTTC  2704


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2729  TCTTCTTCTTCTTCTTCTTCTTC  2707


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2732  TCTTCTTCTTCTTCTTCTTCTTC  2710


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2735  TCTTCTTCTTCTTCTTCTTCTTC  2713


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2738  TCTTCTTCTTCTTCTTCTTCTTC  2716


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2741  TCTTCTTCTTCTTCTTCTTCTTC  2719


> KLLA0E19339g KLLA0E19339g undefined product 7574634:7575662 reverse
Length=1029

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  455  CCTCTTCTTCCTCTTCTTCTTCC  477
            ||||||| || ||||||||||||
Sbjct  319  CCTCTTCCTCTTCTTCTTCTTCC  297


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  491  TCTTCTTCTTCATCTTCTTCTTC  469


> KLLA0E19229g KLLA0E19229g undefined product 7565986:7568205 forward
Length=2220

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            |||||||| ||||||||||||
Sbjct  438  CTCTTCTTGCTCTTCTTCTTC  418


> KLLA0E07019g KLLA0E07019g undefined product 6494278:6495117 forward
Length=840

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  455  TCTTCTTCTTCTTCTTCTTCTTC  433


> KLLA0E05721g KLLA0E05721g undefined product 6364223:6365431 reverse
Length=1209

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  683  TCGTCTTCTTCATCTTCTTCTTC  661


> KLLA0E01035g KLLA0E01035g undefined product 5962708:5968344 forward
Length=5637

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 36/48 (75%), Gaps = 0/48 (0%)
 Strand=Plus/Plus

Query  442   TCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCT  489
             |||||||||||| |  || ||||  ||   ||||||||| | ||| ||
Sbjct  3427  TCTTCCACCGAAGCTACTACTTCAACTGAATCTTCCACCGAAGCTACT  3474


> KLLA0D16566g KLLA0D16566g undefined product 5537294:5544709 forward
Length=7416

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||||||||| |||||
Sbjct  6332  TCTTCTTCTTCCTCTTCATCTTC  6310


> KLLA0D16093g KLLA0D16093g undefined product 5493437:5493805 reverse
Length=369

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||||||||||| ||
Sbjct  110  TCATCTTCTTCCTCTTCTTCATC  88


> KLLA0D08932g KLLA0D08932g undefined product 4889324:4890160 forward
Length=837

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  456  CTCTTCTTCCTCTTCTTCTTC  476
            ||||||||| |||||||||||
Sbjct  146  CTCTTCTTCTTCTTCTTCTTC  126


> KLLA0D01980g KLLA0D01980g undefined product 4308617:4309165 reverse
Length=549

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || |||||||| |||||||||||
Sbjct  427  TCTTCTTCTTCTTCTTCTTCTTC  405


> KLLA0D00792g KLLA0D00792g undefined product 4210803:4213865 forward
Length=3063

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  444   TTCCACCGAATCCTCTTCTTCCTCTTCTTCTTC  476
             ||| || | |||||| || ||||||||||| ||
Sbjct  2142  TTCAACAGCATCCTCGTCGTCCTCTTCTTCATC  2110


> KLLA0C17578g KLLA0C17578g undefined product 3931314:3935891 forward
Length=4578

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            || ||||||||||||||||| ||
Sbjct  206  TCTTCTTCTTCCTCTTCTTCGTC  184


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454  TCCTCTTCTTCCTCTTCTTCTTC  476
            ||||||||||| || ||||||||
Sbjct  209  TCCTCTTCTTCTTCCTCTTCTTC  187


> KLLA0C06633g KLLA0C06633g undefined product 2963773:2965668 forward
Length=1896

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             ||| ||||||||||||| |||||
Sbjct  1703  TCCACTTCTTCCTCTTCATCTTC  1681


> KLLA0B11385g KLLA0B11385g undefined product 2056008:2060390 reverse
Length=4383

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  459  TTCTTCCTCTTCTTCTTC  476
            ||||||||||||||||||
Sbjct  519  TTCTTCCTCTTCTTCTTC  502


> KLLA0B06952g KLLA0B06952g undefined product 1669284:1671968 forward
Length=2685

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Plus

Query  457   TCTTCTTCCTCTTCTTCT  474
             ||||||||||||||||||
Sbjct  1594  TCTTCTTCCTCTTCTTCT  1611


> KLLA0A09537g KLLA0A09537g undefined product 835653:838517 forward
Length=2865

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  291  CTCCTCATCCGCTTCTTCATCCA  313
            ||| |||||| ||||||||||||
Sbjct  213  CTCTTCATCCACTTCTTCATCCA  191


> KLLA0A02959g KLLA0A02959g undefined product 260627:262306 forward
Length=1680

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  459   TTCTTCCTCTTCTTCTTC  476
             ||||||||||||||||||
Sbjct  1020  TTCTTCCTCTTCTTCTTC  1003


> KLLA0A00803g KLLA0A00803g undefined product 76350:79208 forward
Length=2859

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2630  TCTTCTTCTTCTTCTTCTTCTTC  2608


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2633  TCTTCTTCTTCTTCTTCTTCTTC  2611


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2636  TCTTCTTCTTCTTCTTCTTCTTC  2614


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454   TCCTCTTCTTCCTCTTCTTCTTC  476
             || |||||||| |||||||||||
Sbjct  2639  TCTTCTTCTTCTTCTTCTTCTTC  2617


> AEAS01000272  Kluyveromyces aestuarii ATCC 18862 contig00584, 
whole genome shotgun sequence
Length=75083

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  457   TCTTCTTCCTCTTCTTCTTCCAC  479
             |||||||| ||||||||||| ||
Sbjct  1135  TCTTCTTCTTCTTCTTCTTCAAC  1157


> AEAS01000260  Kluyveromyces aestuarii ATCC 18862 contig00566, 
whole genome shotgun sequence
Length=4377

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 30/38 (79%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  425  CATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCT  462
            ||||||||  ||  || || || || ||||||||||||
Sbjct  39   CATCTTCTGCCAGTGCATCCTCTACAGAATCCTCTTCT  2


> AEAS01000256  Kluyveromyces aestuarii ATCC 18862 contig00560, 
whole genome shotgun sequence
Length=15843

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10199  TCTTCTTCTTCTTCTTCTTCTTC  10221


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10202  TCTTCTTCTTCTTCTTCTTCTTC  10224


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10205  TCTTCTTCTTCTTCTTCTTCTTC  10227


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10208  TCTTCTTCTTCTTCTTCTTCTTC  10230


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10211  TCTTCTTCTTCTTCTTCTTCTTC  10233


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10214  TCTTCTTCTTCTTCTTCTTCTTC  10236


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10217  TCTTCTTCTTCTTCTTCTTCTTC  10239


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10220  TCTTCTTCTTCTTCTTCTTCTTC  10242


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10223  TCTTCTTCTTCTTCTTCTTCTTC  10245


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||| |||||||||||
Sbjct  10226  TCTTCTTCTTCTTCTTCTTCTTC  10248


> AEAS01000214  Kluyveromyces aestuarii ATCC 18862 contig00234, 
whole genome shotgun sequence
Length=16812

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              |||||||| || |||||||||||
Sbjct  12144  TCCTCTTCCTCTTCTTCTTCTTC  12122


> AEAS01000207  Kluyveromyces aestuarii ATCC 18862 contig00226, 
whole genome shotgun sequence
Length=15240

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 29/36 (81%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  440    CTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTT  475
              |||||||| |    || |||||||||||||| ||||
Sbjct  15106  CTTCTTCCCCTTCCTCGTCTTCTTCCTCTTCGTCTT  15141


 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              || |||||||||||||| |||||
Sbjct  15210  TCGTCTTCTTCCTCTTCGTCTTC  15232


> AEAS01000170  Kluyveromyces aestuarii ATCC 18862 contig00183, 
whole genome shotgun sequence
Length=33401

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  453    ATCCTCTTCTTCCTCTTCTTCTTCCACC  480
              |||||| || || |||||||||||| ||
Sbjct  10249  ATCCTCCTCCTCTTCTTCTTCTTCCTCC  10276


> AEAS01000160  Kluyveromyces aestuarii ATCC 18862 contig00171, 
whole genome shotgun sequence
Length=114832

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  456    CTCTTCTTCCTCTTCTTCTTC  476
              |||||||||||||| ||||||
Sbjct  38623  CTCTTCTTCCTCTTATTCTTC  38643


> AEAS01000153  Kluyveromyces aestuarii ATCC 18862 contig00162, 
whole genome shotgun sequence
Length=43652

 Score = 33.7 bits (36),  Expect = 3.4
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  454    TCCTCTTCTTCCTCTTCTTCTTC  476
              ||||||||||| ||| |||||||
Sbjct  42049  TCCTCTTCTTCTTCTCCTTCTTC  42027



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 49538168472


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7

  Database: Saccharomyces cerevisiae
    Posted date:  Jul 14, 2011  9:42 PM
  Number of letters in database: 12,155,026
  Number of sequences in database:  17



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
ATGCGTGCCACCACTTTATTATCTTCAGTCGTTTCTTTGGCATTGTTGTCGAAGGAAGTC
TTAGCAACACCTCCAGCTTGTTTATTGGCCTGTGTTGCGCAAGTCGGCAAATCCTCTTCC
ACATGTGACTCTTTGAATCAAGTCACCTGTTACTGTGAACACGAAAACTCCGCCGTCAAG
AAATGTCTAGACTCCATCTGCCCAAACAATGACGCTGATGCTGCTTATTCTGCTTTCAAG
AGTTCTTGTTCCGAACAAAATGCTTCATTGGGCGATTCCAGCAGCAGTGCCTCCTCATCC
GCTTCTTCATCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCC
TCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCT
GCCCCATCTTCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACC
AAGGCTCCTTCCAGTGAAGAATCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCC
TCCACTAGCGAGGCTCACTCTTCCAGTGCTGCCTCTTCGACCGTGTCCCAAGAAACAGTC
TCCTCTGCTCTACCAACTTCTACCGCCGTTATTTCTACTTTCTCTGAAGGTTCTGGTAAT
GTTCTAGAGGCAGGAAAATCCGTTTTCATTGCTGCTGTTGCCGCTATGTTAATCTAA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)