blastn task: LAC12-LAC4

Status
finished finished
Modified 2013-11-06T17:02:18Z
CPU time (s) 0.4
Size (bytes) 116219
Command blastn -num_descriptions 50 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis_Y-1140.fna' -num_alignments 20 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis
NRRL Y-1140
           15,424 sequences; 62,716,586 total letters



Query= query

Length=7311
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  1.319e+04  0.0  
  AEAV01000200  Kluyveromyces wickerhamii UCD 54-210 contig00208,...   897       0.0  
  KLWIg4169 KLWIg4169 undefined product 8464981:8468037 forward        897       0.0  
  AEAS01000242  Kluyveromyces aestuarii ATCC 18862 contig00543, w...   767       0.0  
  KLAEg3795 KLAEg3795 undefined product 8018574:8021630 forward        767       0.0  
  gsASS001Lm                                                          50.0       4e-04
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  48.2       0.001
  AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, w...  42.8       0.061
  KLDOg2768                                                           41.0       0.21 
  AEAV01000232  Kluyveromyces wickerhamii UCD 54-210 contig00243,...  41.0       0.21 
  KLWIg4587 KLWIg4587 undefined product 9363873:9365588 reverse       41.0       0.21 
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  41.0       0.21 
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  41.0       0.21 
  AEAS01000136  Kluyveromyces aestuarii ATCC 18862 contig00142, w...  41.0       0.21 
  KLDOg420                                                            39.2       0.74 
  AEAV01000211  Kluyveromyces wickerhamii UCD 54-210 contig00221,...  39.2       0.74 
  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  39.2       0.74 
  AEAS01000241  Kluyveromyces aestuarii ATCC 18862 contig00542, w...  39.2       0.74 
  AEAS01000218  Kluyveromyces aestuarii ATCC 18862 contig00238, w...  39.2       0.74 
  AEAV01000137  Kluyveromyces wickerhamii UCD 54-210 contig00143,...  37.4       2.6  
  AEAV01000135  Kluyveromyces wickerhamii UCD 54-210 contig00141,...  37.4       2.6  
  AEAV01000121  Kluyveromyces wickerhamii UCD 54-210 contig00127,...  37.4       2.6  
  AEAV01000091  Kluyveromyces wickerhamii UCD 54-210 contig00095,...  37.4       2.6  
  AEAS01000317  Kluyveromyces aestuarii ATCC 18862 contig00649, w...  37.4       2.6  
  AEAS01000273  Kluyveromyces aestuarii ATCC 18862 contig00591, w...  37.4       2.6  
  AEAS01000270  Kluyveromyces aestuarii ATCC 18862 contig00582, w...  37.4       2.6  
  AEAS01000235  Kluyveromyces aestuarii ATCC 18862 contig00535, w...  37.4       2.6  
  AEAS01000111  Kluyveromyces aestuarii ATCC 18862 contig00116, w...  37.4       2.6  
  AEAS01000051  Kluyveromyces aestuarii ATCC 18862 contig00053, w...  37.4       2.6  
  KLAEg2835 KLAEg2835 undefined product 5981557:5982451 reverse       37.4       2.6  
  KLAEg153 KLAEg153 undefined product 338846:341563 forward           37.4       2.6  
  KLDOg4801A                                                          35.6       9.0  
  KLDOg4717                                                           35.6       9.0  
  KLDOg4516                                                           35.6       9.0  
  KLDOg3128                                                           35.6       9.0  
  KLDOg958                                                            35.6       9.0  
  KLDOg836                                                            35.6       9.0  
  KLDOg511                                                            35.6       9.0  
  KLDOg427                                                            35.6       9.0  
  KLDOg158                                                            35.6       9.0  
  AEAV01000466  Kluyveromyces wickerhamii UCD 54-210 contig00882,...  35.6       9.0  
  AEAV01000451  Kluyveromyces wickerhamii UCD 54-210 contig00858,...  35.6       9.0  
  AEAV01000106  Kluyveromyces wickerhamii UCD 54-210 contig00111,...  35.6       9.0  
  AEAV01000087  Kluyveromyces wickerhamii UCD 54-210 contig00091,...  35.6       9.0  
  KLWIg3226 KLWIg3226 undefined product 6536383:6538305 forward       35.6       9.0  
  KLWIg2213 KLWIg2213 undefined product 4532951:4534867 reverse       35.6       9.0  
  KLWIg1060 KLWIg1060 undefined product 2169945:2170226 forward       35.6       9.0  
  gsASS001Lm                                                          35.6       9.0  
  AEAS01000336  Kluyveromyces aestuarii ATCC 18862 contig00682, w...  35.6       9.0  
  AEAS01000288  Kluyveromyces aestuarii ATCC 18862 contig00615, w...  35.6       9.0  


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 1.319e+04 bits (14622),  Expect = 0.0
 Identities = 7311/7311 (100%), Gaps = 0/7311 (0%)
 Strand=Plus/Plus

Query  1        TTTTGAAAACTGATTATCGTCTTGTTTTATTTTTTCGTAATTCTGTCTTTAATCATTAAC  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307690  TTTTGAAAACTGATTATCGTCTTGTTTTATTTTTTCGTAATTCTGTCTTTAATCATTAAC  1307749

Query  61       ACTGACTGAAGGATATAATTATAAGACAACACACAGAGACTTTTGTTTGCTGTTTAGCTT  120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307750  ACTGACTGAAGGATATAATTATAAGACAACACACAGAGACTTTTGTTTGCTGTTTAGCTT  1307809

Query  121      ACACTTTCCAGCTATATTGAATAGCATATATATGTTCCAGAAGCTACAACCACCTTGAAC  180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307810  ACACTTTCCAGCTATATTGAATAGCATATATATGTTCCAGAAGCTACAACCACCTTGAAC  1307869

Query  181      TACAGCCCAACTCAACATTGAAAGTTACTGCCTTTATATACCTTGATACACCATTTAGAC  240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307870  TACAGCCCAACTCAACATTGAAAGTTACTGCCTTTATATACCTTGATACACCATTTAGAC  1307929

Query  241      CTCCAATTAACCGATTGTCCTTGTCATAATGAGCTAGAGTAGCAAGGTATCAACAACAGT  300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307930  CTCCAATTAACCGATTGTCCTTGTCATAATGAGCTAGAGTAGCAAGGTATCAACAACAGT  1307989

Query  301      ATGGACATCTTATTGTCAACTTTCTAGTACGGAGGGAAGAATCCCGAATATGTTAAATCT  360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307990  ATGGACATCTTATTGTCAACTTTCTAGTACGGAGGGAAGAATCCCGAATATGTTAAATCT  1308049

Query  361      GACGCGCGGGTATTGCTAAGTCACGTTGCAGGCCCACGCAGACCCGAGTTTCTTTCTTAC  420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308050  GACGCGCGGGTATTGCTAAGTCACGTTGCAGGCCCACGCAGACCCGAGTTTCTTTCTTAC  1308109

Query  421      AAAAGCGTGTACACACGTAAACGCGCTCGGTGCACCGAACGGCCAGGGTCGGGGTTCATT  480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308110  AAAAGCGTGTACACACGTAAACGCGCTCGGTGCACCGAACGGCCAGGGTCGGGGTTCATT  1308169

Query  481      CGGTATAGAGCCACGCAGGTAACTTGCCAATTCCAAAAAAAATTAAATGACGATACTAGT  540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308170  CGGTATAGAGCCACGCAGGTAACTTGCCAATTCCAAAAAAAATTAAATGACGATACTAGT  1308229

Query  541      AACCAAAGGAAAGGAACAGATAGATAAAATTCCGAGACTGTCAAATTAGGTTTTTTTCTT  600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308230  AACCAAAGGAAAGGAACAGATAGATAAAATTCCGAGACTGTCAAATTAGGTTTTTTTCTT  1308289

Query  601      TTTTTTTGGCGGGAGTCAGTGGGCCGAAATATGTTCTTGGCCTAGAACTTAATCTGGTTT  660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308290  TTTTTTTGGCGGGAGTCAGTGGGCCGAAATATGTTCTTGGCCTAGAACTTAATCTGGTTT  1308349

Query  661      GATCATGCCAATACTTGCCTGAGTGCCCGACTTTTTGCCCACCCTTTTGCCTTCTGTCTA  720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308350  GATCATGCCAATACTTGCCTGAGTGCCCGACTTTTTGCCCACCCTTTTGCCTTCTGTCTA  1308409

Query  721      TCCTTCAAAACCCACCTGTTTTCCAGCCGTATCTTCGCTCGCATCTACACATACTGTGCC  780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308410  TCCTTCAAAACCCACCTGTTTTCCAGCCGTATCTTCGCTCGCATCTACACATACTGTGCC  1308469

Query  781      ATATCTTGTGTGTAGCCGGACGTGACTATGACCAAAAACAAACAAGGAGAACTGTTCGCC  840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308470  ATATCTTGTGTGTAGCCGGACGTGACTATGACCAAAAACAAACAAGGAGAACTGTTCGCC  1308529

Query  841      GATTTGTAACACTCCTGCATCCATCCAAGTGGGTATGCGCTATGCAATGTTAAGCTAGGT  900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308530  GATTTGTAACACTCCTGCATCCATCCAAGTGGGTATGCGCTATGCAATGTTAAGCTAGGT  1308589

Query  901      CAGGTCAGACCAGGTCCAAGGACAGCAACTTGACTGTATGCAACCTTTACCATCTTTGCA  960
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308590  CAGGTCAGACCAGGTCCAAGGACAGCAACTTGACTGTATGCAACCTTTACCATCTTTGCA  1308649

Query  961      CAGAACATACTTGTAGCTAGCTAGTTACACTTATGGACCGAAAAGGCACCCCACCATGTC  1020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308650  CAGAACATACTTGTAGCTAGCTAGTTACACTTATGGACCGAAAAGGCACCCCACCATGTC  1308709

Query  1021     TGTCCGGCTTTAGAGTACGGCCGCAGACCGCTGATTTGCCTTGCCAAGCAGTAGTCACAA  1080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308710  TGTCCGGCTTTAGAGTACGGCCGCAGACCGCTGATTTGCCTTGCCAAGCAGTAGTCACAA  1308769

Query  1081     TGCATCGCATGAGCACACGGGCACGGGCACGGGCACAGGAACCATTGGCAAAAATACCAG  1140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308770  TGCATCGCATGAGCACACGGGCACGGGCACGGGCACAGGAACCATTGGCAAAAATACCAG  1308829

Query  1141     ATACACTATACCGACGTATATCAAGCCCAAGTTTAAAATTCCTAAATTTCCGCGGGGATC  1200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308830  ATACACTATACCGACGTATATCAAGCCCAAGTTTAAAATTCCTAAATTTCCGCGGGGATC  1308889

Query  1201     GACTCATAAAATAGTAACCTTCTAATGCGTATCTATTGACTACCAACCATTAGTGTGGTT  1260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308890  GACTCATAAAATAGTAACCTTCTAATGCGTATCTATTGACTACCAACCATTAGTGTGGTT  1308949

Query  1261     GCAGAAGGCGGAATTCTCCCTTCTTCGAATTCAGCTTGCTTTTTCATTTTTTATTTTCCA  1320
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308950  GCAGAAGGCGGAATTCTCCCTTCTTCGAATTCAGCTTGCTTTTTCATTTTTTATTTTCCA  1309009

Query  1321     TTTTTCAGTTTTTGTTTGTGTCGAATTTAGCCAGTTGCTTCTCCAAGATGAAAAAAACCC  1380
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309010  TTTTTCAGTTTTTGTTTGTGTCGAATTTAGCCAGTTGCTTCTCCAAGATGAAAAAAACCC  1309069

Query  1381     CTGCGCAGTTTCTGTGCTGCAAGATCCTAATCGACTTTTCCACCCCCCACAAAAGTAAAT  1440
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309070  CTGCGCAGTTTCTGTGCTGCAAGATCCTAATCGACTTTTCCACCCCCCACAAAAGTAAAT  1309129

Query  1441     GTTCTTTTGTTACATTCGCGTGGGTAGCTAGCTCCCCGAATCTTCAAAGGACTTAGGGAC  1500
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309130  GTTCTTTTGTTACATTCGCGTGGGTAGCTAGCTCCCCGAATCTTCAAAGGACTTAGGGAC  1309189

Query  1501     TGCACTACATCAGAGTGTGTTCACCTGGTTTGCTGCCTGGTTTGAAAGAAAAGAGCAGGG  1560
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309190  TGCACTACATCAGAGTGTGTTCACCTGGTTTGCTGCCTGGTTTGAAAGAAAAGAGCAGGG  1309249

Query  1561     AACTCGCGGGTTCCCGGCGAATAATCATGCGATAGTCCTTTGGCCTTCCAAGTCGCATGT  1620
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309250  AACTCGCGGGTTCCCGGCGAATAATCATGCGATAGTCCTTTGGCCTTCCAAGTCGCATGT  1309309

Query  1621     AGAGTAGACAACAGACAGGGAGGGCAGGAAGGATCTTTCACTGAGATCCTGTATCTTGTT  1680
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309310  AGAGTAGACAACAGACAGGGAGGGCAGGAAGGATCTTTCACTGAGATCCTGTATCTTGTT  1309369

Query  1681     GGGTAAGTCGGATGAAAGGGGAATCGTATGAGATTGGAGAGGATGCGGAAGAGGTAACGC  1740
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309370  GGGTAAGTCGGATGAAAGGGGAATCGTATGAGATTGGAGAGGATGCGGAAGAGGTAACGC  1309429

Query  1741     CTTTTGTTAACTTGTTTAATTATTATGGGGCAGGCGAGAGGGGGAGGAATGTATGTGTGT  1800
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309430  CTTTTGTTAACTTGTTTAATTATTATGGGGCAGGCGAGAGGGGGAGGAATGTATGTGTGT  1309489

Query  1801     GAGGCGGGCGAGACGGAGCCATCCAGGCCAGGTAGAAATAGAGAAAGCCGAATGTTAGAC  1860
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309490  GAGGCGGGCGAGACGGAGCCATCCAGGCCAGGTAGAAATAGAGAAAGCCGAATGTTAGAC  1309549

Query  1861     AATATGGCAGCGTAGTAGAGTAGGTAGGTAGGCAAGTACTGCTAGCAAAGAGGAGAAGGG  1920
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309550  AATATGGCAGCGTAGTAGAGTAGGTAGGTAGGCAAGTACTGCTAGCAAAGAGGAGAAGGG  1309609

Query  1921     TAAGCTCACTCTTCGCATTCCACACCGTTAGTGTGTCAGTTTGAACAAAAAAACAATCAT  1980
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309610  TAAGCTCACTCTTCGCATTCCACACCGTTAGTGTGTCAGTTTGAACAAAAAAACAATCAT  1309669

Query  1981     CATACCAATTGATGGACTGTGGACTGGCTTTTGGAACGGCTTTTCGGACTGCGATTATTC  2040
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309670  CATACCAATTGATGGACTGTGGACTGGCTTTTGGAACGGCTTTTCGGACTGCGATTATTC  1309729

Query  2041     GTGAGGAATCAAGGTAGGAATTTGGTCATATTTACGGACAACAGTGGGTGATTCCCATAT  2100
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309730  GTGAGGAATCAAGGTAGGAATTTGGTCATATTTACGGACAACAGTGGGTGATTCCCATAT  1309789

Query  2101     GGAGTAGGAAAACGAGATCATGGTATCCTCAGATATGTTGCGGAATTCTGTTCACCGCAA  2160
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309790  GGAGTAGGAAAACGAGATCATGGTATCCTCAGATATGTTGCGGAATTCTGTTCACCGCAA  1309849

Query  2161     AGTTCAGGGTGCTCTGGTGGGTTTCGGTTGGTCTTTGCTTTGCTTCTCCCTTGTCTTGCA  2220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309850  AGTTCAGGGTGCTCTGGTGGGTTTCGGTTGGTCTTTGCTTTGCTTCTCCCTTGTCTTGCA  1309909

Query  2221     TGTTAATAATAGCCTAGCCTGTGAGCCGAAACTTAGGGTAGGCTTAGTGTTGGAACGTAC  2280
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309910  TGTTAATAATAGCCTAGCCTGTGAGCCGAAACTTAGGGTAGGCTTAGTGTTGGAACGTAC  1309969

Query  2281     ATATGTATCACGTTGACTTGGTTTAACCAGGCGACCTGGTAGCCAGCCATACCCACACAC  2340
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309970  ATATGTATCACGTTGACTTGGTTTAACCAGGCGACCTGGTAGCCAGCCATACCCACACAC  1310029

Query  2341     GTTTTTTGTATCTTCAGTATAGTTGTGAAAAGTGTAGCGGAAATTTGTGGTCCGAGCAAC  2400
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310030  GTTTTTTGTATCTTCAGTATAGTTGTGAAAAGTGTAGCGGAAATTTGTGGTCCGAGCAAC  1310089

Query  2401     AGCGTCTTTTTCTAGTAGTGCGGTCGGTTACTTGGTTGACATTGGTATTTGGACTTTGTT  2460
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310090  AGCGTCTTTTTCTAGTAGTGCGGTCGGTTACTTGGTTGACATTGGTATTTGGACTTTGTT  1310149

Query  2461     GCTACACCATTCACTACTTGAAGTCGAGTGTGAAGGGTATGATTTCTAGTGGTGAACACC  2520
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310150  GCTACACCATTCACTACTTGAAGTCGAGTGTGAAGGGTATGATTTCTAGTGGTGAACACC  1310209

Query  2521     TTTAGTTACGTAATGTTTTCATTGCTGTTTTACTTGAGATTTCGATTGAGAAAAAGGTAT  2580
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310210  TTTAGTTACGTAATGTTTTCATTGCTGTTTTACTTGAGATTTCGATTGAGAAAAAGGTAT  1310269

Query  2581     TTAATAGCTCGAATCAATGTGTTATCATTGTGAAGATGTTCTTCCCTAACTCGAAAGGTA  2640
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310270  TTAATAGCTCGAATCAATGTGTTATCATTGTGAAGATGTTCTTCCCTAACTCGAAAGGTA  1310329

Query  2641     TATGAGGCTTGTGTTTCTTAGGAGAATTATTATTCTTTTGTTATGTTGCGCTTGTAGTTG  2700
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310330  TATGAGGCTTGTGTTTCTTAGGAGAATTATTATTCTTTTGTTATGTTGCGCTTGTAGTTG  1310389

Query  2701     GAAAAGGTGAAGAGACAAAAGCGCTTAACACTTGAAATTTAGGAAAGAGCAGAATTTGGC  2760
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310390  GAAAAGGTGAAGAGACAAAAGCGCTTAACACTTGAAATTTAGGAAAGAGCAGAATTTGGC  1310449

Query  2761     AAAAAAAATAAAAAAAAAATAAACACACATACTCATCGAGAACTGAAAGATATGTCTTGC  2820
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310450  AAAAAAAATAAAAAAAAAATAAACACACATACTCATCGAGAACTGAAAGATATGTCTTGC  1310509

Query  2821     CTTATTCCTGAGAATTTAAGGAACCCCAAAAAGGTTCACGAAAATAGATTGCCTACTAGG  2880
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310510  CTTATTCCTGAGAATTTAAGGAACCCCAAAAAGGTTCACGAAAATAGATTGCCTACTAGG  1310569

Query  2881     GCTTACTACTATGATCAGGATATTTTCGAATCTCTCAATGGGCCTTGGGCTTTTGCGTTG  2940
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310570  GCTTACTACTATGATCAGGATATTTTCGAATCTCTCAATGGGCCTTGGGCTTTTGCGTTG  1310629

Query  2941     TTTGATGCACCTCTTGACGCTCCGGATGCTAAGAATTTAGACTGGGAAACGGCAAAGAAA  3000
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310630  TTTGATGCACCTCTTGACGCTCCGGATGCTAAGAATTTAGACTGGGAAACGGCAAAGAAA  1310689

Query  3001     TGGAGCACCATTTCTGTGCCATCCCATTGGGAACTTCAGGAAGACTGGAAGTACGGTAAA  3060
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310690  TGGAGCACCATTTCTGTGCCATCCCATTGGGAACTTCAGGAAGACTGGAAGTACGGTAAA  1310749

Query  3061     CCAATTTACACGAACGTACAGTACCCTATCCCAATCGACATCCCAAATCCTCCCACTGTA  3120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310750  CCAATTTACACGAACGTACAGTACCCTATCCCAATCGACATCCCAAATCCTCCCACTGTA  1310809

Query  3121     AATCCTACTGGTGTTTATGCTAGAACTTTTGAATTAGATTCGAAATCGATTGAGTCGTTC  3180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310810  AATCCTACTGGTGTTTATGCTAGAACTTTTGAATTAGATTCGAAATCGATTGAGTCGTTC  1310869

Query  3181     GAGCACAGATTGAGATTTGAGGGTGTGGACAATTGTTACGAGCTTTATGTTAATGGTCAA  3240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310870  GAGCACAGATTGAGATTTGAGGGTGTGGACAATTGTTACGAGCTTTATGTTAATGGTCAA  1310929

Query  3241     TATGTGGGTTTCAATAAGGGGTCCCGTAACGGGGCTGAATTTGATATCCAAAAGTACGTT  3300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310930  TATGTGGGTTTCAATAAGGGGTCCCGTAACGGGGCTGAATTTGATATCCAAAAGTACGTT  1310989

Query  3301     TCTGAGGGCGAAAACTTAGTGGTCGTCAAGGTTTTCAAGTGGTCCGATTCCACTTATATC  3360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310990  TCTGAGGGCGAAAACTTAGTGGTCGTCAAGGTTTTCAAGTGGTCCGATTCCACTTATATC  1311049

Query  3361     GAGGACCAAGATCAATGGTGGCTCTCTGGTATTTACAGAGACGTTTCTTTACTAAAATTG  3420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311050  GAGGACCAAGATCAATGGTGGCTCTCTGGTATTTACAGAGACGTTTCTTTACTAAAATTG  1311109

Query  3421     CCTAAGAAGGCCCATATTGAAGACGTTAGGGTCACTACAACTTTTGTGGACTCTCAGTAT  3480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311110  CCTAAGAAGGCCCATATTGAAGACGTTAGGGTCACTACAACTTTTGTGGACTCTCAGTAT  1311169

Query  3481     CAGGATGCAGAGCTTTCTGTGAAAGTTGATGTCCAGGGTTCTTCTTATGATCACATCAAT  3540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311170  CAGGATGCAGAGCTTTCTGTGAAAGTTGATGTCCAGGGTTCTTCTTATGATCACATCAAT  1311229

Query  3541     TTCACACTTTACGAACCTGAAGATGGATCTAAAGTTTACGATGCAAGCTCTTTGTTGAAC  3600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311230  TTCACACTTTACGAACCTGAAGATGGATCTAAAGTTTACGATGCAAGCTCTTTGTTGAAC  1311289

Query  3601     GAGGAGAATGGGAACACGACTTTTTCAACTAAAGAATTTATTTCCTTCTCCACCAAAAAG  3660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311290  GAGGAGAATGGGAACACGACTTTTTCAACTAAAGAATTTATTTCCTTCTCCACCAAAAAG  1311349

Query  3661     AACGAAGAAACAGCTTTCAAGATCAACGTCAAGGCCCCAGAACATTGGACCGCAGAAAAT  3720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311350  AACGAAGAAACAGCTTTCAAGATCAACGTCAAGGCCCCAGAACATTGGACCGCAGAAAAT  1311409

Query  3721     CCTACTTTGTACAAGTACCAGTTGGATTTAATTGGATCTGATGGCAGTGTGATTCAATCT  3780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311410  CCTACTTTGTACAAGTACCAGTTGGATTTAATTGGATCTGATGGCAGTGTGATTCAATCT  1311469

Query  3781     ATTAAGCACCATGTTGGTTTCAGACAAGTGGAGTTGAAGGACGGTAACATTACTGTTAAT  3840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311470  ATTAAGCACCATGTTGGTTTCAGACAAGTGGAGTTGAAGGACGGTAACATTACTGTTAAT  1311529

Query  3841     GGCAAAGACATTCTCTTTAGAGGTGTCAACAGACATGATCACCATCCAAGGTTCGGTAGA  3900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311530  GGCAAAGACATTCTCTTTAGAGGTGTCAACAGACATGATCACCATCCAAGGTTCGGTAGA  1311589

Query  3901     GCTGTGCCATTAGATTTTGTTGTTAGGGACTTGATTCTAATGAAGAAGTTTAACATCAAT  3960
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311590  GCTGTGCCATTAGATTTTGTTGTTAGGGACTTGATTCTAATGAAGAAGTTTAACATCAAT  1311649

Query  3961     GCTGTTCGTAACTCGCATTATCCAAACCATCCTAAGGTGTATGACCTCTTCGATAAGCTG  4020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311650  GCTGTTCGTAACTCGCATTATCCAAACCATCCTAAGGTGTATGACCTCTTCGATAAGCTG  1311709

Query  4021     GGCTTCTGGGTCATTGACGAGGCAGATCTTGAAACTCATGGTGTTCAAGAGCCATTTAAT  4080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311710  GGCTTCTGGGTCATTGACGAGGCAGATCTTGAAACTCATGGTGTTCAAGAGCCATTTAAT  1311769

Query  4081     CGTCATACGAACTTGGAGGCTGAATATCCAGATACTAAAAATAAACTCTACGATGTTAAT  4140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311770  CGTCATACGAACTTGGAGGCTGAATATCCAGATACTAAAAATAAACTCTACGATGTTAAT  1311829

Query  4141     GCCCATTACTTATCAGATAATCCAGAGTACGAGGTCGCGTACTTAGACAGAGCTTCCCAA  4200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311830  GCCCATTACTTATCAGATAATCCAGAGTACGAGGTCGCGTACTTAGACAGAGCTTCCCAA  1311889

Query  4201     CTTGTCCTAAGAGATGTCAATCATCCTTCGATTATTATCTGGTCCTTGGGTAACGAAGCT  4260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311890  CTTGTCCTAAGAGATGTCAATCATCCTTCGATTATTATCTGGTCCTTGGGTAACGAAGCT  1311949

Query  4261     TGTTATGGCAGAAACCACAAAGCCATGTACAAGTTAATTAAACAATTGGATCCTACCAGA  4320
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1311950  TGTTATGGCAGAAACCACAAAGCCATGTACAAGTTAATTAAACAATTGGATCCTACCAGA  1312009

Query  4321     CTTGTGCATTATGAGGGTGACTTGAACGCTTTGAGTGCAGATATCTTTAGTTTCATGTAC  4380
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312010  CTTGTGCATTATGAGGGTGACTTGAACGCTTTGAGTGCAGATATCTTTAGTTTCATGTAC  1312069

Query  4381     CCAACATTTGAAATTATGGAAAGGTGGAGGAAGAACCACACTGATGAAAATGGTAAGTTT  4440
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312070  CCAACATTTGAAATTATGGAAAGGTGGAGGAAGAACCACACTGATGAAAATGGTAAGTTT  1312129

Query  4441     GAAAAGCCTTTGATCTTGTGTGAGTACGGCCATGCAATGGGTAACGGTCCTGGCTCTTTG  4500
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312130  GAAAAGCCTTTGATCTTGTGTGAGTACGGCCATGCAATGGGTAACGGTCCTGGCTCTTTG  1312189

Query  4501     AAAGAATATCAAGAGTTGTTCTACAAGGAGAAGTTTTACCAAGGTGGCTTTATCTGGGAA  4560
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312190  AAAGAATATCAAGAGTTGTTCTACAAGGAGAAGTTTTACCAAGGTGGCTTTATCTGGGAA  1312249

Query  4561     TGGGCAAATCACGGTATTGAATTCGAAGATGTTAGTACTGCAGATGGTAAGTTGCATAAA  4620
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312250  TGGGCAAATCACGGTATTGAATTCGAAGATGTTAGTACTGCAGATGGTAAGTTGCATAAA  1312309

Query  4621     GCTTATGCTTATGGTGGTGACTTTAAGGAAGAGGTTCATGACGGAGTGTTCATCATGGAT  4680
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312310  GCTTATGCTTATGGTGGTGACTTTAAGGAAGAGGTTCATGACGGAGTGTTCATCATGGAT  1312369

Query  4681     GGTTTGTGTAACAGTGAGCATAATCCTACTCCGGGCCTTGTAGAGTATAAGAAGGTTATT  4740
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312370  GGTTTGTGTAACAGTGAGCATAATCCTACTCCGGGCCTTGTAGAGTATAAGAAGGTTATT  1312429

Query  4741     GAACCCGTTCATATTAAAATTGCGCACGGATCTGTAACAATCACAAATAAGCACGACTTC  4800
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312430  GAACCCGTTCATATTAAAATTGCGCACGGATCTGTAACAATCACAAATAAGCACGACTTC  1312489

Query  4801     ATTACGACAGACCACTTATTGTTTATCGACAAGGACACGGGAAAGACAATCGACGTTCCA  4860
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312490  ATTACGACAGACCACTTATTGTTTATCGACAAGGACACGGGAAAGACAATCGACGTTCCA  1312549

Query  4861     TCTTTAAAGCCAGAAGAATCTGTTACTATTCCTTCTGATACAACTTATGTTGTTGCCGTG  4920
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312550  TCTTTAAAGCCAGAAGAATCTGTTACTATTCCTTCTGATACAACTTATGTTGTTGCCGTG  1312609

Query  4921     TTGAAAGATGATGCTGGTGTTCTAAAGGCAGGTCATGAAATTGCCTGGGGCCAAGCTGAA  4980
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312610  TTGAAAGATGATGCTGGTGTTCTAAAGGCAGGTCATGAAATTGCCTGGGGCCAAGCTGAA  1312669

Query  4981     CTTCCATTGAAGGTACCCGATTTTGTTACAGAGACAGCAGAAAAAGCTGCGAAGATCAAC  5040
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312670  CTTCCATTGAAGGTACCCGATTTTGTTACAGAGACAGCAGAAAAAGCTGCGAAGATCAAC  1312729

Query  5041     GACGGTAAACGTTATGTCTCAGTTGAATCCAGTGGATTGCATTTTATCTTGGACAAATTG  5100
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312730  GACGGTAAACGTTATGTCTCAGTTGAATCCAGTGGATTGCATTTTATCTTGGACAAATTG  1312789

Query  5101     TTGGGTAAAATTGAAAGCCTAAAGGTCAAGGGTAAGGAAATTTCCAGCAAGTTTGAGGGT  5160
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312790  TTGGGTAAAATTGAAAGCCTAAAGGTCAAGGGTAAGGAAATTTCCAGCAAGTTTGAGGGT  1312849

Query  5161     TCTTCAATCACTTTCTGGAGACCTCCAACGAATAATGATGAACCTAGGGACTTTAAGAAC  5220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312850  TCTTCAATCACTTTCTGGAGACCTCCAACGAATAATGATGAACCTAGGGACTTTAAGAAC  1312909

Query  5221     TGGAAGAAGTACAATATTGATTTAATGAAGCAAAACATCCATGGAGTGAGTGTCGAAAAA  5280
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312910  TGGAAGAAGTACAATATTGATTTAATGAAGCAAAACATCCATGGAGTGAGTGTCGAAAAA  1312969

Query  5281     GGTTCTAATGGTTCTCTAGCTGTAGTCACGGTTAACTCTCGTATATCCCCAGTTGTATTT  5340
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1312970  GGTTCTAATGGTTCTCTAGCTGTAGTCACGGTTAACTCTCGTATATCCCCAGTTGTATTT  1313029

Query  5341     TACTATGGGTTTGAGACTGTTCAGAAGTACACGATCTTTGCTAACAAAATAAACTTGAAC  5400
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313030  TACTATGGGTTTGAGACTGTTCAGAAGTACACGATCTTTGCTAACAAAATAAACTTGAAC  1313089

Query  5401     ACTTCTATGAAGCTTACTGGCGAATATCAGCCTCCTGATTTCCCAAGAGTTGGGTACGAA  5460
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313090  ACTTCTATGAAGCTTACTGGCGAATATCAGCCTCCTGATTTCCCAAGAGTTGGGTACGAA  1313149

Query  5461     TTCTGGCTAGGAGATAGTTATGAATCATTTGAATGGTTAGGTCGCGGGCCCGGCGAATCA  5520
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313150  TTCTGGCTAGGAGATAGTTATGAATCATTTGAATGGTTAGGTCGCGGGCCCGGCGAATCA  1313209

Query  5521     TATCCGGATAAGAAGGAATCTCAAAGATTCGGTCTTTACGATTCCAAAGATGTAGAGGAA  5580
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313210  TATCCGGATAAGAAGGAATCTCAAAGATTCGGTCTTTACGATTCCAAAGATGTAGAGGAA  1313269

Query  5581     TTCGTATATGACTATCCTCAAGAAAATGGAAATCATACAGATACCCACTTTTTGAACATC  5640
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313270  TTCGTATATGACTATCCTCAAGAAAATGGAAATCATACAGATACCCACTTTTTGAACATC  1313329

Query  5641     AAATTTGAAGGTGCAGGAAAACTATCGATCTTCCAAAAGGAGAAGCCATTTAACTTCAAG  5700
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313330  AAATTTGAAGGTGCAGGAAAACTATCGATCTTCCAAAAGGAGAAGCCATTTAACTTCAAG  1313389

Query  5701     ATTTCAGACGAATACGGGGTTGATGAAGCTGCCCACGCTTGTGACGTTAAAAGATACGGC  5760
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313390  ATTTCAGACGAATACGGGGTTGATGAAGCTGCCCACGCTTGTGACGTTAAAAGATACGGC  1313449

Query  5761     AGACACTATCTAAGGTTGGACCATGCAATCCATGGTGTTGGTAGCGAAGCATGCGGACCT  5820
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313450  AGACACTATCTAAGGTTGGACCATGCAATCCATGGTGTTGGTAGCGAAGCATGCGGACCT  1313509

Query  5821     GCTGTTCTGGACCAGTACAGATTGAAAGCTCAAGATTTCAACTTTGAGTTTGATCTCGCT  5880
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313510  GCTGTTCTGGACCAGTACAGATTGAAAGCTCAAGATTTCAACTTTGAGTTTGATCTCGCT  1313569

Query  5881     TTTGAATAAGAATTTTATACTTAGATAAGTATGTACTTACAGGTATATTTCTATGAGATA  5940
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313570  TTTGAATAAGAATTTTATACTTAGATAAGTATGTACTTACAGGTATATTTCTATGAGATA  1313629

Query  5941     CTGATGTATACATGCATGATAATATTTAAACGGTTATTAGTGCCGATTGTCTTGTGCGAT  6000
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313630  CTGATGTATACATGCATGATAATATTTAAACGGTTATTAGTGCCGATTGTCTTGTGCGAT  1313689

Query  6001     AATGACGTTCCTATCAAAGCAATACACTTACCACCTATTACATGGGCCAAGAAAATATTT  6060
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313690  AATGACGTTCCTATCAAAGCAATACACTTACCACCTATTACATGGGCCAAGAAAATATTT  1313749

Query  6061     TCGAACTTGTTTAGAATATTAGCACAGAGTATATGATGATATCCGTTAGATTATGCATGA  6120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313750  TCGAACTTGTTTAGAATATTAGCACAGAGTATATGATGATATCCGTTAGATTATGCATGA  1313809

Query  6121     TTCATTCCTACAACTTTTTCGTAGCATAAGGATTAATTACTTGGATGCCAATAAAAAAAA  6180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313810  TTCATTCCTACAACTTTTTCGTAGCATAAGGATTAATTACTTGGATGCCAATAAAAAAAA  1313869

Query  6181     AAAACATCGAGAAAATTTCAGCATGCTCAGAAACAATTGCAGTGTATCAAAGTAAAAAAA  6240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313870  AAAACATCGAGAAAATTTCAGCATGCTCAGAAACAATTGCAGTGTATCAAAGTAAAAAAA  1313929

Query  6241     AGATTTTCACTACATGTTCCTTTTGAAGAAAGAAAATCATGGAACATTAGATTTACAAAA  6300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313930  AGATTTTCACTACATGTTCCTTTTGAAGAAAGAAAATCATGGAACATTAGATTTACAAAA  1313989

Query  6301     ATTTAACCACCGCTGATTAACGATTAGACCGTTAAGCGCACAACAGGTTATTAGTACAGA  6360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1313990  ATTTAACCACCGCTGATTAACGATTAGACCGTTAAGCGCACAACAGGTTATTAGTACAGA  1314049

Query  6361     GAAAGCATTCTGTGGTGTTGCCCCGGACTTTCTTTTGCGACATAGGTAAATCGAATACCA  6420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314050  GAAAGCATTCTGTGGTGTTGCCCCGGACTTTCTTTTGCGACATAGGTAAATCGAATACCA  1314109

Query  6421     TCATACTATCTTTTCCAATGACTCCCTAAAGAAAGACTCTTCTTCGATGTTGTATACGTT  6480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314110  TCATACTATCTTTTCCAATGACTCCCTAAAGAAAGACTCTTCTTCGATGTTGTATACGTT  1314169

Query  6481     GGAGCATAGGGCAAGAATTGTGGCTTGAGATCTAGATTACGTGGAAGAAAGGTAGTAAAA  6540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314170  GGAGCATAGGGCAAGAATTGTGGCTTGAGATCTAGATTACGTGGAAGAAAGGTAGTAAAA  1314229

Query  6541     GTAGTAGTATAAGTAGTAAAAAGAGGTAAAAAGAGAAAACCGGCTACATACTAGAGAAGC  6600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314230  GTAGTAGTATAAGTAGTAAAAAGAGGTAAAAAGAGAAAACCGGCTACATACTAGAGAAGC  1314289

Query  6601     ACGTACACAAAAACTCATAGGCACTTCATCATACGACAGTTTCTTGATGCATTATAATAG  6660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314290  ACGTACACAAAAACTCATAGGCACTTCATCATACGACAGTTTCTTGATGCATTATAATAG  1314349

Query  6661     TGTATTAGATATTTTCAGAAATATGCATAGAACCTCCTCTTGCCTTTACTTTTTATACAT  6720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314350  TGTATTAGATATTTTCAGAAATATGCATAGAACCTCCTCTTGCCTTTACTTTTTATACAT  1314409

Query  6721     AGAACATTGGCAGATTTACTTACACTACTTTGTTTCTACGCCATTTCTTTTGTTTTCAAC  6780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314410  AGAACATTGGCAGATTTACTTACACTACTTTGTTTCTACGCCATTTCTTTTGTTTTCAAC  1314469

Query  6781     ACTTAGACAAGTTGTTGAGAACCGGACTACTAAAAAGCAATGTTCCCACTGAAAATCATG  6840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314470  ACTTAGACAAGTTGTTGAGAACCGGACTACTAAAAAGCAATGTTCCCACTGAAAATCATG  1314529

Query  6841     TACCTGCAGGATAATAACCCCCTAATTCTGCATCGATCCAGTATGTTTTTTTTTCTCTAC  6900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314530  TACCTGCAGGATAATAACCCCCTAATTCTGCATCGATCCAGTATGTTTTTTTTTCTCTAC  1314589

Query  6901     TCATTTTTACCTGAAGATAGAGCTTCTAAAACAAAAAAAATCAGTGATTACATGCATATT  6960
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314590  TCATTTTTACCTGAAGATAGAGCTTCTAAAACAAAAAAAATCAGTGATTACATGCATATT  1314649

Query  6961     GTGTGTTCTAGAATTGCGGATCACCAGATCGCCATTACAATGTATGCAGGCAAATATTTC  7020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314650  GTGTGTTCTAGAATTGCGGATCACCAGATCGCCATTACAATGTATGCAGGCAAATATTTC  1314709

Query  7021     TCAGAATGAAAAATAGAGAAAAGGAAACGAAAATTCTGTAAGATGCCTTCGAAGAGATTT  7080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314710  TCAGAATGAAAAATAGAGAAAAGGAAACGAAAATTCTGTAAGATGCCTTCGAAGAGATTT  1314769

Query  7081     CTCGATATGCAAGGCGTGCATCAGGGTGATCCAAAGGAACTCGAGAGAGAGGGCGAAAGG  7140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314770  CTCGATATGCAAGGCGTGCATCAGGGTGATCCAAAGGAACTCGAGAGAGAGGGCGAAAGG  1314829

Query  7141     CAATTTAATGCATTGCTTCTCCATTGACTTCTAGTTGAGCGGATAAGTTCGGAAATGTAA  7200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314830  CAATTTAATGCATTGCTTCTCCATTGACTTCTAGTTGAGCGGATAAGTTCGGAAATGTAA  1314889

Query  7201     GTCACAGCTAATGACAAATCCACTTTAGGTTTCGAGGCACTATTTAGGCAAAAAGACGAG  7260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314890  GTCACAGCTAATGACAAATCCACTTTAGGTTTCGAGGCACTATTTAGGCAAAAAGACGAG  1314949

Query  7261     TGGGGAAATAACAAACGCTCAAACATATTAGCATATACGTTCAAAAAATGG  7311
                |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1314950  TGGGGAAATAACAAACGCTCAAACATATTAGCATATACGTTCAAAAAATGG  1315000


 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 38/47 (81%), Gaps = 1/47 (2%)
 Strand=Plus/Plus

Query  2764    AAAAATAAAAAAAAAATAAACACACATACTCATCGAGAACTGAAAGA  2810
               ||||| ||| || ||| ||||||||||| |||| ||||  ||| |||
Sbjct  325701  AAAAAAAAACAACAAACAAACACACATATTCAT-GAGAGATGACAGA  325746


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 29/34 (86%), Gaps = 3/34 (8%)
 Strand=Plus/Plus

Query  1300  TTTTTCATTTTTTATTTTCCATTTTTCAGTTTTT  1333
             |||||||||||||| |||   ||||||| |||||
Sbjct  737   TTTTTCATTTTTTAATTT---TTTTTCATTTTTT  767


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  6164    GATGCCAATAAAAAAAAAAAACATCGAGAAAA  6195
               |||||||| ||||||||||||  || ||||||
Sbjct  657316  GATGCCAAAAAAAAAAAAAAAACTC-AGAAAA  657346


> AEAV01000200  Kluyveromyces wickerhamii UCD 54-210 contig00208, 
whole genome shotgun sequence
Length=27421

 Score =  897 bits (994),  Expect = 0.0
 Identities = 1521/2189 (70%), Gaps = 52/2189 (2%)
 Strand=Plus/Minus

Query  3702   ACATTGGACCGCAGAAAATCCTACTTTGTACAAGTACCAGTTGGATTTAATTGGATCTGA  3761
              ||||||||| |||||| |||| | ||| ||||| | | || ||||||| || |   |   
Sbjct  16819  ACATTGGACAGCAGAAGATCCAATTTTATACAAATTCAAGCTGGATTTGATCGATGCCAC  16760

Query  3762   TGGCAGTGTGATTCAATCTATTAAGCACCATGTTGGTTTCAGACAAGTGGAGTTGAAGGA  3821
              |   | |||||||||| |||||   || || ||||| ||||||||||| || ||   | |
Sbjct  16759  TTCAAATGTGATTCAAACTATTTTCCATCACGTTGGGTTCAGACAAGTTGAATTACTGAA  16700

Query  3822   CGGTAACATTACTGTTAATGGCAAAGACATTCTCTTTAGAGGTGTCAACAGACATGATCA  3881
              |||||| || || || ||||||||||| ||  | || ||||| |||||||||||||||||
Sbjct  16699  CGGTAATATAACCGTCAATGGCAAAGATATCTTATTCAGAGGGGTCAACAGACATGATCA  16640

Query  3882   CCATCCAAGGTTCGGTAGAGCTGTGCCATTAGATTTTGTTGTTAGGGACTTGATTCTAAT  3941
               || ||||||||||| ||| |  | || || ||||||||| | || || || | ||||||
Sbjct  16639  TCACCCAAGGTTCGGAAGATCCATTCCTTTGGATTTTGTTATCAGAGATTTAACTCTAAT  16580

Query  3942   GAAGAAGTTTAACATCAATGCTGTTCGTAACTCGCATTATCCAAACCATCCTAAGGTGTA  4001
              |||| |    |||||||||||||| ||||  || ||||||||||||||||| |  || ||
Sbjct  16579  GAAGCAACACAACATCAATGCTGTACGTACATCACATTATCCAAACCATCCAAGAGTCTA  16520

Query  4002   TGACCTCTTCGATAAGCTGGGCTTCTGGGTCATTGACGAGGCAGATCTTGAAACTCATGG  4061
              ||| || ||||| ||  |||| |||||||| || || || || ||| | || || |||||
Sbjct  16519  TGATCTTTTCGACAAATTGGGATTCTGGGTTATCGATGAAGCCGATTTAGAGACACATGG  16460

Query  4062   TGTTCAAGAGCCATTTAATCGTCATACGAACTTGGAGGCTGAATATCCAGATACTAAAAA  4121
                ||||||| || | |||| | |||   ||  |   |||||| ||| | || || |||||
Sbjct  16459  CCTTCAAGATCCTTATAATAGACATGAAAATGTCACGGCTGAGTATGCTGACACGAAAAA  16400

Query  4122   TAAACTCTACGATGTTAATGCCCATTACTTATCAGATAATCCAGAGTACGAGGTCGCGTA  4181
              ||| | ||| ||||| ||||| ||||| || || |||||||| || |  |||   |||||
Sbjct  16399  TAAGCACTATGATGTCAATGCTCATTATTTGTCTGATAATCCTGATTGGGAGACTGCGTA  16340

Query  4182   CTTAGACAGAGCTTCCCAACTTGTCCTAAGAGATGTCAATCATCCTTCGATTATTATCTG  4241
              |||||||||||| ||||| || ||  || | ||  | || ||||| || || || || ||
Sbjct  16339  CTTAGACAGAGCATCCCAGCTAGTTTTACGTGACATAAACCATCCCTCCATAATAATTTG  16280

Query  4242   GTCCTTGGGTAACGAAGCTTGTTATGGCAGAAACCACAAAGCCATGTACAAGTTAATTAA  4301
              |||  | || || ||| | || || |||||||| |||||||||||||| ||||| || ||
Sbjct  16279  GTCTCTAGGGAATGAATCATGCTACGGCAGAAATCACAAAGCCATGTATAAGTTGATCAA  16220

Query  4302   ACAATTGGATCCTACCAGACTTGTGCATTATGAGGGTGACTTGAACGCTTTGAGTGCAGA  4361
              |||||| ||||| || ||||| || || || || ||||| ||||||||| |   ||| ||
Sbjct  16219  ACAATTAGATCCAACTAGACTGGTTCACTACGAAGGTGATTTGAACGCTGTCTCTGCCGA  16160

Query  4362   TATCTTTAGTTTCATGTACCCAACATTTGAAATTATGGAAAGGTGGAGGAAGAACCACAC  4421
               || |  ||||| ||||||||||||   |||||||||||||  ||||| ||    || ||
Sbjct  16159  CATGTACAGTTTTATGTACCCAACACCAGAAATTATGGAAAACTGGAGAAAAGCTCATAC  16100

Query  4422   TGATGAAAATGGTAAGTTTGAAAAGCCTTTGATCTTGTGTGAGTACGGCCATGCAATGGG  4481
              |||||||  ||| || ||||| || || |||||||| ||||| || |||||||| |||||
Sbjct  16099  TGATGAAGCTGGAAACTTTGACAAACCGTTGATCTTATGTGAATATGGCCATGCGATGGG  16040

Query  4482   TAACGGTCCTGGCTCTTTGAAAGAATATCAAGAGTTGTTCTACAAGGAGAAGTTTTACCA  4541
              ||| || || || || ||||| ||||| || ||| | || ||     | || || || ||
Sbjct  16039  TAATGGGCCAGGATCCTTGAAGGAATACCAGGAGCTATTTTATGGAAACAAATTCTATCA  15980

Query  4542   AGGTGGCTTTATCTGGGAATGGGCAAATCACGGTATTGAATTCGAAGATGTTAGTACTGC  4601
              |||||| || |||||||||||||| ||||| ||||| ||||| ||   ||||||||    
Sbjct  15979  AGGTGGTTTCATCTGGGAATGGGCCAATCATGGTATCGAATTTGAGACTGTTAGTAAAAA  15920

Query  4602   AGATGGTAAGTTGCATAAAGCTTATGCTTATGGTGGTGACTTTAAGGAAGAGGTTCATGA  4661
               || |||||    || ||||| ||||| |||||||||||||| || |||||  | |||||
Sbjct  15919  TGACGGTAAACGTCACAAAGCGTATGCATATGGTGGTGACTTCAACGAAGAAATCCATGA  15860

Query  4662   CGGAGTGTTCATCATGGATGGTTTGTGTAACAGTGAGCATAATCCTACTCCGGGCCTTGT  4721
               || || ||||| ||||| ||||| |  |||  ||| ||||| || || || ||| |  |
Sbjct  15859  TGGCGTATTCATTATGGACGGTTTATTGAACTCTGAACATAACCCAACACCAGGCTTGAT  15800

Query  4722   AGAGTATAAGAAGGTTATTGAACCCGTTCAT---ATTAAAATTGCGCACGGATCTGTAAC  4778
               |||||||| ||    |||||||| ||||||    |||  | ||   | | |   |||| 
Sbjct  15799  TGAGTATAAAAAAACGATTGAACCGGTTCATGTAGTTATTAATGATAAAGAA---GTAAT  15743

Query  4779   AATCACAAATAAGCACGACTTCATTACGACAGACCACTTATTGTTTATCGACAAGGACAC  4838
                ||||||| ||  | ||||| || || || || || |||   || |  ||    |||| 
Sbjct  15742  TGTCACAAACAAATATGACTTTATCACAACTGATCATTTAGAATTCAGAGATGTCGACAA  15683

Query  4839   GGGAAAGACAATCGACGTTCCATCTTTAAAGCCAGAAGAATCTGTTACT------ATTCC  4892
                  || |  || || |||||| | || || || |||||||| ||||||      ||| |
Sbjct  15682  CAACAAAATTATTGAAGTTCCAACATTGAAACCGGAAGAATCCGTTACTTTGGCGATTAC  15623

Query  4893   TTCTGATACAACTTATGTTGTTGCCGTGTTGAAAGATGATGCTGGTGTTCTAAAGGCAGG  4952
              | ||| ||  |  | |||||||      ||||||  ||||| ||||||| | || |||||
Sbjct  15622  TACTGGTAATATATCTGTTGTT------TTGAAAAGTGATGTTGGTGTTTTGAAAGCAGG  15569

Query  4953   TCATGAAATTGCCTGGGGCCAAGCTGAACTTCCATTGAAGGTACCCGATTTTGTTACAGA  5012
              |||||| ||| ||||||| |||    || |  | |  | | |||        ||| ||||
Sbjct  15568  TCATGAGATTTCCTGGGGTCAA----AAAT--CTTACACGCTAC------AAGTTCCAGA  15521

Query  5013   G-ACAGCAGAAAAAG-CTG--CGAAG--------ATCAACG--ACGGTAAACGTTATGTC  5058
              |  ||| |  |||||  ||  |||||        || || |  |||| | |  || || |
Sbjct  15520  GTTCAGAACTAAAAGTGTGATCGAAGGGGCTTCTATTAAAGAAACGGCAGAATTTGTGAC  15461

Query  5059   -TCAGTTGAATCCAGTGGATTGCATTTTATCTTGGACAAATTGTTGGGTAAAATTGAAAG  5117
               | |  || |   ||   || | | ||||  ||  ||||| | |  ||||| || ||| |
Sbjct  15460  TTTATCTGGA--AAGAACATAG-AATTTAAGTTCAACAAACTATATGGTAAGATCGAAGG  15404

Query  5118   CCTAAAGGTCAAGGGTAAGGAAATTTCCAGCAAGTTTGAGGGTTCTTCAATCACTTTCTG  5177
              | ||    | ||   |||| ||||||  |  || || || || || || |||||||||||
Sbjct  15403  CTTATCTATTAACAATAAGAAAATTTGTACTAAATTCGATGGCTCCTCGATCACTTTCTG  15344

Query  5178   GAGACCTCCAACGAATAATGATGAACCTAGGGACTTTAAGAACTGGAAGAAGTACAATAT  5237
              |||||||||||| ||||||||||   | |  ||  || |  | ||||| ||||| ||| |
Sbjct  15343  GAGACCTCCAACAAATAATGATGCTGCAAAAGATGTTGATCATTGGAAAAAGTATAATGT  15284

Query  5238   TGATTTAATGAAGCAAAACATCCATGGAGTGAGTGTCGAA-AAAGGTTCTAATGGTTCTC  5296
              | || | |  || |||||| | || | ||| |   | ||| |  ||  || |  || || 
Sbjct  15283  TCATCTCACTAAACAAAACGTTCACGAAGTTACACTTGAAGAGGGGAACTCAGAGTACT-  15225

Query  5297   TAGCTGTAG-TCACGGTTAACTCTCGTATATCCCCAGTTGTATTTTACTATGGGTTTGAG  5355
              | || | || |    || || ||  |  |   |||    |||||||| ||||| || || 
Sbjct  15224  TGGC-GAAGATTGTAGTAAAATCAAGGGTTGGCCCTCCAGTATTTTATTATGGTTTCGAA  15166

Query  5356   ACTGTTCAGAAGTACACGATCTTTGCTAACAAAATAAACTTGAACACTTCTATGAAGCTT  5415
              ||    ||  | ||||  |||||  |||| ||| |||  ||  ||||||| ||||  || 
Sbjct  15165  ACCACGCAAGAATACATTATCTTACCTAATAAATTAAGTTTACACACTTCGATGAGACTA  15106

Query  5416   ACTGGCGAATATCAGCCTCCTGATTTCCCAAGAGTTGGGTACGAATTCTGGCTAGGAGAT  5475
              || || ||||| || ||   |||  | ||  | ||||| || ||||||||| | || |||
Sbjct  15105  ACAGGTGAATACCAACCAAATGACCTACCTCGTGTTGGATATGAATTCTGGTTGGGTGAT  15046

Query  5476   AGTTATGAATCATTTGAATGGTTAGGTCGCGGGCCCGGCGAATCATATCCGGATAAGAAG  5535
              |  |||||||| | |   ||||| ||||| || || || || || ||||| |||||||| 
Sbjct  15045  AACTATGAATCCTATAGGTGGTTTGGTCGTGGTCCAGGAGAGTCTTATCCAGATAAGAAA  14986

Query  5536   GAATCTCAAAGATTCGGTCTTTACGATTCCAAAGATGTAGAGGAATTCGTATATGACTAT  5595
              || ||||||| | | || || |   | || |  |||||    || || || |||||||| 
Sbjct  14985  GAGTCTCAAAAAGTTGGCCTGTTTAACTCGAGTGATGTGATTGATTTTGTTTATGACTAC  14926

Query  5596   CCTCAAGAAAATGGAAATCATACAGATACCCACTTTTTGAACATCAAATTTGAAGGTGCA  5655
              || ||||||||||| ||||| |||||||| || || ||  | ||  |||   | | ||||
Sbjct  14925  CCGCAAGAAAATGGGAATCACACAGATACTCATTTCTTAGAGATTGAATACAAGGATGCA  14866

Query  5656   GGAAAACTATCGATCTTCCAAAAGGAGAAGCCATTTAACTTCAAGATTTCAGACGAATAC  5715
              |||||| |    |||  | || |    ||  | || ||||| ||||||   || ||||| 
Sbjct  14865  GGAAAATTGGTAATCACCGAAGATAGTAAAACTTTCAACTTTAAGATTAGTGATGAATAT  14806

Query  5716   GGGGTTGATGAAGCTGCCCACGCTTGTGACGTTAAAAGATACGGCAGACACTATCTAAGG  5775
                 ||||| || || |  ||  | || || ||||||   ||   ||   | ||| |  | 
Sbjct  14805  AACGTTGAAGAGGCAGATCATCCATGCGATGTTAAACACTATACCAACAAGTATGTTCGT  14746

Query  5776   TTGGACCATGCAATCCATGGTGTTGGTAGCGAAGCATGCGGACCTGCTGTTCTGGACCAG  5835
              || || |||||||| |||||||||||    ||||| || |||||| ||||| | ||  ||
Sbjct  14745  TTAGATCATGCAATGCATGGTGTTGGATCAGAAGCTTGTGGACCTCCTGTTTTTGATGAG  14686

Query  5836   TACAGATTGAAAGCTCAAGATTTCAACTT  5864
              |||||| | ||||| ||||| ||  ||||
Sbjct  14685  TACAGACTAAAAGCACAAGACTTTGACTT  14657


 Score =  228 bits (252),  Expect = 7e-58
 Identities = 405/587 (69%), Gaps = 23/587 (3%)
 Strand=Plus/Minus

Query  2834   ATTTAAGGAACCCCAAAAAGGTTCACGAAAATAGATTGCCTACTAGGGCTTACTACTATG  2893
              ||||||| |||||||||  |||||| ||||| |||||||| || || || ||  | || |
Sbjct  17666  ATTTAAGAAACCCCAAACTGGTTCATGAAAACAGATTGCCCACAAGAGCGTATCATTACG  17607

Query  2894   ATCAGGATATTTTCGAATCTCTCAATGGGCCTTGGGCTTTTGCGTTGTTTGATGCACCTC  2953
              | |  || |||| |   || || ||||| || ||||||||    |||||||| || ||| 
Sbjct  17606  ACCCCGAAATTTCCACGTCGCTGAATGGTCCGTGGGCTTTCAGTTTGTTTGAAGCTCCTT  17547

Query  2954   TTGACGCTCCGGATGCTAAGAATTTAGACTGGGAAACG-GCA----AAGAAATGGAGCAC  3008
               ||  || || ||| | |  ||      |||| ||| | | |    ||||| |||  | |
Sbjct  17546  CTGTGGCGCCAGATCCGACCAAG-----CTGGCAAAAGAGGACTTCAAGAACTGGGACTC  17492

Query  3009   CATTTCTGTGCCATCCCATTGGGAACTTCAGGAAGACTGGAAGTACGGTAAACCAATTTA  3068
               || || || || || || ||| |||| ||||| | |   |||||||||   ||   |||
Sbjct  17491  TATCTCGGTTCCGTCTCACTGGCAACTGCAGGACGGC---AAGTACGGTGCTCCGGCTTA  17435

Query  3069   CACGAACGTACAGTACCCTATCCCAATCGACATCCCAAATCCTCCCACTGTAAATCCTAC  3128
              ||| ||||| ||||| ||  |||  |||||||| ||||| || || ||| | ||||| ||
Sbjct  17434  CACAAACGTCCAGTATCCCTTCCAGATCGACATTCCAAACCCACCGACTTTGAATCCAAC  17375

Query  3129   TGGTGTTTATGCTAGAACTTTTGAATTAGATTCGAAATCGATTGAGTCGTTCGA--GCAC  3186
               ||| | ||  ||||       |||||  |  ||    ||||  || ||    |  | ||
Sbjct  17374  CGGTATCTACTCTAGG------GAATTCAA--CGTGGGCGATCCAGACGCAGCATTGTAC  17323

Query  3187   AGATTGAGATTTGAGGGTGTGGACAATTGTTACGAGCTTTATGTTAATGGTCAATATGTG  3246
              ||  | ||||| || |||||||||||| ||| |||||| | ||| ||     |||| || 
Sbjct  17322  AGGCTCAGATTCGAAGGTGTGGACAATAGTTTCGAGCTATTTGTCAACCAAAAATACGTT  17263

Query  3247   GGTTTCAATAAGGGGTCCCGTAACGGGGCTGAATTTGATATCCAAAAGTACGTTTCTGAG  3306
              ||||| || ||||| || |||||||| |||||||| || ||||| |  ||| |   ||||
Sbjct  17262  GGTTTTAACAAGGGCTCTCGTAACGGTGCTGAATTCGACATCCAGAGCTACATACATGAG  17203

Query  3307   GGCGAAAACTTAGTGGTCGTCAAGGTTTTCAAGTGGTCCGATTCCACTTATATCGAGGAC  3366
              || |  ||  |||||   |||||||| ||| | ||||| || ||  | || || || || 
Sbjct  17202  GGGGCCAATCTAGTGACTGTCAAGGTGTTCCAATGGTCGGACTCTTCCTACATTGAAGAT  17143

Query  3367   CAAGATCAATGGTGGCTCTCTGGTATTTACAGAGACGTTTCTTTACT  3413
              || || ||||||||||| || || |||| |||||||||||| || ||
Sbjct  17142  CAGGACCAATGGTGGCTATCGGGCATTTTCAGAGACGTTTCCTTGCT  17096


> KLWIg4169 KLWIg4169 undefined product 8464981:8468037 forward
Length=3057

 Score =  897 bits (994),  Expect = 0.0
 Identities = 1521/2189 (70%), Gaps = 52/2189 (2%)
 Strand=Plus/Plus

Query  3702  ACATTGGACCGCAGAAAATCCTACTTTGTACAAGTACCAGTTGGATTTAATTGGATCTGA  3761
             ||||||||| |||||| |||| | ||| ||||| | | || ||||||| || |   |   
Sbjct  873   ACATTGGACAGCAGAAGATCCAATTTTATACAAATTCAAGCTGGATTTGATCGATGCCAC  932

Query  3762  TGGCAGTGTGATTCAATCTATTAAGCACCATGTTGGTTTCAGACAAGTGGAGTTGAAGGA  3821
             |   | |||||||||| |||||   || || ||||| ||||||||||| || ||   | |
Sbjct  933   TTCAAATGTGATTCAAACTATTTTCCATCACGTTGGGTTCAGACAAGTTGAATTACTGAA  992

Query  3822  CGGTAACATTACTGTTAATGGCAAAGACATTCTCTTTAGAGGTGTCAACAGACATGATCA  3881
             |||||| || || || ||||||||||| ||  | || ||||| |||||||||||||||||
Sbjct  993   CGGTAATATAACCGTCAATGGCAAAGATATCTTATTCAGAGGGGTCAACAGACATGATCA  1052

Query  3882  CCATCCAAGGTTCGGTAGAGCTGTGCCATTAGATTTTGTTGTTAGGGACTTGATTCTAAT  3941
              || ||||||||||| ||| |  | || || ||||||||| | || || || | ||||||
Sbjct  1053  TCACCCAAGGTTCGGAAGATCCATTCCTTTGGATTTTGTTATCAGAGATTTAACTCTAAT  1112

Query  3942  GAAGAAGTTTAACATCAATGCTGTTCGTAACTCGCATTATCCAAACCATCCTAAGGTGTA  4001
             |||| |    |||||||||||||| ||||  || ||||||||||||||||| |  || ||
Sbjct  1113  GAAGCAACACAACATCAATGCTGTACGTACATCACATTATCCAAACCATCCAAGAGTCTA  1172

Query  4002  TGACCTCTTCGATAAGCTGGGCTTCTGGGTCATTGACGAGGCAGATCTTGAAACTCATGG  4061
             ||| || ||||| ||  |||| |||||||| || || || || ||| | || || |||||
Sbjct  1173  TGATCTTTTCGACAAATTGGGATTCTGGGTTATCGATGAAGCCGATTTAGAGACACATGG  1232

Query  4062  TGTTCAAGAGCCATTTAATCGTCATACGAACTTGGAGGCTGAATATCCAGATACTAAAAA  4121
               ||||||| || | |||| | |||   ||  |   |||||| ||| | || || |||||
Sbjct  1233  CCTTCAAGATCCTTATAATAGACATGAAAATGTCACGGCTGAGTATGCTGACACGAAAAA  1292

Query  4122  TAAACTCTACGATGTTAATGCCCATTACTTATCAGATAATCCAGAGTACGAGGTCGCGTA  4181
             ||| | ||| ||||| ||||| ||||| || || |||||||| || |  |||   |||||
Sbjct  1293  TAAGCACTATGATGTCAATGCTCATTATTTGTCTGATAATCCTGATTGGGAGACTGCGTA  1352

Query  4182  CTTAGACAGAGCTTCCCAACTTGTCCTAAGAGATGTCAATCATCCTTCGATTATTATCTG  4241
             |||||||||||| ||||| || ||  || | ||  | || ||||| || || || || ||
Sbjct  1353  CTTAGACAGAGCATCCCAGCTAGTTTTACGTGACATAAACCATCCCTCCATAATAATTTG  1412

Query  4242  GTCCTTGGGTAACGAAGCTTGTTATGGCAGAAACCACAAAGCCATGTACAAGTTAATTAA  4301
             |||  | || || ||| | || || |||||||| |||||||||||||| ||||| || ||
Sbjct  1413  GTCTCTAGGGAATGAATCATGCTACGGCAGAAATCACAAAGCCATGTATAAGTTGATCAA  1472

Query  4302  ACAATTGGATCCTACCAGACTTGTGCATTATGAGGGTGACTTGAACGCTTTGAGTGCAGA  4361
             |||||| ||||| || ||||| || || || || ||||| ||||||||| |   ||| ||
Sbjct  1473  ACAATTAGATCCAACTAGACTGGTTCACTACGAAGGTGATTTGAACGCTGTCTCTGCCGA  1532

Query  4362  TATCTTTAGTTTCATGTACCCAACATTTGAAATTATGGAAAGGTGGAGGAAGAACCACAC  4421
              || |  ||||| ||||||||||||   |||||||||||||  ||||| ||    || ||
Sbjct  1533  CATGTACAGTTTTATGTACCCAACACCAGAAATTATGGAAAACTGGAGAAAAGCTCATAC  1592

Query  4422  TGATGAAAATGGTAAGTTTGAAAAGCCTTTGATCTTGTGTGAGTACGGCCATGCAATGGG  4481
             |||||||  ||| || ||||| || || |||||||| ||||| || |||||||| |||||
Sbjct  1593  TGATGAAGCTGGAAACTTTGACAAACCGTTGATCTTATGTGAATATGGCCATGCGATGGG  1652

Query  4482  TAACGGTCCTGGCTCTTTGAAAGAATATCAAGAGTTGTTCTACAAGGAGAAGTTTTACCA  4541
             ||| || || || || ||||| ||||| || ||| | || ||     | || || || ||
Sbjct  1653  TAATGGGCCAGGATCCTTGAAGGAATACCAGGAGCTATTTTATGGAAACAAATTCTATCA  1712

Query  4542  AGGTGGCTTTATCTGGGAATGGGCAAATCACGGTATTGAATTCGAAGATGTTAGTACTGC  4601
             |||||| || |||||||||||||| ||||| ||||| ||||| ||   ||||||||    
Sbjct  1713  AGGTGGTTTCATCTGGGAATGGGCCAATCATGGTATCGAATTTGAGACTGTTAGTAAAAA  1772

Query  4602  AGATGGTAAGTTGCATAAAGCTTATGCTTATGGTGGTGACTTTAAGGAAGAGGTTCATGA  4661
              || |||||    || ||||| ||||| |||||||||||||| || |||||  | |||||
Sbjct  1773  TGACGGTAAACGTCACAAAGCGTATGCATATGGTGGTGACTTCAACGAAGAAATCCATGA  1832

Query  4662  CGGAGTGTTCATCATGGATGGTTTGTGTAACAGTGAGCATAATCCTACTCCGGGCCTTGT  4721
              || || ||||| ||||| ||||| |  |||  ||| ||||| || || || ||| |  |
Sbjct  1833  TGGCGTATTCATTATGGACGGTTTATTGAACTCTGAACATAACCCAACACCAGGCTTGAT  1892

Query  4722  AGAGTATAAGAAGGTTATTGAACCCGTTCAT---ATTAAAATTGCGCACGGATCTGTAAC  4778
              |||||||| ||    |||||||| ||||||    |||  | ||   | | |   |||| 
Sbjct  1893  TGAGTATAAAAAAACGATTGAACCGGTTCATGTAGTTATTAATGATAAAGAA---GTAAT  1949

Query  4779  AATCACAAATAAGCACGACTTCATTACGACAGACCACTTATTGTTTATCGACAAGGACAC  4838
               ||||||| ||  | ||||| || || || || || |||   || |  ||    |||| 
Sbjct  1950  TGTCACAAACAAATATGACTTTATCACAACTGATCATTTAGAATTCAGAGATGTCGACAA  2009

Query  4839  GGGAAAGACAATCGACGTTCCATCTTTAAAGCCAGAAGAATCTGTTACT------ATTCC  4892
                 || |  || || |||||| | || || || |||||||| ||||||      ||| |
Sbjct  2010  CAACAAAATTATTGAAGTTCCAACATTGAAACCGGAAGAATCCGTTACTTTGGCGATTAC  2069

Query  4893  TTCTGATACAACTTATGTTGTTGCCGTGTTGAAAGATGATGCTGGTGTTCTAAAGGCAGG  4952
             | ||| ||  |  | |||||||      ||||||  ||||| ||||||| | || |||||
Sbjct  2070  TACTGGTAATATATCTGTTGTT------TTGAAAAGTGATGTTGGTGTTTTGAAAGCAGG  2123

Query  4953  TCATGAAATTGCCTGGGGCCAAGCTGAACTTCCATTGAAGGTACCCGATTTTGTTACAGA  5012
             |||||| ||| ||||||| |||    || |  | |  | | |||        ||| ||||
Sbjct  2124  TCATGAGATTTCCTGGGGTCAA----AAAT--CTTACACGCTAC------AAGTTCCAGA  2171

Query  5013  G-ACAGCAGAAAAAG-CTG--CGAAG--------ATCAACG--ACGGTAAACGTTATGTC  5058
             |  ||| |  |||||  ||  |||||        || || |  |||| | |  || || |
Sbjct  2172  GTTCAGAACTAAAAGTGTGATCGAAGGGGCTTCTATTAAAGAAACGGCAGAATTTGTGAC  2231

Query  5059  -TCAGTTGAATCCAGTGGATTGCATTTTATCTTGGACAAATTGTTGGGTAAAATTGAAAG  5117
              | |  || |   ||   || | | ||||  ||  ||||| | |  ||||| || ||| |
Sbjct  2232  TTTATCTGGA--AAGAACATAG-AATTTAAGTTCAACAAACTATATGGTAAGATCGAAGG  2288

Query  5118  CCTAAAGGTCAAGGGTAAGGAAATTTCCAGCAAGTTTGAGGGTTCTTCAATCACTTTCTG  5177
             | ||    | ||   |||| ||||||  |  || || || || || || |||||||||||
Sbjct  2289  CTTATCTATTAACAATAAGAAAATTTGTACTAAATTCGATGGCTCCTCGATCACTTTCTG  2348

Query  5178  GAGACCTCCAACGAATAATGATGAACCTAGGGACTTTAAGAACTGGAAGAAGTACAATAT  5237
             |||||||||||| ||||||||||   | |  ||  || |  | ||||| ||||| ||| |
Sbjct  2349  GAGACCTCCAACAAATAATGATGCTGCAAAAGATGTTGATCATTGGAAAAAGTATAATGT  2408

Query  5238  TGATTTAATGAAGCAAAACATCCATGGAGTGAGTGTCGAA-AAAGGTTCTAATGGTTCTC  5296
             | || | |  || |||||| | || | ||| |   | ||| |  ||  || |  || || 
Sbjct  2409  TCATCTCACTAAACAAAACGTTCACGAAGTTACACTTGAAGAGGGGAACTCAGAGTACT-  2467

Query  5297  TAGCTGTAG-TCACGGTTAACTCTCGTATATCCCCAGTTGTATTTTACTATGGGTTTGAG  5355
             | || | || |    || || ||  |  |   |||    |||||||| ||||| || || 
Sbjct  2468  TGGC-GAAGATTGTAGTAAAATCAAGGGTTGGCCCTCCAGTATTTTATTATGGTTTCGAA  2526

Query  5356  ACTGTTCAGAAGTACACGATCTTTGCTAACAAAATAAACTTGAACACTTCTATGAAGCTT  5415
             ||    ||  | ||||  |||||  |||| ||| |||  ||  ||||||| ||||  || 
Sbjct  2527  ACCACGCAAGAATACATTATCTTACCTAATAAATTAAGTTTACACACTTCGATGAGACTA  2586

Query  5416  ACTGGCGAATATCAGCCTCCTGATTTCCCAAGAGTTGGGTACGAATTCTGGCTAGGAGAT  5475
             || || ||||| || ||   |||  | ||  | ||||| || ||||||||| | || |||
Sbjct  2587  ACAGGTGAATACCAACCAAATGACCTACCTCGTGTTGGATATGAATTCTGGTTGGGTGAT  2646

Query  5476  AGTTATGAATCATTTGAATGGTTAGGTCGCGGGCCCGGCGAATCATATCCGGATAAGAAG  5535
             |  |||||||| | |   ||||| ||||| || || || || || ||||| |||||||| 
Sbjct  2647  AACTATGAATCCTATAGGTGGTTTGGTCGTGGTCCAGGAGAGTCTTATCCAGATAAGAAA  2706

Query  5536  GAATCTCAAAGATTCGGTCTTTACGATTCCAAAGATGTAGAGGAATTCGTATATGACTAT  5595
             || ||||||| | | || || |   | || |  |||||    || || || |||||||| 
Sbjct  2707  GAGTCTCAAAAAGTTGGCCTGTTTAACTCGAGTGATGTGATTGATTTTGTTTATGACTAC  2766

Query  5596  CCTCAAGAAAATGGAAATCATACAGATACCCACTTTTTGAACATCAAATTTGAAGGTGCA  5655
             || ||||||||||| ||||| |||||||| || || ||  | ||  |||   | | ||||
Sbjct  2767  CCGCAAGAAAATGGGAATCACACAGATACTCATTTCTTAGAGATTGAATACAAGGATGCA  2826

Query  5656  GGAAAACTATCGATCTTCCAAAAGGAGAAGCCATTTAACTTCAAGATTTCAGACGAATAC  5715
             |||||| |    |||  | || |    ||  | || ||||| ||||||   || ||||| 
Sbjct  2827  GGAAAATTGGTAATCACCGAAGATAGTAAAACTTTCAACTTTAAGATTAGTGATGAATAT  2886

Query  5716  GGGGTTGATGAAGCTGCCCACGCTTGTGACGTTAAAAGATACGGCAGACACTATCTAAGG  5775
                ||||| || || |  ||  | || || ||||||   ||   ||   | ||| |  | 
Sbjct  2887  AACGTTGAAGAGGCAGATCATCCATGCGATGTTAAACACTATACCAACAAGTATGTTCGT  2946

Query  5776  TTGGACCATGCAATCCATGGTGTTGGTAGCGAAGCATGCGGACCTGCTGTTCTGGACCAG  5835
             || || |||||||| |||||||||||    ||||| || |||||| ||||| | ||  ||
Sbjct  2947  TTAGATCATGCAATGCATGGTGTTGGATCAGAAGCTTGTGGACCTCCTGTTTTTGATGAG  3006

Query  5836  TACAGATTGAAAGCTCAAGATTTCAACTT  5864
             |||||| | ||||| ||||| ||  ||||
Sbjct  3007  TACAGACTAAAAGCACAAGACTTTGACTT  3035


 Score =  228 bits (252),  Expect = 7e-58
 Identities = 405/587 (69%), Gaps = 23/587 (3%)
 Strand=Plus/Plus

Query  2834  ATTTAAGGAACCCCAAAAAGGTTCACGAAAATAGATTGCCTACTAGGGCTTACTACTATG  2893
             ||||||| |||||||||  |||||| ||||| |||||||| || || || ||  | || |
Sbjct  26    ATTTAAGAAACCCCAAACTGGTTCATGAAAACAGATTGCCCACAAGAGCGTATCATTACG  85

Query  2894  ATCAGGATATTTTCGAATCTCTCAATGGGCCTTGGGCTTTTGCGTTGTTTGATGCACCTC  2953
             | |  || |||| |   || || ||||| || ||||||||    |||||||| || ||| 
Sbjct  86    ACCCCGAAATTTCCACGTCGCTGAATGGTCCGTGGGCTTTCAGTTTGTTTGAAGCTCCTT  145

Query  2954  TTGACGCTCCGGATGCTAAGAATTTAGACTGGGAAACG-GCA----AAGAAATGGAGCAC  3008
              ||  || || ||| | |  ||      |||| ||| | | |    ||||| |||  | |
Sbjct  146   CTGTGGCGCCAGATCCGACCAAG-----CTGGCAAAAGAGGACTTCAAGAACTGGGACTC  200

Query  3009  CATTTCTGTGCCATCCCATTGGGAACTTCAGGAAGACTGGAAGTACGGTAAACCAATTTA  3068
              || || || || || || ||| |||| ||||| | |   |||||||||   ||   |||
Sbjct  201   TATCTCGGTTCCGTCTCACTGGCAACTGCAGGACGGC---AAGTACGGTGCTCCGGCTTA  257

Query  3069  CACGAACGTACAGTACCCTATCCCAATCGACATCCCAAATCCTCCCACTGTAAATCCTAC  3128
             ||| ||||| ||||| ||  |||  |||||||| ||||| || || ||| | ||||| ||
Sbjct  258   CACAAACGTCCAGTATCCCTTCCAGATCGACATTCCAAACCCACCGACTTTGAATCCAAC  317

Query  3129  TGGTGTTTATGCTAGAACTTTTGAATTAGATTCGAAATCGATTGAGTCGTTCGA--GCAC  3186
              ||| | ||  ||||       |||||  |  ||    ||||  || ||    |  | ||
Sbjct  318   CGGTATCTACTCTAGG------GAATTCAA--CGTGGGCGATCCAGACGCAGCATTGTAC  369

Query  3187  AGATTGAGATTTGAGGGTGTGGACAATTGTTACGAGCTTTATGTTAATGGTCAATATGTG  3246
             ||  | ||||| || |||||||||||| ||| |||||| | ||| ||     |||| || 
Sbjct  370   AGGCTCAGATTCGAAGGTGTGGACAATAGTTTCGAGCTATTTGTCAACCAAAAATACGTT  429

Query  3247  GGTTTCAATAAGGGGTCCCGTAACGGGGCTGAATTTGATATCCAAAAGTACGTTTCTGAG  3306
             ||||| || ||||| || |||||||| |||||||| || ||||| |  ||| |   ||||
Sbjct  430   GGTTTTAACAAGGGCTCTCGTAACGGTGCTGAATTCGACATCCAGAGCTACATACATGAG  489

Query  3307  GGCGAAAACTTAGTGGTCGTCAAGGTTTTCAAGTGGTCCGATTCCACTTATATCGAGGAC  3366
             || |  ||  |||||   |||||||| ||| | ||||| || ||  | || || || || 
Sbjct  490   GGGGCCAATCTAGTGACTGTCAAGGTGTTCCAATGGTCGGACTCTTCCTACATTGAAGAT  549

Query  3367  CAAGATCAATGGTGGCTCTCTGGTATTTACAGAGACGTTTCTTTACT  3413
             || || ||||||||||| || || |||| |||||||||||| || ||
Sbjct  550   CAGGACCAATGGTGGCTATCGGGCATTTTCAGAGACGTTTCCTTGCT  596


> AEAS01000242  Kluyveromyces aestuarii ATCC 18862 contig00543, 
whole genome shotgun sequence
Length=56607

 Score =  767 bits (850),  Expect = 0.0
 Identities = 1501/2193 (69%), Gaps = 44/2193 (2%)
 Strand=Plus/Plus

Query  3694   GCCCCAGAACATTGGACCGCAGAAAATCCTACTTTGTACAAGTACCAGTTGGATTTAATT  3753
              || ||| | |||||||| |||||| |||| | ||||||||||| | |  | ||  |  | 
Sbjct  28420  GCTCCAAAGCATTGGACGGCAGAAGATCCAAATTTGTACAAGTTCAAACTAGAGCTCGT-  28478

Query  3754   GGATCTGAT-GGCAGTGTGATTCAATCTATTAAGCACCATGTTGGTTTCAGACAAGTGGA  3812
              ||||| ||| || |  || |||||| | || ||||||||||| || ||||| || || ||
Sbjct  28479  GGATCAGATTGGTAACGTAATTCAAACGATCAAGCACCATGTCGGATTCAGGCAGGTCGA  28538

Query  3813   GTTGAAGGACGGTAACATTACTGTTAATGGCAAAGACATTCTCTTTAGAGGTGTCAACAG  3872
              | |   | ||||||| || || |||||||| ||||  ||  | ||  | |||   |||||
Sbjct  28539  GCTATTGAACGGTAATATAACAGTTAATGGTAAAGCGATCTTATTCCGGGGTACTAACAG  28598

Query  3873   ACATGATCACCATCCAAGGTTCGGTAGAGCTGTGCCATTAGATTTTGTTGTTAGGGACTT  3932
              ||| ||||| ||||||| |   |||||| | ||  |  | |||||||| |  || ||  |
Sbjct  28599  ACACGATCATCATCCAAAGACTGGTAGAACGGTAGCTCTTGATTTTGTCGCCAGAGATCT  28658

Query  3933   GATTCTAATGAAGAAGTTTAACATCAATGCTGTTCGTAACTCGCATTATCCAAACCATCC  3992
               | | | |||||  |    || || |||||||| |||||||| || |||||||| |||||
Sbjct  28659  AAGTATCATGAAACACCACAATATAAATGCTGTCCGTAACTCACACTATCCAAATCATCC  28718

Query  3993   TAAGGTGTATGACCTCTTCGATAAGCTGGGCTTCTGGGTCATTGACGAGGCAGATCTTGA  4052
              || | | |||||  ||||||||||  | || || |||||||| || |||||||| || ||
Sbjct  28719  TAGGATTTATGATTTCTTCGATAAATTAGGGTTTTGGGTCATAGATGAGGCAGACCTCGA  28778

Query  4053   AACTCATGGTGTTCAAGAGCCATTTAATCGTCATACGAACTTGGAGGCTGAATATCCAGA  4112
              ||| ||||| || |||   || || ||   |||    ||  | | ||  ||||  |||||
Sbjct  28779  AACACATGGGGTCCAAACTCCCTTCAACGTTCACGAAAATATAGGGGTAGAATTACCAGA  28838

Query  4113   TACTAAAAATAAACTCTACGATGTTAATGCCCATTACTTATCAGATAATCCAGAGTACGA  4172
              ||| || ||||| ||||| ||||| ||||| |||||||| || ||||| ||||| |  ||
Sbjct  28839  TACAAAGAATAAGCTCTATGATGTCAATGCTCATTACTTGTCGGATAACCCAGACTGGGA  28898

Query  4173   GGTCGCGTACTTAGACAGAGCTTCCCAACTTGTCCTAAGAGATGTCAATCATCCTTCGAT  4232
                  || ||||| || || || || ||  | ||  |  | ||| |||||||||| || ||
Sbjct  28899  AACTGCTTACTTGGATAGGGCATCGCAGTTAGTATTGCGCGATATCAATCATCCATCAAT  28958

Query  4233   TATTATCTGGTCCTTGGGTAACGAAGCTTGTTATGGCAGAAACCACAAAGCCATGTACAA  4292
                | || |||||  | || || || || |||||||||||||| ||||| || ||||| ||
Sbjct  28959  AGTAATATGGTCTCTAGGAAATGAGGCCTGTTATGGCAGAAATCACAAGGCTATGTATAA  29018

Query  4293   GTTAATTAAACAATTGGATCCTACCAGACTTGTGCATTATGAGGGTGACTTGAACGCTTT  4352
               || || ||| |||| ||||||| | |  | || || ||||| ||||| ||  | ||  |
Sbjct  29019  ATTGATCAAAGAATTAGATCCTAGCCGTTTGGTTCACTATGAAGGTGATTTACATGCAAT  29078

Query  4353   GAGTGCAGATATCTTTAGTTTCATGTACCCAACATTTGAAATTATGGAAAGGTGGAGGAA  4412
                  || ||||| ||||| |||||||||||||| || ||||  ||||||   ||||| ||
Sbjct  29079  TTCGGCTGATATGTTTAGCTTCATGTACCCAACTTTGGAAACAATGGAAGACTGGAGAAA  29138

Query  4413   GAACCACACTGATGAAAATGGTAAGTTTGAAAAGCCTTTGATCTTGTGTGAGTACGGCCA  4472
                  |||||  |  |  ||||||  |||||||| ||||| || || ||||| || || ||
Sbjct  29139  ATCTCACACCAAAAAGGATGGTACATTTGAAAAACCTTTAATATTATGTGAATATGGTCA  29198

Query  4473   TGCAATGGGTAACGGTCCTGGCTCTTTGAAAGAATATCAAGAGTTGTTCTACAAGGAGAA  4532
              ||||||||||||||||||||| ||||| |||||||||||||| ||||| || || ||   
Sbjct  29199  TGCAATGGGTAACGGTCCTGGATCTTTAAAAGAATATCAAGAATTGTTTTATAAAGAACG  29258

Query  4533   GTTTTACCAAGGTGGCTTTATCTGGGAATGGGCAAATCACGGTATTGAATTCGAAGATGT  4592
               || | |||||||||||| |||||||||||||| |||||||| ||||| |||||  | ||
Sbjct  29259  ATTCTTCCAAGGTGGCTTCATCTGGGAATGGGCCAATCACGGCATTGAGTTCGAGAAAGT  29318

Query  4593   ------TAGTACTGCAGATGGTAAGTTGCATAAAGCTTATGCTTATGGTGGTGACTTTAA  4646
                     ||||| |  || |    | |||  ||||||||||| ||||||||||| ||| |
Sbjct  29319  GGGCAAAAGTACCG-GGAAG---CGCTGC--AAAGCTTATGCCTATGGTGGTGATTTTGA  29372

Query  4647   GGAAGAGGTTCATGACGGAGTGTTCATCATGGATGGTTTGTGTAACAGTGAGCATAATCC  4706
               || ||||| ||||| || || |||||||||||||||||||  ||    |||||| | ||
Sbjct  29373  TGAGGAGGTCCATGATGGTGTTTTCATCATGGATGGTTTGTTAAATTCAGAGCATGAACC  29432

Query  4707   TACTCCGGGCCTTGTAGAGTATAAGAAGGTTATTGAACCCGTTCATATTAAAATTGCGCA  4766
              |||||| ||  | || || ||||| ||  ||||||||||| ||| |||  | || ||  |
Sbjct  29433  TACTCCAGGATTGGTCGATTATAAAAAAATTATTGAACCCATTCGTATCGATATCGCCAA  29492

Query  4767   CGGATCTGTAACAATCACAAATAAGCACGACTTCATTACGACAGACCACTTATTGTTTAT  4826
               ||    || || || |||||   | |||| |||||||  || || || |||   || | 
Sbjct  29493  TGGCAAGGTCACTATAACAAACTTGTACGATTTCATTAATACTGATCATTTAGAATTCAA  29552

Query  4827   CGACAAGGACACGGGAAAGACAATCGACGTTCCATCTTTAAAGCCAGAAGAATCTGTTAC  4886
               ||    ||||  |  ||    || || || ||  | ||||||||| | || ||  ||||
Sbjct  29553  AGATGTTGACAATGATAAACTCATTGAAGTGCCCGCATTAAAGCCAAATGATTCGATTAC  29612

Query  4887   TATTCCTTCTGATACAACTTATGTTGTTGCCGTGTTGAAAGATGATGCTGGTGTTCTAAA  4946
              ||||      || ||     | |||   ||| | || ||| | |||  |||  |  ||||
Sbjct  29613  TATTGAAATCGACACGGGCAACGTTTCAGCCCTTTTAAAAAAAGATTTTGGGTTATTAAA  29672

Query  4947   GGCAGGTCATGAAATTGCCTGGGGCCAAGCTGAACTTCCA-TTGAAGGTACCCGATTT--  5003
               || || || ||||| ||||||||||||  | | || | |  |||| || || || ||  
Sbjct  29673  AGCTGGCCACGAAATCGCCTGGGGCCAAAAT-ATCTACGAGCTGAAAGTCCCTGAATTCA  29731

Query  5004   -TGT---TACAGAGACAGCAGAAAAAGCTG--CGAAGATCAACGACGGTAAACGTTATGT  5057
               |||   | | | || |   |||    |||    ||||  ||| | ||  ||  |  |||
Sbjct  29732  ATGTCGCTTCCGTGA-AAATGAACCCTCTGGTTCAAGA--AACCAAGG--AATTTATTGT  29786

Query  5058   CTCAGTTGAATCCAGTGGAT-TGCATTTTATCTTGGACAAATTGTTGGGTAAAATTGAAA  5116
                  ||||||| | |  ||| || |  | |  ||  ||||| | |  || || |||||  
Sbjct  29787  ---GGTTGAAT-CTGAAGATCTGAAACTCAAGTTCAACAAACTCTATGGGAAGATTGAGG  29842

Query  5117   GCCTAAAGGTCAAGGGTAAGGAA--ATTTCCAGCAAGTTTGAGGGTTCTTCAATCACTTT  5174
                 |||     || ||||  |||  ||||| |  || ||  | || || || ||||| ||
Sbjct  29843  AATTAACTCATAAAGGTA--GAACCATTTCAACAAAATTCAATGGGTCATCTATCACATT  29900

Query  5175   CTGGAGACCTCCAACGAATAATGATGAACCTAGGGACTTTAAGAACTGGAAGAAGTACAA  5234
               |  ||||| || || |||||||||| |||||  |||       | |||||    |||||
Sbjct  29901  TTTCAGACCACCCACAAATAATGATGCACCTACTGACGCAGCTCATTGGAAATCATACAA  29960

Query  5235   TATTGATTTAATGAAGCAAAACATCCATGGAGTGAGTGTCGAAAAAGGTTCTAATGGTTC  5294
               ||| | || ||||  || ||| |    | ||| |   | |||| || |     || || 
Sbjct  29961  CATTCAATTGATGAGACAGAACGTTAGAGAAGTCAAGTTAGAAACAGATGACTGTGATTA  30020

Query  5295   TCTAGCTGTAGTCACGGTTAACTCTCGTATATCCCCAGTTGTATTTTACTATGGGTTTGA  5354
              | | ||   | | || ||||  || |||||    ||   ||| ||||| || |||| |||
Sbjct  30021  TTTGGCAAAAATAACTGTTACATCGCGTATTGGGCCTCCTGTTTTTTATTACGGGTATGA  30080

Query  5355   GACTGTTCAGAAGTACACGATCTTTGCTAACAAAATAAACTTGAACACTTCTATGAAGCT  5414
               ||||| ||| | || |  || ||  | || ||| | |  ||  | ||   |||||||||
Sbjct  30081  AACTGTCCAGGAATATATTATTTTCCCAAATAAACTGAGTTTACATACAAATATGAAGCT  30140

Query  5415   TACTGGCGAATATCAGCCTCCTGATTTCCCAAGAGTTGGGTACGAATTCTGGCTAGGAGA  5474
               ||||| |||||||| ||    || || || ||| |||| || ||||| ||||| || ||
Sbjct  30141  CACTGGAGAATATCAACCGAAGGACTTACCCAGAATTGGTTATGAATTTTGGCTTGGTGA  30200

Query  5475   TAGTTATGAATCATTTGAATGGTTAGGTCGCGGGCCCGGCGAATCATATCCGGATAAGAA  5534
               | ||| |||||||     ||||| || ||||| || || || || ||||| || |||||
Sbjct  30201  CAATTACGAATCATACAGTTGGTTTGGGCGCGGTCCAGGAGAGTCTTATCCCGACAAGAA  30260

Query  5535   GGAATCTCAAAGATTCGGTCTTTACGATTCCAAAGATGTAGAGGAATTCGTATATGACTA  5594
               || ||||||||||| ||   |||  |||| |  ||  |    || ||||| ||||||||
Sbjct  30261  AGAGTCTCAAAGATTGGGAACTTATAATTCTAGGGACATCATCGACTTCGTTTATGACTA  30320

Query  5595   TCCTCAAGAAAATGGAAATCATACAGATACCCACTTTTTGAACATCAAATTTGAAGGTGC  5654
              ||| |||||||| || |||||||| ||||| ||||||||  |  |||| |   ||| || 
Sbjct  30321  TCCACAAGAAAACGGGAATCATACTGATACTCACTTTTTAGAGGTCAAGTACAAAGATGG  30380

Query  5655   AGGAAAACTATCGATCTTCCAAAAGGAGAAGCCATTTAACTTCAAGATTTCAGACGAATA  5714
                |  | ||   | |||   || | |  ||  |||| || |||||||||   || |||||
Sbjct  30381  GAGCCAGCTGCTGTTCTCGGAATACGGTAAAACATTCAATTTCAAGATTAGTGATGAATA  30440

Query  5715   CGGGGTTGATGAAGCTGCCCACGCTTGTGACGTTA--AAAGATACGGCAGACACTATCTA  5772
              ||| || || |||||||| ||  | || |||||||   |  || | | | || |||||||
Sbjct  30441  CGGTGTCGAAGAAGCTGCACATCCATGCGACGTTAGGCACTATTCCG-AAAC-CTATCTA  30498

Query  5773   AGGTTGGACCATGCAATCCATGGTGTTGGTAGCGAAGCATGCGGACCTGCTGTTCTGGAC  5832
              ||  | || |||| ||| |||||||| ||    ||||| || |||||| | ||  |||| 
Sbjct  30499  AGACTAGATCATGGAATGCATGGTGTAGGGTCAGAAGCTTGTGGACCTCCAGTATTGGAT  30558

Query  5833   CAGTACAGATTGAAAGCT-CAAGATTTCAACTT  5864
              || || || ||| ||||| ||||||||  ||||
Sbjct  30559  CAATATAGGTTG-AAGCTGCAAGATTTTGACTT  30590


 Score =  185 bits (204),  Expect = 8e-45
 Identities = 308/438 (71%), Gaps = 19/438 (4%)
 Strand=Plus/Plus

Query  3009   CATTTCTGTGCCATCCCATTGGGAACTTCAGGAAGACTGGAAGTACGGTAAACCAATTTA  3068
              ||| ||||| ||||| || ||| || | ||||| | |   || || |||  ||||| |||
Sbjct  27759  CATCTCTGTACCATCTCACTGGCAATTACAGGATGGC---AAATATGGTTCACCAAATTA  27815

Query  3069   CACGAACGTACAGTACCCTATCCCAATCGACATCCCAAATCCTCCCACTGTAAATCCTAC  3128
               |||||  | || || ||| |||  ||||| || ||||||||||| ||  ||||||| ||
Sbjct  27816  TACGAATATTCAATATCCTTTCCAGATCGATATTCCAAATCCTCCAACAATAAATCCCAC  27875

Query  3129   TGGTGTTTATGCTAGA-ACTTTTGAATT--AGATTCGAAATCGATTGAGTCGTTCGAGCA  3185
               || || ||  |  |  | ||||   |   |||  ||||  |   || |   |||    |
Sbjct  27876  AGGGGTGTACTCACGCGAGTTTTTCGTGGAAGACCCGAAGGC---TGCGC--TTC----A  27926

Query  3186   CAGATTGAGATTTGAGGGTGTGGACAATTGTTACGAGCTTTATGTTAATGGTCAATATGT  3245
              | || | ||||| |||||||| || ||  ||| ||| || ||||| |||    |||||||
Sbjct  27927  CCGAATTAGATTCGAGGGTGTTGATAACAGTTTCGAACTGTATGTCAATCAAGAATATGT  27986

Query  3246   GGGTTTCAATAAGGGGTCCCGTAACGGGGCTGAATTTGATATCCAAAAGTACGTTTCTGA  3305
               ||||||||||| || ||| | || || ||||| |||||| | |||||  |  |||   |
Sbjct  27987  TGGTTTCAATAAAGGATCCAGAAATGGCGCTGAGTTTGATGTTCAAAAAAA--TTTGAAA  28044

Query  3306   GGGCGAA--AACTTAGTGGTCGTCAAGGTTTTCAAGTGGTCCGATTCCACTTATATCGAG  3363
                  |||  || || |||  |||||| || ||| | ||||| |||||| ||||||| || 
Sbjct  28045  CCAGGAATCAATTTTGTGACCGTCAAAGTATTCCAATGGTCTGATTCCTCTTATATTGAA  28104

Query  3364   GACCAAGATCAATGGTGGCTCTCTGGTATTTACAGAGACGTTTCTTTACTAAAATTGCCT  3423
              || ||||||||||||||| | |||||||||||||| || |||||||||||    || || 
Sbjct  28105  GATCAAGATCAATGGTGGTTGTCTGGTATTTACAGGGATGTTTCTTTACTGGTGTTACCC  28164

Query  3424   AAGAAGGCCCATATTGAA  3441
              ||| |||  ||| | |||
Sbjct  28165  AAGGAGGGTCATGTGGAA  28182


> KLAEg3795 KLAEg3795 undefined product 8018574:8021630 forward
Length=3057

 Score =  767 bits (850),  Expect = 0.0
 Identities = 1501/2193 (69%), Gaps = 44/2193 (2%)
 Strand=Plus/Plus

Query  3694  GCCCCAGAACATTGGACCGCAGAAAATCCTACTTTGTACAAGTACCAGTTGGATTTAATT  3753
             || ||| | |||||||| |||||| |||| | ||||||||||| | |  | ||  |  | 
Sbjct  865   GCTCCAAAGCATTGGACGGCAGAAGATCCAAATTTGTACAAGTTCAAACTAGAGCTCGT-  923

Query  3754  GGATCTGAT-GGCAGTGTGATTCAATCTATTAAGCACCATGTTGGTTTCAGACAAGTGGA  3812
             ||||| ||| || |  || |||||| | || ||||||||||| || ||||| || || ||
Sbjct  924   GGATCAGATTGGTAACGTAATTCAAACGATCAAGCACCATGTCGGATTCAGGCAGGTCGA  983

Query  3813  GTTGAAGGACGGTAACATTACTGTTAATGGCAAAGACATTCTCTTTAGAGGTGTCAACAG  3872
             | |   | ||||||| || || |||||||| ||||  ||  | ||  | |||   |||||
Sbjct  984   GCTATTGAACGGTAATATAACAGTTAATGGTAAAGCGATCTTATTCCGGGGTACTAACAG  1043

Query  3873  ACATGATCACCATCCAAGGTTCGGTAGAGCTGTGCCATTAGATTTTGTTGTTAGGGACTT  3932
             ||| ||||| ||||||| |   |||||| | ||  |  | |||||||| |  || ||  |
Sbjct  1044  ACACGATCATCATCCAAAGACTGGTAGAACGGTAGCTCTTGATTTTGTCGCCAGAGATCT  1103

Query  3933  GATTCTAATGAAGAAGTTTAACATCAATGCTGTTCGTAACTCGCATTATCCAAACCATCC  3992
              | | | |||||  |    || || |||||||| |||||||| || |||||||| |||||
Sbjct  1104  AAGTATCATGAAACACCACAATATAAATGCTGTCCGTAACTCACACTATCCAAATCATCC  1163

Query  3993  TAAGGTGTATGACCTCTTCGATAAGCTGGGCTTCTGGGTCATTGACGAGGCAGATCTTGA  4052
             || | | |||||  ||||||||||  | || || |||||||| || |||||||| || ||
Sbjct  1164  TAGGATTTATGATTTCTTCGATAAATTAGGGTTTTGGGTCATAGATGAGGCAGACCTCGA  1223

Query  4053  AACTCATGGTGTTCAAGAGCCATTTAATCGTCATACGAACTTGGAGGCTGAATATCCAGA  4112
             ||| ||||| || |||   || || ||   |||    ||  | | ||  ||||  |||||
Sbjct  1224  AACACATGGGGTCCAAACTCCCTTCAACGTTCACGAAAATATAGGGGTAGAATTACCAGA  1283

Query  4113  TACTAAAAATAAACTCTACGATGTTAATGCCCATTACTTATCAGATAATCCAGAGTACGA  4172
             ||| || ||||| ||||| ||||| ||||| |||||||| || ||||| ||||| |  ||
Sbjct  1284  TACAAAGAATAAGCTCTATGATGTCAATGCTCATTACTTGTCGGATAACCCAGACTGGGA  1343

Query  4173  GGTCGCGTACTTAGACAGAGCTTCCCAACTTGTCCTAAGAGATGTCAATCATCCTTCGAT  4232
                 || ||||| || || || || ||  | ||  |  | ||| |||||||||| || ||
Sbjct  1344  AACTGCTTACTTGGATAGGGCATCGCAGTTAGTATTGCGCGATATCAATCATCCATCAAT  1403

Query  4233  TATTATCTGGTCCTTGGGTAACGAAGCTTGTTATGGCAGAAACCACAAAGCCATGTACAA  4292
               | || |||||  | || || || || |||||||||||||| ||||| || ||||| ||
Sbjct  1404  AGTAATATGGTCTCTAGGAAATGAGGCCTGTTATGGCAGAAATCACAAGGCTATGTATAA  1463

Query  4293  GTTAATTAAACAATTGGATCCTACCAGACTTGTGCATTATGAGGGTGACTTGAACGCTTT  4352
              || || ||| |||| ||||||| | |  | || || ||||| ||||| ||  | ||  |
Sbjct  1464  ATTGATCAAAGAATTAGATCCTAGCCGTTTGGTTCACTATGAAGGTGATTTACATGCAAT  1523

Query  4353  GAGTGCAGATATCTTTAGTTTCATGTACCCAACATTTGAAATTATGGAAAGGTGGAGGAA  4412
                 || ||||| ||||| |||||||||||||| || ||||  ||||||   ||||| ||
Sbjct  1524  TTCGGCTGATATGTTTAGCTTCATGTACCCAACTTTGGAAACAATGGAAGACTGGAGAAA  1583

Query  4413  GAACCACACTGATGAAAATGGTAAGTTTGAAAAGCCTTTGATCTTGTGTGAGTACGGCCA  4472
                 |||||  |  |  ||||||  |||||||| ||||| || || ||||| || || ||
Sbjct  1584  ATCTCACACCAAAAAGGATGGTACATTTGAAAAACCTTTAATATTATGTGAATATGGTCA  1643

Query  4473  TGCAATGGGTAACGGTCCTGGCTCTTTGAAAGAATATCAAGAGTTGTTCTACAAGGAGAA  4532
             ||||||||||||||||||||| ||||| |||||||||||||| ||||| || || ||   
Sbjct  1644  TGCAATGGGTAACGGTCCTGGATCTTTAAAAGAATATCAAGAATTGTTTTATAAAGAACG  1703

Query  4533  GTTTTACCAAGGTGGCTTTATCTGGGAATGGGCAAATCACGGTATTGAATTCGAAGATGT  4592
              || | |||||||||||| |||||||||||||| |||||||| ||||| |||||  | ||
Sbjct  1704  ATTCTTCCAAGGTGGCTTCATCTGGGAATGGGCCAATCACGGCATTGAGTTCGAGAAAGT  1763

Query  4593  ------TAGTACTGCAGATGGTAAGTTGCATAAAGCTTATGCTTATGGTGGTGACTTTAA  4646
                    ||||| |  || |    | |||  ||||||||||| ||||||||||| ||| |
Sbjct  1764  GGGCAAAAGTACCG-GGAAG---CGCTGC--AAAGCTTATGCCTATGGTGGTGATTTTGA  1817

Query  4647  GGAAGAGGTTCATGACGGAGTGTTCATCATGGATGGTTTGTGTAACAGTGAGCATAATCC  4706
              || ||||| ||||| || || |||||||||||||||||||  ||    |||||| | ||
Sbjct  1818  TGAGGAGGTCCATGATGGTGTTTTCATCATGGATGGTTTGTTAAATTCAGAGCATGAACC  1877

Query  4707  TACTCCGGGCCTTGTAGAGTATAAGAAGGTTATTGAACCCGTTCATATTAAAATTGCGCA  4766
             |||||| ||  | || || ||||| ||  ||||||||||| ||| |||  | || ||  |
Sbjct  1878  TACTCCAGGATTGGTCGATTATAAAAAAATTATTGAACCCATTCGTATCGATATCGCCAA  1937

Query  4767  CGGATCTGTAACAATCACAAATAAGCACGACTTCATTACGACAGACCACTTATTGTTTAT  4826
              ||    || || || |||||   | |||| |||||||  || || || |||   || | 
Sbjct  1938  TGGCAAGGTCACTATAACAAACTTGTACGATTTCATTAATACTGATCATTTAGAATTCAA  1997

Query  4827  CGACAAGGACACGGGAAAGACAATCGACGTTCCATCTTTAAAGCCAGAAGAATCTGTTAC  4886
              ||    ||||  |  ||    || || || ||  | ||||||||| | || ||  ||||
Sbjct  1998  AGATGTTGACAATGATAAACTCATTGAAGTGCCCGCATTAAAGCCAAATGATTCGATTAC  2057

Query  4887  TATTCCTTCTGATACAACTTATGTTGTTGCCGTGTTGAAAGATGATGCTGGTGTTCTAAA  4946
             ||||      || ||     | |||   ||| | || ||| | |||  |||  |  ||||
Sbjct  2058  TATTGAAATCGACACGGGCAACGTTTCAGCCCTTTTAAAAAAAGATTTTGGGTTATTAAA  2117

Query  4947  GGCAGGTCATGAAATTGCCTGGGGCCAAGCTGAACTTCCA-TTGAAGGTACCCGATTT--  5003
              || || || ||||| ||||||||||||  | | || | |  |||| || || || ||  
Sbjct  2118  AGCTGGCCACGAAATCGCCTGGGGCCAAAAT-ATCTACGAGCTGAAAGTCCCTGAATTCA  2176

Query  5004  -TGT---TACAGAGACAGCAGAAAAAGCTG--CGAAGATCAACGACGGTAAACGTTATGT  5057
              |||   | | | || |   |||    |||    ||||  ||| | ||  ||  |  |||
Sbjct  2177  ATGTCGCTTCCGTGA-AAATGAACCCTCTGGTTCAAGA--AACCAAGG--AATTTATTGT  2231

Query  5058  CTCAGTTGAATCCAGTGGAT-TGCATTTTATCTTGGACAAATTGTTGGGTAAAATTGAAA  5116
                 ||||||| | |  ||| || |  | |  ||  ||||| | |  || || |||||  
Sbjct  2232  ---GGTTGAAT-CTGAAGATCTGAAACTCAAGTTCAACAAACTCTATGGGAAGATTGAGG  2287

Query  5117  GCCTAAAGGTCAAGGGTAAGGAA--ATTTCCAGCAAGTTTGAGGGTTCTTCAATCACTTT  5174
                |||     || ||||  |||  ||||| |  || ||  | || || || ||||| ||
Sbjct  2288  AATTAACTCATAAAGGTA--GAACCATTTCAACAAAATTCAATGGGTCATCTATCACATT  2345

Query  5175  CTGGAGACCTCCAACGAATAATGATGAACCTAGGGACTTTAAGAACTGGAAGAAGTACAA  5234
              |  ||||| || || |||||||||| |||||  |||       | |||||    |||||
Sbjct  2346  TTTCAGACCACCCACAAATAATGATGCACCTACTGACGCAGCTCATTGGAAATCATACAA  2405

Query  5235  TATTGATTTAATGAAGCAAAACATCCATGGAGTGAGTGTCGAAAAAGGTTCTAATGGTTC  5294
              ||| | || ||||  || ||| |    | ||| |   | |||| || |     || || 
Sbjct  2406  CATTCAATTGATGAGACAGAACGTTAGAGAAGTCAAGTTAGAAACAGATGACTGTGATTA  2465

Query  5295  TCTAGCTGTAGTCACGGTTAACTCTCGTATATCCCCAGTTGTATTTTACTATGGGTTTGA  5354
             | | ||   | | || ||||  || |||||    ||   ||| ||||| || |||| |||
Sbjct  2466  TTTGGCAAAAATAACTGTTACATCGCGTATTGGGCCTCCTGTTTTTTATTACGGGTATGA  2525

Query  5355  GACTGTTCAGAAGTACACGATCTTTGCTAACAAAATAAACTTGAACACTTCTATGAAGCT  5414
              ||||| ||| | || |  || ||  | || ||| | |  ||  | ||   |||||||||
Sbjct  2526  AACTGTCCAGGAATATATTATTTTCCCAAATAAACTGAGTTTACATACAAATATGAAGCT  2585

Query  5415  TACTGGCGAATATCAGCCTCCTGATTTCCCAAGAGTTGGGTACGAATTCTGGCTAGGAGA  5474
              ||||| |||||||| ||    || || || ||| |||| || ||||| ||||| || ||
Sbjct  2586  CACTGGAGAATATCAACCGAAGGACTTACCCAGAATTGGTTATGAATTTTGGCTTGGTGA  2645

Query  5475  TAGTTATGAATCATTTGAATGGTTAGGTCGCGGGCCCGGCGAATCATATCCGGATAAGAA  5534
              | ||| |||||||     ||||| || ||||| || || || || ||||| || |||||
Sbjct  2646  CAATTACGAATCATACAGTTGGTTTGGGCGCGGTCCAGGAGAGTCTTATCCCGACAAGAA  2705

Query  5535  GGAATCTCAAAGATTCGGTCTTTACGATTCCAAAGATGTAGAGGAATTCGTATATGACTA  5594
              || ||||||||||| ||   |||  |||| |  ||  |    || ||||| ||||||||
Sbjct  2706  AGAGTCTCAAAGATTGGGAACTTATAATTCTAGGGACATCATCGACTTCGTTTATGACTA  2765

Query  5595  TCCTCAAGAAAATGGAAATCATACAGATACCCACTTTTTGAACATCAAATTTGAAGGTGC  5654
             ||| |||||||| || |||||||| ||||| ||||||||  |  |||| |   ||| || 
Sbjct  2766  TCCACAAGAAAACGGGAATCATACTGATACTCACTTTTTAGAGGTCAAGTACAAAGATGG  2825

Query  5655  AGGAAAACTATCGATCTTCCAAAAGGAGAAGCCATTTAACTTCAAGATTTCAGACGAATA  5714
               |  | ||   | |||   || | |  ||  |||| || |||||||||   || |||||
Sbjct  2826  GAGCCAGCTGCTGTTCTCGGAATACGGTAAAACATTCAATTTCAAGATTAGTGATGAATA  2885

Query  5715  CGGGGTTGATGAAGCTGCCCACGCTTGTGACGTTA--AAAGATACGGCAGACACTATCTA  5772
             ||| || || |||||||| ||  | || |||||||   |  || | | | || |||||||
Sbjct  2886  CGGTGTCGAAGAAGCTGCACATCCATGCGACGTTAGGCACTATTCCG-AAAC-CTATCTA  2943

Query  5773  AGGTTGGACCATGCAATCCATGGTGTTGGTAGCGAAGCATGCGGACCTGCTGTTCTGGAC  5832
             ||  | || |||| ||| |||||||| ||    ||||| || |||||| | ||  |||| 
Sbjct  2944  AGACTAGATCATGGAATGCATGGTGTAGGGTCAGAAGCTTGTGGACCTCCAGTATTGGAT  3003

Query  5833  CAGTACAGATTGAAAGCT-CAAGATTTCAACTT  5864
             || || || ||| ||||| ||||||||  ||||
Sbjct  3004  CAATATAGGTTG-AAGCTGCAAGATTTTGACTT  3035


 Score =  185 bits (204),  Expect = 8e-45
 Identities = 308/438 (71%), Gaps = 19/438 (4%)
 Strand=Plus/Plus

Query  3009  CATTTCTGTGCCATCCCATTGGGAACTTCAGGAAGACTGGAAGTACGGTAAACCAATTTA  3068
             ||| ||||| ||||| || ||| || | ||||| | |   || || |||  ||||| |||
Sbjct  204   CATCTCTGTACCATCTCACTGGCAATTACAGGATGGC---AAATATGGTTCACCAAATTA  260

Query  3069  CACGAACGTACAGTACCCTATCCCAATCGACATCCCAAATCCTCCCACTGTAAATCCTAC  3128
              |||||  | || || ||| |||  ||||| || ||||||||||| ||  ||||||| ||
Sbjct  261   TACGAATATTCAATATCCTTTCCAGATCGATATTCCAAATCCTCCAACAATAAATCCCAC  320

Query  3129  TGGTGTTTATGCTAGA-ACTTTTGAATT--AGATTCGAAATCGATTGAGTCGTTCGAGCA  3185
              || || ||  |  |  | ||||   |   |||  ||||  |   || |   |||    |
Sbjct  321   AGGGGTGTACTCACGCGAGTTTTTCGTGGAAGACCCGAAGGC---TGCGC--TTC----A  371

Query  3186  CAGATTGAGATTTGAGGGTGTGGACAATTGTTACGAGCTTTATGTTAATGGTCAATATGT  3245
             | || | ||||| |||||||| || ||  ||| ||| || ||||| |||    |||||||
Sbjct  372   CCGAATTAGATTCGAGGGTGTTGATAACAGTTTCGAACTGTATGTCAATCAAGAATATGT  431

Query  3246  GGGTTTCAATAAGGGGTCCCGTAACGGGGCTGAATTTGATATCCAAAAGTACGTTTCTGA  3305
              ||||||||||| || ||| | || || ||||| |||||| | |||||  |  |||   |
Sbjct  432   TGGTTTCAATAAAGGATCCAGAAATGGCGCTGAGTTTGATGTTCAAAAAAA--TTTGAAA  489

Query  3306  GGGCGAA--AACTTAGTGGTCGTCAAGGTTTTCAAGTGGTCCGATTCCACTTATATCGAG  3363
                 |||  || || |||  |||||| || ||| | ||||| |||||| ||||||| || 
Sbjct  490   CCAGGAATCAATTTTGTGACCGTCAAAGTATTCCAATGGTCTGATTCCTCTTATATTGAA  549

Query  3364  GACCAAGATCAATGGTGGCTCTCTGGTATTTACAGAGACGTTTCTTTACTAAAATTGCCT  3423
             || ||||||||||||||| | |||||||||||||| || |||||||||||    || || 
Sbjct  550   GATCAAGATCAATGGTGGTTGTCTGGTATTTACAGGGATGTTTCTTTACTGGTGTTACCC  609

Query  3424  AAGAAGGCCCATATTGAA  3441
             ||| |||  ||| | |||
Sbjct  610   AAGGAGGGTCATGTGGAA  627


> gsASS001Lm
Length=10741898

 Score = 50.0 bits (54),  Expect = 4e-04
 Identities = 40/47 (86%), Gaps = 1/47 (2%)
 Strand=Plus/Minus

Query  1294    GCTTGCTTTTTCATTTTTTATTTTCCAT-TTTTCAGTTTTTGTTTGT  1339
               |||| ||||||||  |||| |||||||| |||||| ||||| |||||
Sbjct  863067  GCTTTCTTTTTCACATTTTTTTTTCCATTTTTTCATTTTTTCTTTGT  863021


 Score = 48.2 bits (52),  Expect = 0.001
 Identities = 31/34 (92%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  1307     TTTTTTATTTTCCATTTTTCAGTTTTTGTTTGTG  1340
                |||||||||||  ||||||||| |||||||||||
Sbjct  5965713  TTTTTTATTTTTTATTTTTCAGATTTTGTTTGTG  5965746


 Score = 46.4 bits (50),  Expect = 0.005
 Identities = 34/39 (88%), Gaps = 3/39 (7%)
 Strand=Plus/Minus

Query  2760     CAAAAAAAATAAAAAAAAAATA---AACACACATACTCA  2795
                ||||||||||||||||||||||   |||||||| || ||
Sbjct  8500211  CAAAAAAAATAAAAAAAAAATAAGGAACACACACACGCA  8500173


 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 28/31 (91%), Gaps = 2/31 (6%)
 Strand=Plus/Plus

Query  1086     CGCATGAGCACACGGGCACGGGCACGGGCAC  1116
                |||||| ||||  ||||||||||||||||||
Sbjct  6065698  CGCATGCGCAC--GGGCACGGGCACGGGCAC  6065726


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  6447    TAAAGAAAGACTCTTCTTCGATGT  6470
               |||||| |||||||||||||||||
Sbjct  888548  TAAAGAGAGACTCTTCTTCGATGT  888571


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  2755     TTTGGCAAAAAAAATAAAAAAAAAATAAA  2783
                |||||||||||||||||||||  || |||
Sbjct  1234083  TTTGGCAAAAAAAATAAAAAACGAAGAAA  1234055


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  2755     TTTGGCAAAAAAAATAAAAAAAAAAT  2780
                ||||| ||||||||||||||||| ||
Sbjct  1420351  TTTGGAAAAAAAAATAAAAAAAAGAT  1420326


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  2765     AAAATAAAAAAAAAATAAACACACATACT  2793
                || |||| ||||||| |||||||||||||
Sbjct  4224570  AAGATAATAAAAAAAAAAACACACATACT  4224598


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  2759     GCAAAAAAAATAAAAAAAAAA  2779
                |||||||||||||||||||||
Sbjct  8731980  GCAAAAAAAATAAAAAAAAAA  8732000


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 27/30 (90%), Gaps = 2/30 (6%)
 Strand=Plus/Plus

Query  2757     TGGCAAA--AAAAATAAAAAAAAAATAAAC  2784
                |||||||  ||||| |||||||||||||||
Sbjct  9264248  TGGCAAAGCAAAAAAAAAAAAAAAATAAAC  9264277


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  2760     CAAAAAAAATAAAAAAAAAA  2779
                ||||||||||||||||||||
Sbjct  2772569  CAAAAAAAATAAAAAAAAAA  2772588


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  515      AAAAAAAATTAAATGACGATACTAG  539
                ||||||||||||||||  |||||||
Sbjct  4339682  AAAAAAAATTAAATGAAAATACTAG  4339658


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  6248     CACTACATGTTCCTTTTGAAGAAAGAAAAT  6277
                |||||||| || |||||  |||||||||||
Sbjct  5189497  CACTACATCTTGCTTTTTCAGAAAGAAAAT  5189526


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAATAAA  2783
                ||||||||||||||||||| |||
Sbjct  6125905  AAAAAAAATAAAAAAAAAAAAAA  6125883


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAATAAACACACATACTCA  2795
                ||| |||||||||||||||   ||||||| || ||
Sbjct  7976221  AAACAAAATAAAAAAAAAAAGGACACACACACACA  7976187


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  2759     GCAAAAAAAATAAAAAAAAA  2778
                ||||||||||||||||||||
Sbjct  8680356  GCAAAAAAAATAAAAAAAAA  8680337


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  2757     TGGCAAAAAAAATAAAAAAAAAATAAACAC  2786
                ||| |||||||| || ||||||||||| ||
Sbjct  9288357  TGGAAAAAAAAAAAATAAAAAAATAAAGAC  9288328


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  2770    AAAAAAAAAATAAACACAC  2788
               |||||||||||||||||||
Sbjct  136885  AAAAAAAAAATAAACACAC  136903


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  2172    CTCTGGTGGGTTTCGGTTG  2190
               |||||||||||||||||||
Sbjct  335822  CTCTGGTGGGTTTCGGTTG  335804


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 27/31 (88%), Gaps = 1/31 (3%)
 Strand=Plus/Plus

Query  3926    GGGAC-TTGATTCTAATGAAGAAGTTTAACA  3955
               ||||| |||| ||||||||||||||  ||||
Sbjct  912466  GGGACCTTGACTCTAATGAAGAAGTCGAACA  912496


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  3842     GCAAAGACATTCTCTTTAGAGG  3863
                |||||||| |||||||||||||
Sbjct  1109381  GCAAAGACTTTCTCTTTAGAGG  1109402


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  1300     TTTTTCATTTTTTATTTTCCATTT  1323
                |||||||||||  |||||||||||
Sbjct  1709651  TTTTTCATTTTCCATTTTCCATTT  1709628


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  6748     CTTTGTTTCTACGCCATTTCTT  6769
                ||||||||||| ||||||||||
Sbjct  1814782  CTTTGTTTCTAAGCCATTTCTT  1814803


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  6766     TCTTTTGTTTTCAACACTT  6784
                |||||||||||||||||||
Sbjct  2075693  TCTTTTGTTTTCAACACTT  2075675


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1096     CACGGGCACGGGCACGGGCACAGGAAC  1122
                |||||||||||||| |||||| || ||
Sbjct  2088617  CACGGGCACGGGCAGGGGCACGGGCAC  2088591


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  2760     CAAAAAAAATAAAAAAAAAATAAA  2783
                ||||||||||||||| ||||| ||
Sbjct  2532842  CAAAAAAAATAAAAATAAAATGAA  2532819


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  2761     AAAAAAAATAAAAAAAAAATAAACACA  2787
                |||||| |||||||||||| ||| |||
Sbjct  3339934  AAAAAACATAAAAAAAAAACAAAAACA  3339960


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  2761     AAAAAAAATAAAAAAAAAA  2779
                |||||||||||||||||||
Sbjct  3385782  AAAAAAAATAAAAAAAAAA  3385800


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAATAA  2782
                |||||||||||||| |||||||
Sbjct  3625505  AAAAAAAATAAAAATAAAATAA  3625484


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 29/35 (83%), Gaps = 3/35 (8%)
 Strand=Plus/Plus

Query  2761     AAAAAAAATAAAAAAA---AAATAAACACACATAC  2792
                ||||||||||||||||   ||| ||||| ||| ||
Sbjct  5297059  AAAAAAAATAAAAAAAATTAAAAAAACAAACAAAC  5297093


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAA  2779
                |||||||||||||||||||
Sbjct  5503564  AAAAAAAATAAAAAAAAAA  5503546


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  2758     GGCAAAAAAAATAAAAAAAAAA  2779
                || |||||||||||||||||||
Sbjct  5548407  GGAAAAAAAAATAAAAAAAAAA  5548428


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  6903     ATTTTTACCTGAAGATAGAGCTTCTAAAA  6931
                ||||  ||||| ||||| |||||||||||
Sbjct  6809145  ATTTGAACCTGCAGATATAGCTTCTAAAA  6809117


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2762     AAAAAAATAAAAAAAAAATAAA  2783
                ||||||||||||||||| ||||
Sbjct  7389445  AAAAAAATAAAAAAAAACTAAA  7389424


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2759     GCAAAAAAAATAAAAAAAAAAT  2780
                ||||||||||| ||||||||||
Sbjct  7684716  GCAAAAAAAATTAAAAAAAAAT  7684695


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 25/29 (87%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  22       TTGTTTTATTTTTTCGTAATTCTGTCTTT  50
                || |||||||||||| | || ||||||||
Sbjct  7748568  TTTTTTTATTTTTTCTTTATACTGTCTTT  7748596


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 27/31 (88%), Gaps = 2/31 (6%)
 Strand=Plus/Plus

Query  1307     TTTTTTATTTTCCATTTTTCAGTTTTTGTTT  1337
                ||||||||||| |||||| ||  ||||||||
Sbjct  8007610  TTTTTTATTTTTCATTTTACA--TTTTGTTT  8007638


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  2761     AAAAAAAATAAAAAAAAAA  2779
                |||||||||||||||||||
Sbjct  8650406  AAAAAAAATAAAAAAAAAA  8650424


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 24/26 (93%), Gaps = 1/26 (3%)
 Strand=Plus/Minus

Query  2755     TTTGGCAAAAAAAATAAAAAAAAAAT  2780
                |||| ||||||||| |||||||||||
Sbjct  8755500  TTTGTCAAAAAAAA-AAAAAAAAAAT  8755476


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAATAA  2782
                ||||||||||||||||||| ||
Sbjct  9528272  AAAAAAAATAAAAAAAAAAAAA  9528251


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 27/32 (85%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  3823     GGTAACATTACTGTTAATGGCAAAGACATTCT  3854
                |||| ||  |||||  ||||||||||||||||
Sbjct  9901987  GGTATCAAGACTGTATATGGCAAAGACATTCT  9902018


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 31/38 (82%), Gaps = 2/38 (5%)
 Strand=Plus/Plus

Query  2744      AAAGAGCAGAATTT--GGCAAAAAAAATAAAAAAAAAA  2779
                 ||||||||  |||   ||||||||  ||||||||||||
Sbjct  10175953  AAAGAGCACTATTGAGGGCAAAAAGTATAAAAAAAAAA  10175990


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  5251      CAAAACATCCATGGAGTGAGTGTC  5274
                 |||||||||||||||  |||||||
Sbjct  10395579  CAAAACATCCATGGATAGAGTGTC  10395556


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  2760      CAAAAAAAATAAAAAAAAAATAAA  2783
                 ||||||||||||| |||||| |||
Sbjct  10406791  CAAAAAAAATAAACAAAAAAAAAA  10406814


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  1965      ACAAAAAAACAATCATCAT  1983
                 |||||||||||||||||||
Sbjct  10582237  ACAAAAAAACAATCATCAT  10582255


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 48.2 bits (52),  Expect = 0.001
 Identities = 32/36 (89%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  2761    AAAAAAAATAAAAAAAAAATAAACACACATACTCAT  2796
               |||||||| ||||||||| | || ||||||||||||
Sbjct  535978  AAAAAAAAAAAAAAAAAATTGAAAACACATACTCAT  535943


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 27/31 (88%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAATAAACACACATA  2791
                |||||||| |||||||||||||| | | |||
Sbjct  1185136  AAAAAAAAAAAAAAAAAAATAAAAAAAAATA  1185106


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  2759     GCAAAAAAAATAAAAAAAAAATAAAC  2784
                |||||| |||||||||||||| ||||
Sbjct  1369980  GCAAAACAAATAAAAAAAAAAAAAAC  1369955


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  2767    AATAAAAAAAAAATAAACACACATACTCAT  2796
               |||||||||||||| |||| |||| || ||
Sbjct  231003  AATAAAAAAAAAATTAACATACATTCTTAT  231032


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 24/25 (96%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  6222    GTGTATCAAAGTAA-AAAAAAGATT  6245
               |||||||||||||| ||||||||||
Sbjct  572063  GTGTATCAAAGTAATAAAAAAGATT  572087


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 27/31 (88%), Gaps = 1/31 (3%)
 Strand=Plus/Plus

Query  2753    AATTTGGCAAAAAAAATAAAAAAAAAATAAA  2783
               || ||||||||||||| ||||| |||| |||
Sbjct  972127  AACTTGGCAAAAAAAA-AAAAACAAAAGAAA  972156


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  2763     AAAAAATAAAAAAAAAATAAAC  2784
                ||||||||||||||||| ||||
Sbjct  1366489  AAAAAATAAAAAAAAAAAAAAC  1366510


> AEAS01000133  Kluyveromyces aestuarii ATCC 18862 contig00139, 
whole genome shotgun sequence
Length=95829

 Score = 42.8 bits (46),  Expect = 0.061
 Identities = 31/36 (87%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  2760   CAAAAAAAATAAAAAAAAAATAAACACACATACTCA  2795
              ||||||||||||||||| ||| ||  |||||| |||
Sbjct  88598  CAAAAAAAATAAAAAAATAATTAAGGCACATAGTCA  88633


> KLDOg2768
Length=705

 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 28/31 (91%), Gaps = 2/31 (6%)
 Strand=Plus/Plus

Query  1086  CGCATGAGCACACGGGCACGGGCACGGGCAC  1116
             |||||| ||||  ||||||||||||||||||
Sbjct  404   CGCATGCGCAC--GGGCACGGGCACGGGCAC  432


> AEAV01000232  Kluyveromyces wickerhamii UCD 54-210 contig00243, 
whole genome shotgun sequence
Length=45488

 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 27/29 (94%), Gaps = 1/29 (3%)
 Strand=Plus/Minus

Query  4436   AGTTTGAAAAGCCTTTGATCTTGTGTGAG  4464
              |||| ||||||||||||||||||| ||||
Sbjct  37119  AGTTCGAAAAGCCTTTGATCTTGT-TGAG  37092


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  1300   TTTTTCATTTTTTATTTTCCATTTTTCA  1327
              |||||||||||| |||||| | ||||||
Sbjct  10827  TTTTTCATTTTTCATTTTCAAATTTTCA  10800


> KLWIg4587 KLWIg4587 undefined product 9363873:9365588 reverse
Length=1716

 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 27/29 (94%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  4436  AGTTTGAAAAGCCTTTGATCTTGTGTGAG  4464
             |||| ||||||||||||||||||| ||||
Sbjct  710   AGTTCGAAAAGCCTTTGATCTTGT-TGAG  737


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2762     AAAAAAATAAAAAAAAAATAAA  2783
                ||||||||||||||||||||||
Sbjct  2231475  AAAAAAATAAAAAAAAAATAAA  2231454


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  2761    AAAAAAAATAAAAAAAAAATAAAC  2784
               ||||||||||||||||||| ||||
Sbjct  455283  AAAAAAAATAAAAAAAAAAAAAAC  455260


 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 35/43 (82%), Gaps = 1/43 (2%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAATAAACAC-ACATACTCATCGAGAA  2802
                |||||||||||||||||||  | ||| ||| | || | |||||
Sbjct  2430978  AAAAAAAATAAAAAAAAAAATACCACGACAAATTCTTGGAGAA  2430936


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 24/25 (96%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  2760    CAAAAAAAATAAAAAA-AAAATAAA  2783
               |||||||||||||||| ||||||||
Sbjct  841181  CAAAAAAAATAAAAAATAAAATAAA  841205


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2758    GGCAAAAAAAATAAAAAAAAAA  2779
               ||||||||||| ||||||||||
Sbjct  471582  GGCAAAAAAAAAAAAAAAAAAA  471561


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  6625     TTCATCATACGACAGTTTCTTGAT  6648
                ||||||| |||| |||||||||||
Sbjct  1344651  TTCATCAAACGATAGTTTCTTGAT  1344628


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  1288     AATTCAGCTTGCTTTTTCATTT  1309
                |||||||||| |||||||||||
Sbjct  1704437  AATTCAGCTTTCTTTTTCATTT  1704458


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 24/26 (93%), Gaps = 1/26 (3%)
 Strand=Plus/Plus

Query  2761     AAAAAAAATAA-AAAAAAAATAAACA  2785
                ||||||||||| |||||||| |||||
Sbjct  2267228  AAAAAAAATAAGAAAAAAAAAAAACA  2267253


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  2761     AAAAAAAATAAAAAAAAAATAAACA  2785
                ||||||||| |||||||||||||||
Sbjct  2107451  AAAAAAAATGAAAAAAAAATAAACA  2107427


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  2757     TGGCAAAAAAAATAAAAAAAAAA  2779
                |||||||||||| ||||||||||
Sbjct  2137952  TGGCAAAAAAAAAAAAAAAAAAA  2137974


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  2760    CAAAAAAAATAAAAAAAAA  2778
               |||||||||||||||||||
Sbjct  164902  CAAAAAAAATAAAAAAAAA  164884


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 23/24 (96%), Gaps = 1/24 (4%)
 Strand=Plus/Minus

Query  591     TTTTTTTCTTTTTTTTT-GGCGGG  613
               ||||||||||||||||| ||||||
Sbjct  771457  TTTTTTTCTTTTTTTTTTGGCGGG  771434


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  2761    AAAAAAAATAAAAAAAAAATAA  2782
               |||||||| |||||||||||||
Sbjct  776310  AAAAAAAAAAAAAAAAAAATAA  776331


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  2760     CAAAAAAAATAAAAAAAAAATAAA  2783
                ||||||||| ||||||||||| ||
Sbjct  1350136  CAAAAAAAAAAAAAAAAAAATTAA  1350159


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  590      GTTTTTTTCTTTTTTTTTGGCGGG  613
                |||||||| |||||||||||| ||
Sbjct  1511324  GTTTTTTTTTTTTTTTTTGGCAGG  1511347


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  1354     GTTGCTTCTCCAAGATGAAAAAAA  1377
                ||||||||| ||||||||||| ||
Sbjct  1511713  GTTGCTTCTGCAAGATGAAAAGAA  1511736


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 30/36 (84%), Gaps = 2/36 (5%)
 Strand=Plus/Minus

Query  2758     GGCAAAAAAAATAAAAAAAAAAT--AAACACACATA  2791
                ||||||||||| ||||||||| |  ||| ||| |||
Sbjct  1565921  GGCAAAAAAAAAAAAAAAAAAGTTGAAAAACAAATA  1565886


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  6173     AAAAAAAAAAAACATCGAGAAAATTTC  6199
                |||||||||||||||| | | ||||||
Sbjct  1575367  AAAAAAAAAAAACATCAACACAATTTC  1575341


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 26/29 (90%), Gaps = 1/29 (3%)
 Strand=Plus/Minus

Query  6173     AAAAAAAAAAAACATCGAGAAAATTTCAG  6201
                ||||||||||||||  || ||||||||||
Sbjct  2013837  AAAAAAAAAAAACAAAGA-AAAATTTCAG  2013810


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1300     TTTTTCATTTTTTATTTTCCATTTTTC  1326
                |||||||||||| ||||| ||||| ||
Sbjct  2081997  TTTTTCATTTTTCATTTTTCATTTCTC  2081971


> AEAS01000136  Kluyveromyces aestuarii ATCC 18862 contig00142, 
whole genome shotgun sequence
Length=38619

 Score = 41.0 bits (44),  Expect = 0.21
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  2761   AAAAAAAATAAAAAAAAAATAAACACACATACTCA  2795
              |||||||| |||||||||||| ||  ||| |||||
Sbjct  37847  AAAAAAAAGAAAAAAAAAATACACTGACAAACTCA  37813


> KLDOg420
Length=1338

 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  6447  TAAAGAAAGACTCTTCTTCGATGT  6470
             |||||| |||||||||||||||||
Sbjct  954   TAAAGAGAGACTCTTCTTCGATGT  931


> AEAV01000211  Kluyveromyces wickerhamii UCD 54-210 contig00221, 
whole genome shotgun sequence
Length=35822

 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 24/26 (93%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  6663  TATTAGATATTTTCAGAAATATGCAT  6688
             ||| |||||||||||||| |||||||
Sbjct  103   TATCAGATATTTTCAGAAGTATGCAT  78


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Plus

Query  2761    AAAAAAAATAAAAAAAAAATAAACAC-ACATAC  2792
               |||||||||||||||||||   |||| ||||||
Sbjct  774974  AAAAAAAATAAAAAAAAAAGTCACACAACATAC  775006


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 25/27 (93%), Gaps = 1/27 (3%)
 Strand=Plus/Minus

Query  1300    TTTTTCATTTTTT-ATTTTCCATTTTT  1325
               |||||| |||||| |||||||||||||
Sbjct  457013  TTTTTCTTTTTTTCATTTTCCATTTTT  456987


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 24/26 (93%), Gaps = 1/26 (3%)
 Strand=Plus/Plus

Query  2761    AAAAAAAATAAAAAAAAAAT-AAACA  2785
               |||||||| ||||||||||| |||||
Sbjct  868707  AAAAAAAAAAAAAAAAAAATCAAACA  868732


 Score = 35.6 bits (38),  Expect = 9.0
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  6922     GCTTCTAAAACAAAAAAAA  6940
                |||||||||||||||||||
Sbjct  1546574  GCTTCTAAAACAAAAAAAA  1546592


> AEAS01000241  Kluyveromyces aestuarii ATCC 18862 contig00542, 
whole genome shotgun sequence
Length=72008

 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 32/39 (83%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  2759  GCAAAAAAAATAAAAAAAAAATAAACACACATACTCATC  2797
             ||||||||||||||||| |||  | ||| | | ||||||
Sbjct  1180  GCAAAAAAAATAAAAAATAAAATACCACTCCTGCTCATC  1142


 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  2763   AAAAAATAAAAAAAAAATAAACACACATAC  2792
              ||||||||||||||||| |  |||||| ||
Sbjct  66874  AAAAAATAAAAAAAAAAAACGCACACACAC  66903


> AEAS01000218  Kluyveromyces aestuarii ATCC 18862 contig00238, 
whole genome shotgun sequence
Length=23195

 Score = 39.2 bits (42),  Expect = 0.74
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  2763  AAAAAATAAAAAAAAAATAAACACACATA  2791
             ||||| ||||||||||| | |||||||||
Sbjct  3195  AAAAATTAAAAAAAAAACACACACACATA  3167


> AEAV01000137  Kluyveromyces wickerhamii UCD 54-210 contig00143, 
whole genome shotgun sequence
Length=59788

 Score = 37.4 bits (40),  Expect = 2.6
 Identities = 25/28 (90%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  2750   CAGAATTTGGCAAAAAAAATAAAAAAAA  2777
              ||||||||| | | ||||||||||||||
Sbjct  14627  CAGAATTTGCCTACAAAAATAAAAAAAA  14654



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 453095857760


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
TTTTGAAAACTGATTATCGTCTTGTTTTATTTTTTCGTAATTCTGTCTTTAATCATTAAC
ACTGACTGAAGGATATAATTATAAGACAACACACAGAGACTTTTGTTTGCTGTTTAGCTT
ACACTTTCCAGCTATATTGAATAGCATATATATGTTCCAGAAGCTACAACCACCTTGAAC
TACAGCCCAACTCAACATTGAAAGTTACTGCCTTTATATACCTTGATACACCATTTAGAC
CTCCAATTAACCGATTGTCCTTGTCATAATGAGCTAGAGTAGCAAGGTATCAACAACAGT
ATGGACATCTTATTGTCAACTTTCTAGTACGGAGGGAAGAATCCCGAATATGTTAAATCT
GACGCGCGGGTATTGCTAAGTCACGTTGCAGGCCCACGCAGACCCGAGTTTCTTTCTTAC
AAAAGCGTGTACACACGTAAACGCGCTCGGTGCACCGAACGGCCAGGGTCGGGGTTCATT
CGGTATAGAGCCACGCAGGTAACTTGCCAATTCCAAAAAAAATTAAATGACGATACTAGT
AACCAAAGGAAAGGAACAGATAGATAAAATTCCGAGACTGTCAAATTAGGTTTTTTTCTT
TTTTTTTGGCGGGAGTCAGTGGGCCGAAATATGTTCTTGGCCTAGAACTTAATCTGGTTT
GATCATGCCAATACTTGCCTGAGTGCCCGACTTTTTGCCCACCCTTTTGCCTTCTGTCTA
TCCTTCAAAACCCACCTGTTTTCCAGCCGTATCTTCGCTCGCATCTACACATACTGTGCC
ATATCTTGTGTGTAGCCGGACGTGACTATGACCAAAAACAAACAAGGAGAACTGTTCGCC
GATTTGTAACACTCCTGCATCCATCCAAGTGGGTATGCGCTATGCAATGTTAAGCTAGGT
CAGGTCAGACCAGGTCCAAGGACAGCAACTTGACTGTATGCAACCTTTACCATCTTTGCA
CAGAACATACTTGTAGCTAGCTAGTTACACTTATGGACCGAAAAGGCACCCCACCATGTC
TGTCCGGCTTTAGAGTACGGCCGCAGACCGCTGATTTGCCTTGCCAAGCAGTAGTCACAA
TGCATCGCATGAGCACACGGGCACGGGCACGGGCACAGGAACCATTGGCAAAAATACCAG
ATACACTATACCGACGTATATCAAGCCCAAGTTTAAAATTCCTAAATTTCCGCGGGGATC
GACTCATAAAATAGTAACCTTCTAATGCGTATCTATTGACTACCAACCATTAGTGTGGTT
GCAGAAGGCGGAATTCTCCCTTCTTCGAATTCAGCTTGCTTTTTCATTTTTTATTTTCCA
TTTTTCAGTTTTTGTTTGTGTCGAATTTAGCCAGTTGCTTCTCCAAGATGAAAAAAACCC
CTGCGCAGTTTCTGTGCTGCAAGATCCTAATCGACTTTTCCACCCCCCACAAAAGTAAAT
GTTCTTTTGTTACATTCGCGTGGGTAGCTAGCTCCCCGAATCTTCAAAGGACTTAGGGAC
TGCACTACATCAGAGTGTGTTCACCTGGTTTGCTGCCTGGTTTGAAAGAAAAGAGCAGGG
AACTCGCGGGTTCCCGGCGAATAATCATGCGATAGTCCTTTGGCCTTCCAAGTCGCATGT
AGAGTAGACAACAGACAGGGAGGGCAGGAAGGATCTTTCACTGAGATCCTGTATCTTGTT
GGGTAAGTCGGATGAAAGGGGAATCGTATGAGATTGGAGAGGATGCGGAAGAGGTAACGC
CTTTTGTTAACTTGTTTAATTATTATGGGGCAGGCGAGAGGGGGAGGAATGTATGTGTGT
GAGGCGGGCGAGACGGAGCCATCCAGGCCAGGTAGAAATAGAGAAAGCCGAATGTTAGAC
AATATGGCAGCGTAGTAGAGTAGGTAGGTAGGCAAGTACTGCTAGCAAAGAGGAGAAGGG
TAAGCTCACTCTTCGCATTCCACACCGTTAGTGTGTCAGTTTGAACAAAAAAACAATCAT
CATACCAATTGATGGACTGTGGACTGGCTTTTGGAACGGCTTTTCGGACTGCGATTATTC
GTGAGGAATCAAGGTAGGAATTTGGTCATATTTACGGACAACAGTGGGTGATTCCCATAT
GGAGTAGGAAAACGAGATCATGGTATCCTCAGATATGTTGCGGAATTCTGTTCACCGCAA
AGTTCAGGGTGCTCTGGTGGGTTTCGGTTGGTCTTTGCTTTGCTTCTCCCTTGTCTTGCA
TGTTAATAATAGCCTAGCCTGTGAGCCGAAACTTAGGGTAGGCTTAGTGTTGGAACGTAC
ATATGTATCACGTTGACTTGGTTTAACCAGGCGACCTGGTAGCCAGCCATACCCACACAC
GTTTTTTGTATCTTCAGTATAGTTGTGAAAAGTGTAGCGGAAATTTGTGGTCCGAGCAAC
AGCGTCTTTTTCTAGTAGTGCGGTCGGTTACTTGGTTGACATTGGTATTTGGACTTTGTT
GCTACACCATTCACTACTTGAAGTCGAGTGTGAAGGGTATGATTTCTAGTGGTGAACACC
TTTAGTTACGTAATGTTTTCATTGCTGTTTTACTTGAGATTTCGATTGAGAAAAAGGTAT
TTAATAGCTCGAATCAATGTGTTATCATTGTGAAGATGTTCTTCCCTAACTCGAAAGGTA
TATGAGGCTTGTGTTTCTTAGGAGAATTATTATTCTTTTGTTATGTTGCGCTTGTAGTTG
GAAAAGGTGAAGAGACAAAAGCGCTTAACACTTGAAATTTAGGAAAGAGCAGAATTTGGC
AAAAAAAATAAAAAAAAAATAAACACACATACTCATCGAGAACTGAAAGATATGTCTTGC
CTTATTCCTGAGAATTTAAGGAACCCCAAAAAGGTTCACGAAAATAGATTGCCTACTAGG
GCTTACTACTATGATCAGGATATTTTCGAATCTCTCAATGGGCCTTGGGCTTTTGCGTTG
TTTGATGCACCTCTTGACGCTCCGGATGCTAAGAATTTAGACTGGGAAACGGCAAAGAAA
TGGAGCACCATTTCTGTGCCATCCCATTGGGAACTTCAGGAAGACTGGAAGTACGGTAAA
CCAATTTACACGAACGTACAGTACCCTATCCCAATCGACATCCCAAATCCTCCCACTGTA
AATCCTACTGGTGTTTATGCTAGAACTTTTGAATTAGATTCGAAATCGATTGAGTCGTTC
GAGCACAGATTGAGATTTGAGGGTGTGGACAATTGTTACGAGCTTTATGTTAATGGTCAA
TATGTGGGTTTCAATAAGGGGTCCCGTAACGGGGCTGAATTTGATATCCAAAAGTACGTT
TCTGAGGGCGAAAACTTAGTGGTCGTCAAGGTTTTCAAGTGGTCCGATTCCACTTATATC
GAGGACCAAGATCAATGGTGGCTCTCTGGTATTTACAGAGACGTTTCTTTACTAAAATTG
CCTAAGAAGGCCCATATTGAAGACGTTAGGGTCACTACAACTTTTGTGGACTCTCAGTAT
CAGGATGCAGAGCTTTCTGTGAAAGTTGATGTCCAGGGTTCTTCTTATGATCACATCAAT
TTCACACTTTACGAACCTGAAGATGGATCTAAAGTTTACGATGCAAGCTCTTTGTTGAAC
GAGGAGAATGGGAACACGACTTTTTCAACTAAAGAATTTATTTCCTTCTCCACCAAAAAG
AACGAAGAAACAGCTTTCAAGATCAACGTCAAGGCCCCAGAACATTGGACCGCAGAAAAT
CCTACTTTGTACAAGTACCAGTTGGATTTAATTGGATCTGATGGCAGTGTGATTCAATCT
ATTAAGCACCATGTTGGTTTCAGACAAGTGGAGTTGAAGGACGGTAACATTACTGTTAAT
GGCAAAGACATTCTCTTTAGAGGTGTCAACAGACATGATCACCATCCAAGGTTCGGTAGA
GCTGTGCCATTAGATTTTGTTGTTAGGGACTTGATTCTAATGAAGAAGTTTAACATCAAT
GCTGTTCGTAACTCGCATTATCCAAACCATCCTAAGGTGTATGACCTCTTCGATAAGCTG
GGCTTCTGGGTCATTGACGAGGCAGATCTTGAAACTCATGGTGTTCAAGAGCCATTTAAT
CGTCATACGAACTTGGAGGCTGAATATCCAGATACTAAAAATAAACTCTACGATGTTAAT
GCCCATTACTTATCAGATAATCCAGAGTACGAGGTCGCGTACTTAGACAGAGCTTCCCAA
CTTGTCCTAAGAGATGTCAATCATCCTTCGATTATTATCTGGTCCTTGGGTAACGAAGCT
TGTTATGGCAGAAACCACAAAGCCATGTACAAGTTAATTAAACAATTGGATCCTACCAGA
CTTGTGCATTATGAGGGTGACTTGAACGCTTTGAGTGCAGATATCTTTAGTTTCATGTAC
CCAACATTTGAAATTATGGAAAGGTGGAGGAAGAACCACACTGATGAAAATGGTAAGTTT
GAAAAGCCTTTGATCTTGTGTGAGTACGGCCATGCAATGGGTAACGGTCCTGGCTCTTTG
AAAGAATATCAAGAGTTGTTCTACAAGGAGAAGTTTTACCAAGGTGGCTTTATCTGGGAA
TGGGCAAATCACGGTATTGAATTCGAAGATGTTAGTACTGCAGATGGTAAGTTGCATAAA
GCTTATGCTTATGGTGGTGACTTTAAGGAAGAGGTTCATGACGGAGTGTTCATCATGGAT
GGTTTGTGTAACAGTGAGCATAATCCTACTCCGGGCCTTGTAGAGTATAAGAAGGTTATT
GAACCCGTTCATATTAAAATTGCGCACGGATCTGTAACAATCACAAATAAGCACGACTTC
ATTACGACAGACCACTTATTGTTTATCGACAAGGACACGGGAAAGACAATCGACGTTCCA
TCTTTAAAGCCAGAAGAATCTGTTACTATTCCTTCTGATACAACTTATGTTGTTGCCGTG
TTGAAAGATGATGCTGGTGTTCTAAAGGCAGGTCATGAAATTGCCTGGGGCCAAGCTGAA
CTTCCATTGAAGGTACCCGATTTTGTTACAGAGACAGCAGAAAAAGCTGCGAAGATCAAC
GACGGTAAACGTTATGTCTCAGTTGAATCCAGTGGATTGCATTTTATCTTGGACAAATTG
TTGGGTAAAATTGAAAGCCTAAAGGTCAAGGGTAAGGAAATTTCCAGCAAGTTTGAGGGT
TCTTCAATCACTTTCTGGAGACCTCCAACGAATAATGATGAACCTAGGGACTTTAAGAAC
TGGAAGAAGTACAATATTGATTTAATGAAGCAAAACATCCATGGAGTGAGTGTCGAAAAA
GGTTCTAATGGTTCTCTAGCTGTAGTCACGGTTAACTCTCGTATATCCCCAGTTGTATTT
TACTATGGGTTTGAGACTGTTCAGAAGTACACGATCTTTGCTAACAAAATAAACTTGAAC
ACTTCTATGAAGCTTACTGGCGAATATCAGCCTCCTGATTTCCCAAGAGTTGGGTACGAA
TTCTGGCTAGGAGATAGTTATGAATCATTTGAATGGTTAGGTCGCGGGCCCGGCGAATCA
TATCCGGATAAGAAGGAATCTCAAAGATTCGGTCTTTACGATTCCAAAGATGTAGAGGAA
TTCGTATATGACTATCCTCAAGAAAATGGAAATCATACAGATACCCACTTTTTGAACATC
AAATTTGAAGGTGCAGGAAAACTATCGATCTTCCAAAAGGAGAAGCCATTTAACTTCAAG
ATTTCAGACGAATACGGGGTTGATGAAGCTGCCCACGCTTGTGACGTTAAAAGATACGGC
AGACACTATCTAAGGTTGGACCATGCAATCCATGGTGTTGGTAGCGAAGCATGCGGACCT
GCTGTTCTGGACCAGTACAGATTGAAAGCTCAAGATTTCAACTTTGAGTTTGATCTCGCT
TTTGAATAAGAATTTTATACTTAGATAAGTATGTACTTACAGGTATATTTCTATGAGATA
CTGATGTATACATGCATGATAATATTTAAACGGTTATTAGTGCCGATTGTCTTGTGCGAT
AATGACGTTCCTATCAAAGCAATACACTTACCACCTATTACATGGGCCAAGAAAATATTT
TCGAACTTGTTTAGAATATTAGCACAGAGTATATGATGATATCCGTTAGATTATGCATGA
TTCATTCCTACAACTTTTTCGTAGCATAAGGATTAATTACTTGGATGCCAATAAAAAAAA
AAAACATCGAGAAAATTTCAGCATGCTCAGAAACAATTGCAGTGTATCAAAGTAAAAAAA
AGATTTTCACTACATGTTCCTTTTGAAGAAAGAAAATCATGGAACATTAGATTTACAAAA
ATTTAACCACCGCTGATTAACGATTAGACCGTTAAGCGCACAACAGGTTATTAGTACAGA
GAAAGCATTCTGTGGTGTTGCCCCGGACTTTCTTTTGCGACATAGGTAAATCGAATACCA
TCATACTATCTTTTCCAATGACTCCCTAAAGAAAGACTCTTCTTCGATGTTGTATACGTT
GGAGCATAGGGCAAGAATTGTGGCTTGAGATCTAGATTACGTGGAAGAAAGGTAGTAAAA
GTAGTAGTATAAGTAGTAAAAAGAGGTAAAAAGAGAAAACCGGCTACATACTAGAGAAGC
ACGTACACAAAAACTCATAGGCACTTCATCATACGACAGTTTCTTGATGCATTATAATAG
TGTATTAGATATTTTCAGAAATATGCATAGAACCTCCTCTTGCCTTTACTTTTTATACAT
AGAACATTGGCAGATTTACTTACACTACTTTGTTTCTACGCCATTTCTTTTGTTTTCAAC
ACTTAGACAAGTTGTTGAGAACCGGACTACTAAAAAGCAATGTTCCCACTGAAAATCATG
TACCTGCAGGATAATAACCCCCTAATTCTGCATCGATCCAGTATGTTTTTTTTTCTCTAC
TCATTTTTACCTGAAGATAGAGCTTCTAAAACAAAAAAAATCAGTGATTACATGCATATT
GTGTGTTCTAGAATTGCGGATCACCAGATCGCCATTACAATGTATGCAGGCAAATATTTC
TCAGAATGAAAAATAGAGAAAAGGAAACGAAAATTCTGTAAGATGCCTTCGAAGAGATTT
CTCGATATGCAAGGCGTGCATCAGGGTGATCCAAAGGAACTCGAGAGAGAGGGCGAAAGG
CAATTTAATGCATTGCTTCTCCATTGACTTCTAGTTGAGCGGATAAGTTCGGAAATGTAA
GTCACAGCTAATGACAAATCCACTTTAGGTTTCGAGGCACTATTTAGGCAAAAAGACGAG
TGGGGAAATAACAAACGCTCAAACATATTAGCATATACGTTCAAAAAATGG
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)