blastn task: [no title]

Status
finished finished
Modified 2016-05-16T13:20:48Z
CPU time (s) 0.0
Size (bytes) 12973
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
           336 sequences; 9,910,115 total letters



Query= query

Length=886
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000152  Kluyveromyces aestuarii ATCC 18862 contig00161, w...   695    0.0  
  AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, w...  35.6    0.17 
  AEAS01000254  Kluyveromyces aestuarii ATCC 18862 contig00556, w...  31.9    2.1  
  AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, w...  31.9    2.1  
  AEAS01000135  Kluyveromyces aestuarii ATCC 18862 contig00141, w...  31.9    2.1  
  AEAS01000130  Kluyveromyces aestuarii ATCC 18862 contig00136, w...  31.9    2.1  
  AEAS01000087  Kluyveromyces aestuarii ATCC 18862 contig00092, w...  31.9    2.1  
  AEAS01000013  Kluyveromyces aestuarii ATCC 18862 contig00014, w...  31.9    2.1  
  AEAS01000172  Kluyveromyces aestuarii ATCC 18862 contig00185, w...  30.1    7.2  
  AEAS01000159  Kluyveromyces aestuarii ATCC 18862 contig00170, w...  30.1    7.2  
  AEAS01000128  Kluyveromyces aestuarii ATCC 18862 contig00134, w...  30.1    7.2  
  AEAS01000120  Kluyveromyces aestuarii ATCC 18862 contig00126, w...  30.1    7.2  
  AEAS01000113  Kluyveromyces aestuarii ATCC 18862 contig00118, w...  30.1    7.2  
  AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, w...  30.1    7.2  
  AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, w...  30.1    7.2  
  AEAS01000058  Kluyveromyces aestuarii ATCC 18862 contig00062, w...  30.1    7.2  


> AEAS01000152  Kluyveromyces aestuarii ATCC 18862 contig00161, 
whole genome shotgun sequence
Length=51814

 Score =  695 bits (770),  Expect = 0.0
 Identities = 679/874 (78%), Gaps = 3/874 (0%)
 Strand=Plus/Plus

Query  1      CCCTCATAACGGCACAAAGACAGAAATCCCAACTTCCCTTGAAGAATTGTTGAAACCAAG  60
              ||||||||| || || || || ||||| || ||| |  ||| ||||||||| || |||||
Sbjct  48162  CCCTCATAATGGAACTAAAACCGAAATTCCGACTACTATTGGAGAATTGTTAAAGCCAAG  48221

Query  61     CGACAAGGTCCTATTGAAGAAACGTGTGTTTGCATTGCGTAGGCCAGAGGGAACCCTACC  120
               |||| |||  | || ||||||||||| || || ||||||||||| |||||| |  ||||
Sbjct  48222  TGACATGGTTTTGTTAAAGAAACGTGTTTTCGCCTTGCGTAGGCCGGAGGGATCTTTACC  48281

Query  121    CCCAATCGTGACCCACAACATGGTGGACGACGCTACGGATCCCGTCTTGAACCAAATCAG  180
               |||||||||||||| || ||||| || || || |  |||||  | ||||| ||||| ||
Sbjct  48282  TCCAATCGTGACCCATAATATGGTTGAAGATGCCAGTGATCCAATTTTGAATCAAATTAG  48341

Query  181    ACGTGTCCAATTGTTCAACAACTCGTACGATCGTGTCAAGATCATTTTCCATCCAGAGTT  240
              ||| || || |||||||||||||| || || || || ||||| ||||||||||| || ||
Sbjct  48342  ACGAGTTCAGTTGTTCAACAACTCTTATGACCGAGTTAAGATAATTTTCCATCCTGAATT  48401

Query  241    CTTGAACGCCAATAACCCAATCTTATCTCTAGATTACGACGAGTTCGTCAGAGGTTGCCA  300
              |||||| || ||||| ||||| |||||||||||||| || || || ||  | || |||||
Sbjct  48402  CTTGAATGCAAATAATCCAATTTTATCTCTAGATTATGATGAATTTGTTCGCGGATGCCA  48461

Query  301    TTTGGGTGTGTTCCCTTCGTATTACGAGCCATGGGGTTACACCCCAGCAGAGTGTACCGT  360
              ||| ||||| |||||||| || || || || ||||| ||||| |||||||||||||| ||
Sbjct  48462  TTTAGGTGTCTTCCCTTCTTACTATGAACCTTGGGGATACACTCCAGCAGAGTGTACTGT  48521

Query  361    CATGGGTATCCCATCCATCACAACCAACTTGTCCGGTTTTGGTGCATACATGGAGGATTT  420
              |||||| || |||||||| |||||||| ||||| || |||||||| |||||||| |||||
Sbjct  48522  CATGGGGATTCCATCCATAACAACCAATTTGTCAGGGTTTGGTGCGTACATGGAAGATTT  48581

Query  421    GATAGAGAAGGATCAGGCTAAGGATTACGGTATCTACATCGTAGACCGTCGTTTCAAAAA  480
               || ||||| |||||||||||||| || ||||| ||||| |||||||||||||| || ||
Sbjct  48582  AATTGAGAAAGATCAGGCTAAGGACTATGGTATTTACATTGTAGACCGTCGTTTTAAGAA  48641

Query  481    CCCAGACGAGTCTGTCAACCAGCTTGTCGACTACATGGAGGAGTTCGTCCTCAAGACCCG  540
               || || || || ||  | ||  | || || || ||||| || || ||   ||| |||||
Sbjct  48642  TCCTGATGAATCAGTTGAACAATTGGTTGATTATATGGAAGATTTTGTGAACAAAACCCG  48701

Query  541    TAGACAAAGAATCAACCAAAGAAACAGAACTGAACGTTTATCCGATCTATTGGACTGGAG  600
               ||||||||||| || |||||||| ||||||||||||||||| ||||||||||| |||||
Sbjct  48702  CAGACAAAGAATTAATCAAAGAAATAGAACTGAACGTTTATCGGATCTATTGGATTGGAG  48761

Query  601    ACGTATGGGTTTAGAATACGTCAAGGCTCGTCAACTTGCCTTGCGTAGAGCGTACCCAGA  660
              |||||||||  | |||||||| || ||  | ||| | ||  | ||||| || || || ||
Sbjct  48762  ACGTATGGGGCTTGAATACGTTAAAGCAAGGCAATTAGCTCTACGTAGGGCATATCCGGA  48821

Query  661    TGAGTTCAAAGAATTGACAGGCGGAAACGAACTCGATGACTCCAACATGGATTCAATGGC  720
              ||| || | ||||||  | || || |  ||  | || ||||| || |||||  |  ||||
Sbjct  48822  TGAATTTAGAGAATTAGCTGGTGGCACTGAGGTGGACGACTCTAATATGGACACTCTGGC  48881

Query  721    AGGTAAAAAACAAAAAATCAAGGTCGCAAGACCTTTGAGTGTCCCTGGCTCTCCAAAGGA  780
              ||| || |    |||||| |  || || |||||| | ||||| ||||| || || || ||
Sbjct  48882  AGGCAATA---GAAAAATTAGAGTTGCTAGACCTCTCAGTGTACCTGGGTCACCTAAAGA  48938

Query  781    CTCTAGAGCAAGCAGCGTTGGCGCCGTAATGATGACTCCCGGCGATTTCGGGACTCTACA  840
              ||| ||| |  | || || || || || |||||||| || || ||| | || ||  ||||
Sbjct  48939  CTCCAGATCGGGAAGTGTAGGTGCAGTGATGATGACACCTGGTGATCTAGGTACCATACA  48998

Query  841    AGACGCTAACAACGCAGATGACTATTTCCATCTT  874
              ||| |||||||| ||||| || |||||||| |||
Sbjct  48999  AGATGCTAACAATGCAGACGATTATTTCCACCTT  49032


> AEAS01000277  Kluyveromyces aestuarii ATCC 18862 contig00598, 
whole genome shotgun sequence
Length=84350

 Score = 35.6 bits (38),  Expect = 0.17
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  42     AAGAATTGTTGAAACCAAGCGACA  65
              |||||||| |||||||||||| ||
Sbjct  15173  AAGAATTGGTGAAACCAAGCGTCA  15150


> AEAS01000254  Kluyveromyces aestuarii ATCC 18862 contig00556, 
whole genome shotgun sequence
Length=60282

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  779    GACTCTAGAGCAAGCAG  795
              |||||||||||||||||
Sbjct  32980  GACTCTAGAGCAAGCAG  32964


> AEAS01000146  Kluyveromyces aestuarii ATCC 18862 contig00155, 
whole genome shotgun sequence
Length=165313

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  239     TTCTTGAACGCCAATAACCCAATCTTA  265
               |||||||||||||||| | || | |||
Sbjct  124197  TTCTTGAACGCCAATAGCTCATTTTTA  124171


> AEAS01000135  Kluyveromyces aestuarii ATCC 18862 contig00141, 
whole genome shotgun sequence
Length=113607

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  714    CAATGGCAGGTAAAAAACAAAAAATCA  740
              |||| |||||||||||| || || |||
Sbjct  59230  CAATCGCAGGTAAAAAAAAATAATTCA  59204


> AEAS01000130  Kluyveromyces aestuarii ATCC 18862 contig00136, 
whole genome shotgun sequence
Length=20341

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 25/29 (87%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  714   CAATGGCAGGTAAAAAACAAAAAATCAAG  742
             |||| || || |||||||||||| |||||
Sbjct  2880  CAATTGCGGG-AAAAAACAAAAATTCAAG  2907


> AEAS01000087  Kluyveromyces aestuarii ATCC 18862 contig00092, 
whole genome shotgun sequence
Length=166145

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  683     GGAAACGAACTCGATGACTC  702
               ||||||||||||||||| ||
Sbjct  148163  GGAAACGAACTCGATGAATC  148182


> AEAS01000013  Kluyveromyces aestuarii ATCC 18862 contig00014, 
whole genome shotgun sequence
Length=24651

 Score = 31.9 bits (34),  Expect = 2.1
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  633    AACTTGCCTTGCGTAGA  649
              |||||||||||||||||
Sbjct  18855  AACTTGCCTTGCGTAGA  18871


> AEAS01000172  Kluyveromyces aestuarii ATCC 18862 contig00185, 
whole genome shotgun sequence
Length=37702

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 21/24 (88%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  543    GACAAAGAATCAACCAAAGAAACA  566
              ||| || ||| |||||||||||||
Sbjct  13169  GACGAACAATGAACCAAAGAAACA  13192


> AEAS01000159  Kluyveromyces aestuarii ATCC 18862 contig00170, 
whole genome shotgun sequence
Length=111171

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 25/31 (81%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  21     CAGAAATCCCAACTTCCCTTGAAGAATTGTT  51
              || ||| | ||| ||| ||||||||||| ||
Sbjct  22089  CATAAACCACAAGTTCTCTTGAAGAATTTTT  22119


> AEAS01000128  Kluyveromyces aestuarii ATCC 18862 contig00134, 
whole genome shotgun sequence
Length=55338

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  658    AGATGAGTTCAAAGAA  673
              ||||||||||||||||
Sbjct  55192  AGATGAGTTCAAAGAA  55207


> AEAS01000120  Kluyveromyces aestuarii ATCC 18862 contig00126, 
whole genome shotgun sequence
Length=9685

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  747   CAAGACCTTTGAGTGT  762
             ||||||||||||||||
Sbjct  8426  CAAGACCTTTGAGTGT  8411


> AEAS01000113  Kluyveromyces aestuarii ATCC 18862 contig00118, 
whole genome shotgun sequence
Length=41694

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  856   AGATGACTATTTCCATCTT  874
             ||||||| |||||||||||
Sbjct  9556  AGATGACCATTTCCATCTT  9574


> AEAS01000105  Kluyveromyces aestuarii ATCC 18862 contig00110, 
whole genome shotgun sequence
Length=148475

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  184    TGTCCAATTGTTCAAC  199
              ||||||||||||||||
Sbjct  48966  TGTCCAATTGTTCAAC  48981


> AEAS01000068  Kluyveromyces aestuarii ATCC 18862 contig00072, 
whole genome shotgun sequence
Length=81824

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  687    ACGAACTCGATGACTC  702
              ||||||||||||||||
Sbjct  24319  ACGAACTCGATGACTC  24304


 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 22/26 (85%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  60     GCGACAAGGTCCTATTGAAGAAACGT  85
              |||| | |||||||||||| | ||||
Sbjct  30082  GCGATAGGGTCCTATTGAAAATACGT  30057


> AEAS01000058  Kluyveromyces aestuarii ATCC 18862 contig00062, 
whole genome shotgun sequence
Length=81525

 Score = 30.1 bits (32),  Expect = 7.2
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  90     TTGCATTGCGTAGGCCAGAGG  110
              |||||||||||| || |||||
Sbjct  18847  TTGCATTGCGTATGCGAGAGG  18867



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8515185940


  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
CCCTCATAACGGCACAAAGACAGAAATCCCAACTTCCCTTGAAGAATTGTTGAAACCAAGCGACAAGGTCCTATTGAAGAAACGTGTGTTTGCATTGCGTAGGCCAGAGGGAACCCTACCCCCAATCGTGACCCACAACATGGTGGACGACGCTACGGATCCCGTCTTGAACCAAATCAGACGTGTCCAATTGTTCAACAACTCGTACGATCGTGTCAAGATCATTTTCCATCCAGAGTTCTTGAACGCCAATAACCCAATCTTATCTCTAGATTACGACGAGTTCGTCAGAGGTTGCCATTTGGGTGTGTTCCCTTCGTATTACGAGCCATGGGGTTACACCCCAGCAGAGTGTACCGTCATGGGTATCCCATCCATCACAACCAACTTGTCCGGTTTTGGTGCATACATGGAGGATTTGATAGAGAAGGATCAGGCTAAGGATTACGGTATCTACATCGTAGACCGTCGTTTCAAAAACCCAGACGAGTCTGTCAACCAGCTTGTCGACTACATGGAGGAGTTCGTCCTCAAGACCCGTAGACAAAGAATCAACCAAAGAAACAGAACTGAACGTTTATCCGATCTATTGGACTGGAGACGTATGGGTTTAGAATACGTCAAGGCTCGTCAACTTGCCTTGCGTAGAGCGTACCCAGATGAGTTCAAAGAATTGACAGGCGGAAACGAACTCGATGACTCCAACATGGATTCAATGGCAGGTAAAAAACAAAAAATCAAGGTCGCAAGACCTTTGAGTGTCCCTGGCTCTCCAAAGGACTCTAGAGCAAGCAGCGTTGGCGCCGTAATGATGACTCCCGGCGATTTCGGGACTCTACAAGACGCTAACAACGCAGATGACTATTTCCATCTTGCCATGGATGAC
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)