blastn task: [no title]

Status
finished finished
Modified 2016-05-16T13:13:34Z
CPU time (s) 0.0
Size (bytes) 14608
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
           510 sequences; 9,807,744 total letters



Query= query

Length=876
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAV01000338  Kluyveromyces wickerhamii UCD 54-210 contig00350,...   827    0.0  
  AEAV01000470  Kluyveromyces wickerhamii UCD 54-210 contig00887,...  33.7    0.58 
  AEAV01000326  Kluyveromyces wickerhamii UCD 54-210 contig00337,...  33.7    0.58 
  AEAV01000102  Kluyveromyces wickerhamii UCD 54-210 contig00106,...  33.7    0.58 
  AEAV01000057  Kluyveromyces wickerhamii UCD 54-210 contig00060,...  33.7    0.58 
  AEAV01000216  Kluyveromyces wickerhamii UCD 54-210 contig00227,...  31.9    2.0  
  AEAV01000208  Kluyveromyces wickerhamii UCD 54-210 contig00216,...  31.9    2.0  
  AEAV01000198  Kluyveromyces wickerhamii UCD 54-210 contig00206,...  31.9    2.0  
  AEAV01000128  Kluyveromyces wickerhamii UCD 54-210 contig00134,...  31.9    2.0  
  AEAV01000064  Kluyveromyces wickerhamii UCD 54-210 contig00067,...  31.9    2.0  
  AEAV01000002  Kluyveromyces wickerhamii UCD 54-210 contig00002,...  31.9    2.0  
  AEAV01000411  Kluyveromyces wickerhamii UCD 54-210 contig00811,...  30.1    7.0  
  AEAV01000231  Kluyveromyces wickerhamii UCD 54-210 contig00242,...  30.1    7.0  
  AEAV01000196  Kluyveromyces wickerhamii UCD 54-210 contig00204,...  30.1    7.0  
  AEAV01000176  Kluyveromyces wickerhamii UCD 54-210 contig00183,...  30.1    7.0  
  AEAV01000119  Kluyveromyces wickerhamii UCD 54-210 contig00125,...  30.1    7.0  
  AEAV01000051  Kluyveromyces wickerhamii UCD 54-210 contig00054,...  30.1    7.0  
  AEAV01000038  Kluyveromyces wickerhamii UCD 54-210 contig00041,...  30.1    7.0  
  AEAV01000016  Kluyveromyces wickerhamii UCD 54-210 contig00017,...  30.1    7.0  
  AEAV01000015  Kluyveromyces wickerhamii UCD 54-210 contig00016,...  30.1    7.0  


> AEAV01000338  Kluyveromyces wickerhamii UCD 54-210 contig00350, 
whole genome shotgun sequence
Length=10108

 Score =  827 bits (916),  Expect = 0.0
 Identities = 708/872 (82%), Gaps = 2/872 (0%)
 Strand=Plus/Plus

Query  1     GCAGCACAACAAGCAAAAGCTTGCCGATTTGATCAAGAAGTTGTACGACGGCGAAGACAT  60
             ||||  |||||||   || || ||||| |||||| | ||  | |||||||| |||||  |
Sbjct  5907  GCAGGCCAACAAGTTGAAACTGGCCGACTTGATCGAAAAACTCTACGACGGTGAAGATGT  5966

Query  61    CATCGAAAGAGACCACATCAGAAACACCTTGTTCGACATCCAAGTGAAGCGTATTCACGA  120
              ||||| ||| | |||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct  5967  GATCGACAGAAAACACATCAGAAACACCTTGTTCGACATTCAAGTGAAGCGTATCCACGA  6026

Query  121   GTACAAGCGTCAACAGTTGAACATCTTTGGGTGCATCTACAGATACTTGCGGATCAAGGA  180
             |||||||||||||||  |||| ||||| || ||||| ||| | ||| ||  ||| |||||
Sbjct  6027  GTACAAGCGTCAACAAATGAATATCTTCGGCTGCATTTACCGTTACCTGAAGATGAAGGA  6086

Query  181   GTTGTTG-GCTGAAGGTGTCCCAATTGCCGAAGTGGAAAAGAAGTACCCAAGAAAGGTGT  239
             | || |  || |  || |   | || |  |||||||  |  ||||||||||||||||| |
Sbjct  6087  GCTGCTAAGCAGC-GGCGCATCCATCGAGGAAGTGGCCACCAAGTACCCAAGAAAGGTCT  6145

Query  240   CCATCTTTGGTGGTAAGAGTGCTCCAGGTTACTACATGGCCAAGACGATTATCAAGTTGA  299
             |||| || || ||||||||||| || || |||||||||||||||  ||| ||||||||||
Sbjct  6146  CCATTTTCGGCGGTAAGAGTGCGCCGGGCTACTACATGGCCAAGTTGATCATCAAGTTGA  6205

Query  300   TCAACAGTGTCAGCGACGTGGTGAACCACGACAAGGAGATCGGGAACATCTTCAAGGTCG  359
             |||||||||| ||||| || || ||||||||| ||||||||    || | ||||||||||
Sbjct  6206  TCAACAGTGTGAGCGATGTCGTCAACCACGACCAGGAGATCCAAGACTTGTTCAAGGTCG  6265

Query  360   TGTTCATTCCAGACTACAACGTCTCCAAGGCAGAAATCATCATTCCTGCCAGTGACTTGA  419
             ||||||| || |||||||||||||| ||||| || ||||||||||| || || |||||||
Sbjct  6266  TGTTCATCCCCGACTACAACGTCTCTAAGGCCGAGATCATCATTCCAGCAAGCGACTTGA  6325

Query  420   GTGAGCACATCTCTACCGCCGGTACCGAGGCCTCTGGTACATCCAACATGAAGTTTGTCA  479
             ||||||||||||| ||||| |||||||||||||| ||||| |||||||||||||| ||||
Sbjct  6326  GTGAGCACATCTCCACCGCTGGTACCGAGGCCTCCGGTACCTCCAACATGAAGTTCGTCA  6385

Query  480   TGAACGGTGGGTTGATCATTGGTACCGTGGACGGTGCCAACGTCGAGATCACCAGAGAAA  539
             ||||||||||  | ||||| ||||| || ||||||||||| ||||| ||||| ||||| |
Sbjct  6386  TGAACGGTGGTCTAATCATCGGTACTGTCGACGGTGCCAATGTCGAAATCACAAGAGAGA  6445

Query  540   TTGGAGAGGACAACATCTTCTTGTTTGGTAACTTGGCCGAGAACGTTGACGAGTTGAGAT  599
             | |||||||| |||||||| ||||| || ||||||||||| ||||| || ||||||||||
Sbjct  6446  TCGGAGAGGAGAACATCTTTTTGTTCGGCAACTTGGCCGAAAACGTCGAGGAGTTGAGAT  6505

Query  600   ACCAACACCAGTACCACGCCAAGCCATTGCCAAAGGAGTTGGAGGAAGTGTTGCAACTGA  659
             |||| |||||||||||| || | ||||||||  |  | ||||||   ||| | ||    |
Sbjct  6506  ACCAGCACCAGTACCACTCCCAACCATTGCCCGAAAACTTGGAGTTGGTGCTACAGGCCA  6565

Query  660   TTGAGCGCGGCACTTTCGACGGTGACTTCAAGCCTTTGGTCGACTCTATCAGACACCACG  719
             | |||   ||| | ||||||||||||||||| || ||||||||||| ||||||||||| |
Sbjct  6566  TCGAGAAGGGCTCCTTCGACGGTGACTTCAAACCCTTGGTCGACTCCATCAGACACCAGG  6625

Query  720   GTGACTATTACTTAGTCAGTGACGATTTCCAATCCTACTTGCAAATGCAATCGATGGTCG  779
             | ||||| ||| | ||||| || || ||| | |||||| | |||| |||  |  || |||
Sbjct  6626  GCGACTACTACCTCGTCAGCGATGACTTCGAGTCCTACCTACAAACGCAGACCTTGATCG  6685

Query  780   ATGACGTCTACCACAACAACAAGAAGGAGTGGCTAAAGAAGTCCATTTTGAGTGTTGCCA  839
             | ||||||||||||||| | |||||||||||| | || || ||| || |||| || || |
Sbjct  6686  ACGACGTCTACCACAACGATAAGAAGGAGTGGATCAAAAAATCCGTTCTGAGCGTCGCAA  6745

Query  840   ACGTTGGTTTCTTCTCCAGTGACCGTTGTATC  871
             |||| ||||||||||||||||||||||| |||
Sbjct  6746  ACGTCGGTTTCTTCTCCAGTGACCGTTGCATC  6777


> AEAV01000470  Kluyveromyces wickerhamii UCD 54-210 contig00887, 
whole genome shotgun sequence
Length=10525

 Score = 33.7 bits (36),  Expect = 0.58
 Identities = 24/28 (86%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  571   CTTGGCCGAGAACGTTGACGAGTTGAGA  598
             |||||||||||||| |||| || | |||
Sbjct  7742  CTTGGCCGAGAACGGTGACAAGGTCAGA  7715


> AEAV01000326  Kluyveromyces wickerhamii UCD 54-210 contig00337, 
whole genome shotgun sequence
Length=10552

 Score = 33.7 bits (36),  Expect = 0.58
 Identities = 27/33 (82%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  338   ATCGGGAACATCTTCAAGGTCGTGTTCATTCCA  370
             ||| |||||||||||   ||||| ||| |||||
Sbjct  6231  ATCAGGAACATCTTCCCAGTCGTTTTCCTTCCA  6199


> AEAV01000102  Kluyveromyces wickerhamii UCD 54-210 contig00106, 
whole genome shotgun sequence
Length=54017

 Score = 33.7 bits (36),  Expect = 0.58
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  609    AGTACCACGCCAAGCCATTGC  629
              ||| |||||||||||||||||
Sbjct  27773  AGTGCCACGCCAAGCCATTGC  27793


> AEAV01000057  Kluyveromyces wickerhamii UCD 54-210 contig00060, 
whole genome shotgun sequence
Length=85437

 Score = 33.7 bits (36),  Expect = 0.58
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  46     CGACGGCGAAGACATCATCGA  66
              ||||||| |||||||||||||
Sbjct  13855  CGACGGCAAAGACATCATCGA  13875


> AEAV01000216  Kluyveromyces wickerhamii UCD 54-210 contig00227, 
whole genome shotgun sequence
Length=67392

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  206    GCCGAAGTGGAAAAGAAGTACC  227
              || |||||||||||| ||||||
Sbjct  43736  GCGGAAGTGGAAAAGTAGTACC  43715


> AEAV01000208  Kluyveromyces wickerhamii UCD 54-210 contig00216, 
whole genome shotgun sequence
Length=6471

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  319   GGTGAACCACGACAAGGAGATC  340
             ||||| |||||||||||| |||
Sbjct  4169  GGTGAGCCACGACAAGGACATC  4190


> AEAV01000198  Kluyveromyces wickerhamii UCD 54-210 contig00206, 
whole genome shotgun sequence
Length=98453

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  23     GCCGATTTGATCAAGAAGTT  42
              || |||||||||||||||||
Sbjct  36705  GCTGATTTGATCAAGAAGTT  36724


> AEAV01000128  Kluyveromyces wickerhamii UCD 54-210 contig00134, 
whole genome shotgun sequence
Length=17394

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  7      CAACAAGCAAAAGCTTG  23
              |||||||||||||||||
Sbjct  10259  CAACAAGCAAAAGCTTG  10243


> AEAV01000064  Kluyveromyces wickerhamii UCD 54-210 contig00067, 
whole genome shotgun sequence
Length=16799

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  73    CCACATCAGAAACACCTTGTTC  94
             ||| |||||||||||||| |||
Sbjct  9145  CCAAATCAGAAACACCTTTTTC  9124


> AEAV01000002  Kluyveromyces wickerhamii UCD 54-210 contig00002, 
whole genome shotgun sequence
Length=27796

 Score = 31.9 bits (34),  Expect = 2.0
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  393    AAATCATCATTCCTGCCAGT  412
              |||||||||||| |||||||
Sbjct  21979  AAATCATCATTCATGCCAGT  21960


> AEAV01000411  Kluyveromyces wickerhamii UCD 54-210 contig00811, 
whole genome shotgun sequence
Length=52665

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  551  AACATCTTCTTGTTTG  566
            ||||||||||||||||
Sbjct  677  AACATCTTCTTGTTTG  662


> AEAV01000231  Kluyveromyces wickerhamii UCD 54-210 contig00242, 
whole genome shotgun sequence
Length=17358

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  204    TTGCCGAAGTGGAAAAGAAGT  224
              |||| ||| ||||||||||||
Sbjct  10657  TTGCAGAATTGGAAAAGAAGT  10677


> AEAV01000196  Kluyveromyces wickerhamii UCD 54-210 contig00204, 
whole genome shotgun sequence
Length=91113

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  50    GGCGAAGACATCATCGAAAGA  70
             ||||||||||| | |||||||
Sbjct  1044  GGCGAAGACATGACCGAAAGA  1024


 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  53     GAAGACATCATCGAAAGAGAC  73
              ||||||||||| |||||| ||
Sbjct  90143  GAAGACATCATAGAAAGAAAC  90163


> AEAV01000176  Kluyveromyces wickerhamii UCD 54-210 contig00183, 
whole genome shotgun sequence
Length=36167

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  386    AAGGCAGAAATCATCATTC  404
              ||| |||||||||||||||
Sbjct  30130  AAGTCAGAAATCATCATTC  30112


> AEAV01000119  Kluyveromyces wickerhamii UCD 54-210 contig00125, 
whole genome shotgun sequence
Length=23374

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  173    ATCAAGGAGTTGTTGGCTG  191
              |||||||||||||||| ||
Sbjct  17322  ATCAAGGAGTTGTTGGATG  17304


> AEAV01000051  Kluyveromyces wickerhamii UCD 54-210 contig00054, 
whole genome shotgun sequence
Length=71584

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  60     TCATCGAAAGAGACCACAT  78
              ||||| |||||||||||||
Sbjct  46087  TCATCAAAAGAGACCACAT  46105


> AEAV01000038  Kluyveromyces wickerhamii UCD 54-210 contig00041, 
whole genome shotgun sequence
Length=63282

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  83    AACACCTTGTTCGACATCC  101
             |||||| ||||||||||||
Sbjct  7352  AACACCCTGTTCGACATCC  7334


> AEAV01000016  Kluyveromyces wickerhamii UCD 54-210 contig00017, 
whole genome shotgun sequence
Length=93660

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 18/19 (95%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  29     TTGATCAAGAAGTTGTACG  47
              ||| |||||||||||||||
Sbjct  64411  TTGGTCAAGAAGTTGTACG  64429


> AEAV01000015  Kluyveromyces wickerhamii UCD 54-210 contig00016, 
whole genome shotgun sequence
Length=31310

 Score = 30.1 bits (32),  Expect = 7.0
 Identities = 19/21 (91%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  830    AGTGTTGCCAACGTTGGTTTC  850
              |||||||||||  ||||||||
Sbjct  20433  AGTGTTGCCAATCTTGGTTTC  20413



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 8325311400


  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GCAGCACAACAAGCAAAAGCTTGCCGATTTGATCAAGAAGTTGTACGACGGCGAAGACATCATCGAAAGAGACCACATCAGAAACACCTTGTTCGACATCCAAGTGAAGCGTATTCACGAGTACAAGCGTCAACAGTTGAACATCTTTGGGTGCATCTACAGATACTTGCGGATCAAGGAGTTGTTGGCTGAAGGTGTCCCAATTGCCGAAGTGGAAAAGAAGTACCCAAGAAAGGTGTCCATCTTTGGTGGTAAGAGTGCTCCAGGTTACTACATGGCCAAGACGATTATCAAGTTGATCAACAGTGTCAGCGACGTGGTGAACCACGACAAGGAGATCGGGAACATCTTCAAGGTCGTGTTCATTCCAGACTACAACGTCTCCAAGGCAGAAATCATCATTCCTGCCAGTGACTTGAGTGAGCACATCTCTACCGCCGGTACCGAGGCCTCTGGTACATCCAACATGAAGTTTGTCATGAACGGTGGGTTGATCATTGGTACCGTGGACGGTGCCAACGTCGAGATCACCAGAGAAATTGGAGAGGACAACATCTTCTTGTTTGGTAACTTGGCCGAGAACGTTGACGAGTTGAGATACCAACACCAGTACCACGCCAAGCCATTGCCAAAGGAGTTGGAGGAAGTGTTGCAACTGATTGAGCGCGGCACTTTCGACGGTGACTTCAAGCCTTTGGTCGACTCTATCAGACACCACGGTGACTATTACTTAGTCAGTGACGATTTCCAATCCTACTTGCAAATGCAATCGATGGTCGATGACGTCTACCACAACAACAAGAAGGAGTGGCTAAAGAAGTCCATTTTGAGTGTTGCCAACGTTGGTTTCTTCTCCAGTGACCGTTGTATCCAGGA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)