blastn task: Est2

Status
finished finished
Modified 2014-05-17T19:36:13Z
CPU time (s) 0.1
Size (bytes) 35738
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db Kluyveromyces_lactis_Y-1140.fna -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces lactis NRRL Y-1140
           7 sequences; 10,729,447 total letters



Query= query

Length=3172
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 c...  5721    0.0  
  gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 c...  44.6    0.001
  gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 c...  42.8    0.005
  gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 c...  39.2    0.055
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  39.2    0.055
  gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 c...  37.4    0.19 


> gi|50313008|ref|NC_006039.1| Kluyveromyces lactis NRRL Y-1140 
chromosome C, complete genome
Length=1753957

 Score = 5721 bits (6344),  Expect = 0.0
 Identities = 3172/3172 (100%), Gaps = 0/3172 (0%)
 Strand=Plus/Plus

Query  1        GTGGAAGCCATTAAAAAGGCAGAAAAACTAAGAAACAGAGAGAAAGAGTACAAGGAAAAT  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1624646  GTGGAAGCCATTAAAAAGGCAGAAAAACTAAGAAACAGAGAGAAAGAGTACAAGGAAAAT  1624705

Query  61       GAAGCCTTTGAAGATGAGTTGGGCAATTTCGTTGAGAAAGGTAACTTCAAAAAGGCCGGT  120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1624706  GAAGCCTTTGAAGATGAGTTGGGCAATTTCGTTGAGAAAGGTAACTTCAAAAAGGCCGGT  1624765

Query  121      GGCATTGAGGAGATAGAACGCCTAAGAAAACAAAAAGACGAAGAAAATCTGCGTGTTAAT  180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1624766  GGCATTGAGGAGATAGAACGCCTAAGAAAACAAAAAGACGAAGAAAATCTGCGTGTTAAT  1624825

Query  181      TTTGGTCTGATATAGGTACAATAATTTTAAGTAATAGCATTAAAACTCTATTAATAGTTT  240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1624826  TTTGGTCTGATATAGGTACAATAATTTTAAGTAATAGCATTAAAACTCTATTAATAGTTT  1624885

Query  241      CAAATCGCTGACATTTGTCAAAATGTCTGCAAATGCGTTCTTCCTTAATTTTAATTGTTC  300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1624886  CAAATCGCTGACATTTGTCAAAATGTCTGCAAATGCGTTCTTCCTTAATTTTAATTGTTC  1624945

Query  301      AAGGAAAACTGACAACACCAGTTCTTTTGACGCGACGGACTTTTCCATCGAGAACATATT  360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1624946  AAGGAAAACTGACAACACCAGTTCTTTTGACGCGACGGACTTTTCCATCGAGAACATATT  1625005

Query  361      AGCTGAAGAGAGGTTAAGATCAATTCGCTGAAAAATGTTGAAAACAAATTGTTTGAAAGA  420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625006  AGCTGAAGAGAGGTTAAGATCAATTCGCTGAAAAATGTTGAAAACAAATTGTTTGAAAGA  1625065

Query  421      TCTTCTGCTGCTTTTCTTCCTATTAAAAAGGACAATGAACGATTGAATTACATTTAACGC  480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625066  TCTTCTGCTGCTTTTCTTCCTATTAAAAAGGACAATGAACGATTGAATTACATTTAACGC  1625125

Query  481      AACTTCTCTCAGGAACCTTGCAGCCGTTTCCCAAGAATTTAAGCGCTCGTCCAGCATATT  540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625126  AACTTCTCTCAGGAACCTTGCAGCCGTTTCCCAAGAATTTAAGCGCTCGTCCAGCATATT  1625185

Query  541      ATAAGATAGTCTCATCTCAAAGATCCAGAGTAATTTATTATACAGTTGCTTAGATGATCC  600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625186  ATAAGATAGTCTCATCTCAAAGATCCAGAGTAATTTATTATACAGTTGCTTAGATGATCC  1625245

Query  601      CAAAACTGTTCCTAGGACATTATACGATGAGCGGTCTTTCCAAACTTCTAGGGTTCTTAG  660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625246  CAAAACTGTTCCTAGGACATTATACGATGAGCGGTCTTTCCAAACTTCTAGGGTTCTTAG  1625305

Query  661      ATTTAACTGCAGTGCACAAAAAGGTACATTTGTTGATGTTTCAGATTCTGATGAAGTAAC  720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625306  ATTTAACTGCAGTGCACAAAAAGGTACATTTGTTGATGTTTCAGATTCTGATGAAGTAAC  1625365

Query  721      CAAGACTTTTTGTGGGTTTATATAAGTATTGAAAGATTTGAATCCTGTTTGAGCCAGATT  780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625366  CAAGACTTTTTGTGGGTTTATATAAGTATTGAAAGATTTGAATCCTGTTTGAGCCAGATT  1625425

Query  781      ATTAAGCCGCTCGATGTATTTCTTGGAAGTTGAAACTATTAGAAAATCATCCACCAGCCG  840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625426  ATTAAGCCGCTCGATGTATTTCTTGGAAGTTGAAACTATTAGAAAATCATCCACCAGCCG  1625485

Query  841      TATTATCATCGGATCTGAATCATTTTCATCAGTAAACTCGGTGTAGAATTCAAGTAGGTC  900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625486  TATTATCATCGGATCTGAATCATTTTCATCAGTAAACTCGGTGTAGAATTCAAGTAGGTC  1625545

Query  901      GTCATACAATATATCAACAAGAACGGAAGATAAGGGAGTTCCTTGAAAGAGTCCATCTTT  960
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625546  GTCATACAATATATCAACAAGAACGGAAGATAAGGGAGTTCCTTGAAAGAGTCCATCTTT  1625605

Query  961      TCTTAAGTAACACTTGCCTCTGTAAAAGATACTGGTTTTGAAGAGTTCCATTTTAACTAC  1020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625606  TCTTAAGTAACACTTGCCTCTGTAAAAGATACTGGTTTTGAAGAGTTCCATTTTAACTAC  1625665

Query  1021     TGTTAAAACGTCTTCTTTTGATAAGACAGTAGTTTTGACTGAATCAATTACTAAATCATT  1080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625666  TGTTAAAACGTCTTCTTTTGATAAGACAGTAGTTTTGACTGAATCAATTACTAAATCATT  1625725

Query  1081     TTCCTGGAATTGTATGTCTCCATTTACAGCATGAAGCCTTTTCAGACGAGTGGAAGCAGT  1140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625726  TTCCTGGAATTGTATGTCTCCATTTACAGCATGAAGCCTTTTCAGACGAGTGGAAGCAGT  1625785

Query  1141     TGTCAGTATATCTTGAGATCTAATAAAAAACTGCTGCTCTTCACATATCCGAGCCTCTAC  1200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625786  TGTCAGTATATCTTGAGATCTAATAAAAAACTGCTGCTCTTCACATATCCGAGCCTCTAC  1625845

Query  1201     CAATTTCATTACTTTCTGAACCGGAATTGAATCATAGCAGGATTGAATGTCAAACTTTAA  1260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625846  CAATTTCATTACTTTCTGAACCGGAATTGAATCATAGCAGGATTGAATGTCAAACTTTAA  1625905

Query  1261     AAGATAGAGATTCGGTATTTTACCATGTTTTAAAAGTAGCCTTTGCTTATAACTTAATAC  1320
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625906  AAGATAGAGATTCGGTATTTTACCATGTTTTAAAAGTAGCCTTTGCTTATAACTTAATAC  1625965

Query  1321     AATCTTGGGTATTTCCAAAGGAGAGAATGCTTTTGTAAACTTGGTATTTCGTCTCATCCT  1380
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625966  AATCTTGGGTATTTCCAAAGGAGAGAATGCTTTTGTAAACTTGGTATTTCGTCTCATCCT  1626025

Query  1381     CAATCTTTCCAGTATAATCTTGGTGGGCTTCAGAGCGTTCGTAACGTAATCATTAAACTC  1440
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626026  CAATCTTTCCAGTATAATCTTGGTGGGCTTCAGAGCGTTCGTAACGTAATCATTAAACTC  1626085

Query  1441     GTTAAACTCTTGTATATTGACTCCTTTACACGGCACCGCTATTATTCTGAAATCGAGGCC  1500
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626086  GTTAAACTCTTGTATATTGACTCCTTTACACGGCACCGCTATTATTCTGAAATCGAGGCC  1626145

Query  1501     TGATTTTTTTGGTATTAAACGAAGATTTCTGTGATTGAACTTGGATTCTGTGAAAGATCT  1560
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626146  TGATTTTTTTGGTATTAAACGAAGATTTCTGTGATTGAACTTGGATTCTGTGAAAGATCT  1626205

Query  1561     GTGCTGGAAACAATATTTATTCTCAAGCAAATACCTCCTAAAGTAAGATTTCAAAAAAGG  1620
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626206  GTGCTGGAAACAATATTTATTCTCAAGCAAATACCTCCTAAAGTAAGATTTCAAAAAAGG  1626265

Query  1621     TTGTGACATGGTTTTCCAAGTATCATGACGAATATAAACTATATCGACAGTCGACGATAG  1680
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626266  TTGTGACATGGTTTTCCAAGTATCATGACGAATATAAACTATATCGACAGTCGACGATAG  1626325

Query  1681     TTCTGTCACATAGAAAAATGTAGATAGTAATTTTGGGACGTAACAGGAAAGGATCCAAAA  1740
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626326  TTCTGTCACATAGAAAAATGTAGATAGTAATTTTGGGACGTAACAGGAAAGGATCCAAAA  1626385

Query  1741     AAACAGTTTATAAAGAAGCGCTTGTCGATTTTTCACATCATAATATGGAATCTTTTGAGT  1800
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626386  AAACAGTTTATAAAGAAGCGCTTGTCGATTTTTCACATCATAATATGGAATCTTTTGAGT  1626445

Query  1801     TTGTTCACCAGCTGGAAGCCGCCTTGTTTCTAGCCATTTGACATCTTTCACACGCAATCC  1860
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626446  TTGTTCACCAGCTGGAAGCCGCCTTGTTTCTAGCCATTTGACATCTTTCACACGCAATCC  1626505

Query  1861     TTTACATAATTCATCAAATAGTATCTTTGAATGGAGCGGTTTTTTGACAAGTATTGCAAT  1920
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626506  TTTACATAATTCATCAAATAGTATCTTTGAATGGAGCGGTTTTTTGACAAGTATTGCAAT  1626565

Query  1921     CGCTTTTGATAGAACGCTATAGTTTGAATTTGATCCTAACAGGTCCAATGGGAACGTTTT  1980
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626566  CGCTTTTGATAGAACGCTATAGTTTGAATTTGATCCTAACAGGTCCAATGGGAACGTTTT  1626625

Query  1981     TCTAACACATACAATGAGCAGTTTGATGACACTTTTGGGTGATGAATAGAAAGTATCTGA  2040
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626626  TCTAACACATACAATGAGCAGTTTGATGACACTTTTGGGTGATGAATAGAAAGTATCTGA  1626685

Query  2041     TTTGGGGCATATATTATTGATGATGTGTCTATATGAAAACCTCTCGTGAGCTCGAATGAG  2100
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626686  TTTGGGGCATATATTATTGATGATGTGTCTATATGAAAACCTCTCGTGAGCTCGAATGAG  1626745

Query  2101     CTCATATAAAATGGGTTTTAGATTATTCAATGCAAAGTTTAGAGAACGAGGTGTCTTACT  2160
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626746  CTCATATAAAATGGGTTTTAGATTATTCAATGCAAAGTTTAGAGAACGAGGTGTCTTACT  1626805

Query  2161     GCTCTCTGATATTTTCGGAAAAATCTCAGCTATTAACAGCCCCTGATCAGTCTCAATGAT  2220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626806  GCTCTCTGATATTTTCGGAAAAATCTCAGCTATTAACAGCCCCTGATCAGTCTCAATGAT  1626865

Query  2221     ATTCTTGTAATCTTGCGGTCTTATCTTATGATATAGAGCAGAGTTCCAATCTATCGTTAG  2280
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626866  ATTCTTGTAATCTTGCGGTCTTATCTTATGATATAGAGCAGAGTTCCAATCTATCGTTAG  1626925

Query  2281     CTTAGTATTTCTTTCCCTCCTATACGACCGATCTAGCCATGCAGGTGGCACCTGAGGCGC  2340
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626926  CTTAGTATTTCTTTCCCTCCTATACGACCGATCTAGCCATGCAGGTGGCACCTGAGGCGC  1626985

Query  2341     GTTAGCGGGGGTTCCAATTATCTGCCTGAAGTAATGGCCGGTGTTGAAATATACGGAATA  2400
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626986  GTTAGCGGGGGTTCCAATTATCTGCCTGAAGTAATGGCCGGTGTTGAAATATACGGAATA  1627045

Query  2401     GTTGATTAACAAATTCACAAAATTGTCAGTGCCAACCAGCTGATGGAACAATCTCCAGCT  2460
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627046  GTTGATTAACAAATTCACAAAATTGTCAGTGCCAACCAGCTGATGGAACAATCTCCAGCT  1627105

Query  2461     ATTACATTTCAATACACTTACGCTTATGTTCGATGAACGGCAAAACAGTTTGGTCATGAC  2520
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627106  ATTACATTTCAATACACTTACGCTTATGTTCGATGAACGGCAAAACAGTTTGGTCATGAC  1627165

Query  2521     ATCTGAATTCTTTCCCAGCTGGTAACCATAAGTCAGTATATTATTCGTAAAATTCTTGTG  2580
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627166  ATCTGAATTCTTTCCCAGCTGGTAACCATAAGTCAGTATATTATTCGTAAAATTCTTGTG  1627225

Query  2581     CAAAAGGTAGAGAATGCATGTTTCTATAGTTTCACAGTGATACGATGAGCTGAAAGTAGA  2640
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627226  CAAAAGGTAGAGAATGCATGTTTCTATAGTTTCACAGTGATACGATGAGCTGAAAGTAGA  1627285

Query  2641     AGATATTTCAATTTCAGGAGGTACGCAATGTTTGCTGTTAACTTGTGCGAAACAGCTGAG  2700
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627286  AGATATTTCAATTTCAGGAGGTACGCAATGTTTGCTGTTAACTTGTGCGAAACAGCTGAG  1627345

Query  2701     TAACAGATTGGATACCCCATTAGAGTCAGCATTGATCAGAATATCCGATTTTCTGAGGGT  2760
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627346  TAACAGATTGGATACCCCATTAGAGTCAGCATTGATCAGAATATCCGATTTTCTGAGGGT  1627405

Query  2761     TTCATAGCACTCTAAAGATTCCAAATATTCGACAAGAATTTTCATCTAAACCAATTGATA  2820
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627406  TTCATAGCACTCTAAAGATTCCAAATATTCGACAAGAATTTTCATCTAAACCAATTGATA  1627465

Query  2821     TAGGTCATTATTCGAAGTCACCTTAGTCATCTCGATGATCAATTTAAGGTTCTTATTAAT  2880
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627466  TAGGTCATTATTCGAAGTCACCTTAGTCATCTCGATGATCAATTTAAGGTTCTTATTAAT  1627525

Query  2881     TATTCTCAGTGTTCATCTTTCTTACGAGCATGATCTAAACTGGTAAATAGTGTTTCGTAG  2940
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627526  TATTCTCAGTGTTCATCTTTCTTACGAGCATGATCTAAACTGGTAAATAGTGTTTCGTAG  1627585

Query  2941     CCTATAATTTCTGGATATGAATTTTTCAATGATAGAAATGTAAGATGCGATGCGATGAGA  3000
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627586  CCTATAATTTCTGGATATGAATTTTTCAATGATAGAAATGTAAGATGCGATGCGATGAGA  1627645

Query  3001     TGATATACTAATATGTAAAGGGTAAAGGAAATGGATGCTTAATTATAGCTCTAGATTTAC  3060
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627646  TGATATACTAATATGTAAAGGGTAAAGGAAATGGATGCTTAATTATAGCTCTAGATTTAC  1627705

Query  3061     TAGTTATTCACATGAAAAGCTAACAGTATGGTTAAGAAACATCTGAACCCCACTAAGATC  3120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627706  TAGTTATTCACATGAAAAGCTAACAGTATGGTTAAGAAACATCTGAACCCCACTAAGATC  1627765

Query  3121     GATTTTATAAAATGCATCGTCGAAGATTGCCTCTGGCAAATTCGAGATACCA  3172
                ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1627766  GATTTTATAAAATGCATCGTCGAAGATTGCCTCTGGCAAATTCGAGATACCA  1627817


 Score = 37.4 bits (40),  Expect = 0.19
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  2983   AGATGCGATGCGATGAGATGATA  3005
              ||||| |||||||||||||||||
Sbjct  68849  AGATGTGATGCGATGAGATGATA  68827


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  2983     AGATGCGATGCGATGAGATGATAT  3006
                ||||| ||||||||||||||| ||
Sbjct  1028805  AGATGAGATGCGATGAGATGAGAT  1028782


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  2984     GATGCGATGCGATGAGATG  3002
                |||||||||||||||||||
Sbjct  1363808  GATGCGATGCGATGAGATG  1363790


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  2983    AGATGCGATGCGATGAGATGA  3003
               ||||| |||||||||||||||
Sbjct  580191  AGATGAGATGCGATGAGATGA  580171


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  1514    ATTAAACGAAGATTTCTGTGATTGAA  1539
               ||||||| | | ||||||||||||||
Sbjct  686442  ATTAAACTAGGTTTTCTGTGATTGAA  686467


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  428     CTGCTTTTCTTCCTATTAAAA  448
               |||||||||||| ||||||||
Sbjct  838199  CTGCTTTTCTTCTTATTAAAA  838179


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  2983     AGATGCGATGCGATGAGATGA  3003
                ||||||||||||||||| |||
Sbjct  1280204  AGATGCGATGCGATGAGCTGA  1280224


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  177      TAATTTTGGTCTGATATA  194
                ||||||||||||||||||
Sbjct  1734827  TAATTTTGGTCTGATATA  1734810


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  391     AAAAATGTTGAAAACAAATTGT  412
               |||| |||| ||||||||||||
Sbjct  322448  AAAAGTGTTAAAAACAAATTGT  322469


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 26/32 (82%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  1500    CTGATTTTTTTGGTATTAAACGAAGATTTCTG  1531
               |||||||||||| |||| || ||| | | |||
Sbjct  725218  CTGATTTTTTTGATATTGAAAGAATAATGCTG  725249


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  2955    ATATGAATTTTTCAATGATAGAAAT  2979
               ||| ||||  |||||||||||||||
Sbjct  895966  ATACGAATCCTTCAATGATAGAAAT  895990


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  2982     AAGATGCGATGCGATGAGATGATAT  3006
                ||||||||||| ||||| |||| ||
Sbjct  1007702  AAGATGCGATGAGATGAAATGAGAT  1007678


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  2983     AGATGCGATGCGATGAGATGATATACT  3009
                ||||| | ||||||||||||| || ||
Sbjct  1093679  AGATGAGCTGCGATGAGATGAGATCCT  1093653


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  2982     AAGATGCGATGCGATGAGAT  3001
                ||||||||||| ||||||||
Sbjct  1276200  AAGATGCGATGAGATGAGAT  1276219


> gi|50313011|ref|NC_006042.1| Kluyveromyces lactis NRRL Y-1140 
chromosome F, complete genome
Length=2602197

 Score = 44.6 bits (48),  Expect = 0.001
 Identities = 37/44 (85%), Gaps = 1/44 (2%)
 Strand=Plus/Minus

Query  2964    TTTCAATGATAGAAA-TGTAAGATGCGATGCGATGAGATGATAT  3006
               ||| ||| | ||||  ||||||||| ||||||||||||||| ||
Sbjct  129771  TTTGAATAAAAGAACCTGTAAGATGAGATGCGATGAGATGAGAT  129728


 Score = 39.2 bits (42),  Expect = 0.055
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  2983     AGATGCGATGCGATGAGATGA  3003
                |||||||||||||||||||||
Sbjct  1057229  AGATGCGATGCGATGAGATGA  1057209


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  2983    AGATGCGATGCGATGAGATGATAT  3006
               ||||||||||||||| ||||| ||
Sbjct  318884  AGATGCGATGCGATGTGATGAGAT  318861


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 41/56 (74%), Gaps = 6/56 (10%)
 Strand=Plus/Minus

Query  2957     ATGAATTTTTCAATGATAGAAATG------TAAGATGCGATGCGATGAGATGATAT  3006
                |||||  ||| | | | |||||||      |||||||||||| |||| ||||| ||
Sbjct  1510581  ATGAAAATTTTATTAAAAGAAATGAAGCCTTAAGATGCGATGAGATGCGATGAGAT  1510526


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  2770    CTCTAAAGATTCCAAATATTCGA  2792
               ||||||||||| |||||| ||||
Sbjct  842836  CTCTAAAGATTTCAAATAATCGA  842814


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  2984     GATGCGATGCGATGAGATGATAT  3006
                |||| ||||||||||||||| ||
Sbjct  1510543  GATGAGATGCGATGAGATGAGAT  1510521


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  2984    GATGCGATGCGATGAGATGA  3003
               ||||||||||| ||||||||
Sbjct  183675  GATGCGATGCGGTGAGATGA  183656


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  20       CAGAAAAACTAAGAAACAGA  39
                |||||| |||||||||||||
Sbjct  1304793  CAGAAACACTAAGAAACAGA  1304812


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  29       TAAGAAACAGAGAGAAA  45
                |||||||||||||||||
Sbjct  1509896  TAAGAAACAGAGAGAAA  1509880


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  2988     CGATGCGATGAGATGAT  3004
                |||||||||||||||||
Sbjct  1577061  CGATGCGATGAGATGAT  1577077


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  1836     ATTTGACATCTTTCACA  1852
                |||||||||||||||||
Sbjct  2230134  ATTTGACATCTTTCACA  2230150


> gi|50313006|ref|NC_006037.1| Kluyveromyces lactis NRRL Y-1140 
chromosome A, complete genome
Length=1062590

 Score = 42.8 bits (46),  Expect = 0.005
 Identities = 34/40 (85%), Gaps = 1/40 (2%)
 Strand=Plus/Plus

Query  2646   TTTCAATTTCAGGAGGTACGCAATGTTTGCTGTTAACTTG  2685
              ||||||||||   || ||||||| |||||||||||| |||
Sbjct  33537  TTTCAATTTCTT-AGTTACGCAAGGTTTGCTGTTAAATTG  33575


 Score = 37.4 bits (40),  Expect = 0.19
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  2984    GATGCGATGCGATGAGATGATAT  3006
               |||||||||||||||||||| ||
Sbjct  361032  GATGCGATGCGATGAGATGAGAT  361010


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  2847    TCATCTCGATGATCAATTTAAG  2868
               ||||||| ||||||||||||||
Sbjct  563697  TCATCTCAATGATCAATTTAAG  563718


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2981    TAAGATGCGATGCGATGAGATG  3002
               ||||||| ||||||||||||||
Sbjct  928363  TAAGATGAGATGCGATGAGATG  928342


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  2582    AAAAGGTAGAGAATGCATGT  2601
               ||||||| ||||||||||||
Sbjct  267052  AAAAGGTTGAGAATGCATGT  267071


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Minus

Query  2445    GGAACAATCTCCAGCTA  2461
               |||||||||||||||||
Sbjct  424296  GGAACAATCTCCAGCTA  424280


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2986    TGCGATGCGATGAGATGATATA  3007
               || ||||||||||||||| |||
Sbjct  568256  TGAGATGCGATGAGATGAGATA  568235


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  1972    GAACGTTTTTCTAACACATA  1991
               |||||||| |||||||||||
Sbjct  714531  GAACGTTTATCTAACACATA  714512


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1720    GTAACAGGAAAGGATCCAAAAAAACAG  1746
               |||||||||||  |  |||||||||||
Sbjct  783824  GTAACAGGAAAAAAAACAAAAAAACAG  783798


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  706     TTCTGATGAAGTAACCAAGA  725
               |||||||||||| |||||||
Sbjct  787977  TTCTGATGAAGTTACCAAGA  787996


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2983    AGATGCGATGCGATGAGATGAT  3004
               ||||| |||| |||||||||||
Sbjct  848651  AGATGAGATGAGATGAGATGAT  848630


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2982    AAGATGCGATGCGATGAGATGA  3003
               ||||| | ||||||||||||||
Sbjct  848680  AAGATTCAATGCGATGAGATGA  848659


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  2983    AGATGCGATGCGATGAGATG  3002
               ||||||||||||||| ||||
Sbjct  915460  AGATGCGATGCGATGCGATG  915441


> gi|50313009|ref|NC_006040.1| Kluyveromyces lactis NRRL Y-1140 
chromosome D, complete genome
Length=1715506

 Score = 39.2 bits (42),  Expect = 0.055
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Minus

Query  2981     TAAGATGCGATGCGATGAGATGATATACTAATA  3013
                |||||||||||| |||||||  |||| ||||||
Sbjct  1547354  TAAGATGCGATGAGATGAGACAATAT-CTAATA  1547323


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  856     TGAATCATTTTCATCAGTA  874
               |||||||||||||||||||
Sbjct  114523  TGAATCATTTTCATCAGTA  114541


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  984     AAAAGATACTGGTTTTGAAGAGTTCC  1009
               ||| |||||||||||| ||| |||||
Sbjct  149219  AAAGGATACTGGTTTTCAAGTGTTCC  149244


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  2984    GATGCGATGCGATGAGATGATAT  3006
               |||| ||||||||||||||| ||
Sbjct  419279  GATGAGATGCGATGAGATGAAAT  419301


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  55      GAAAATGAAGCCTTTGAA  72
               ||||||||||||||||||
Sbjct  727471  GAAAATGAAGCCTTTGAA  727454


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  939     TTCCTTGAAAGAGTCCATCTTTTCTT  964
               ||||||||| ||  ||||||||||||
Sbjct  805679  TTCCTTGAATGAAGCCATCTTTTCTT  805704


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  1278     TTTTACCATGTTTTAAAAGTA  1298
                |||||||||||||| ||||||
Sbjct  1434698  TTTTACCATGTTTTGAAAGTA  1434718


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  2987    GCGATGCGATGAGATGA  3003
               |||||||||||||||||
Sbjct  148002  GCGATGCGATGAGATGA  148018


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 21/22 (96%), Gaps = 1/22 (4%)
 Strand=Plus/Plus

Query  1578    TATTCTCAAGCAAATACCTCCT  1599
               |||||||||||||||| |||||
Sbjct  277745  TATTCTCAAGCAAATA-CTCCT  277765


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2983     AGATGCGATGCGATGAGATGAT  3004
                ||||| |||| |||||||||||
Sbjct  1184917  AGATGAGATGAGATGAGATGAT  1184896


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  2769     ACTCTAAAGATTCCAAATATTC  2790
                ||||| |||||||||||| |||
Sbjct  1433141  ACTCTGAAGATTCCAAATCTTC  1433162


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 25/30 (84%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  1429     ATCATTAAACTCGTTAAACTCTTGTATATT  1458
                |||| | || | | ||||||||||||||||
Sbjct  1440620  ATCAATGAAGTTGGTAAACTCTTGTATATT  1440649


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  480      CAACTTCTCTCAGGAAC  496
                |||||||||||||||||
Sbjct  1486657  CAACTTCTCTCAGGAAC  1486673


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  2985     ATGCGATGCGATGAGATGATAT  3006
                ||| ||||||||||||||| ||
Sbjct  1600234  ATGAGATGCGATGAGATGAGAT  1600213


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 39.2 bits (42),  Expect = 0.055
 Identities = 26/28 (93%), Gaps = 1/28 (3%)
 Strand=Plus/Plus

Query  1021     TGTTAAAACGTCTTCTTTTG-ATAAGAC  1047
                |||||||||||||| ||||| |||||||
Sbjct  1203678  TGTTAAAACGTCTTGTTTTGAATAAGAC  1203705


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 21/23 (92%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  1532    TGATTGAACTTGGATTCTGTGAA  1554
               |||||| || |||||||||||||
Sbjct  564032  TGATTGTACATGGATTCTGTGAA  564054


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  2953   GGATATGAATTTTTCAATGATAGAA  2977
              || || || ||||||||||||||||
Sbjct  89819  GGCTACGAGTTTTTCAATGATAGAA  89843


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  497     CTTGCAGCCGTTTCCCAAGA  516
               |||||||||||| |||||||
Sbjct  385603  CTTGCAGCCGTTACCCAAGA  385622


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  838     CCGTATTATCATCGGAT  854
               |||||||||||||||||
Sbjct  674420  CCGTATTATCATCGGAT  674436


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  1276     TATTTTACCATGTTTTAAAA  1295
                |||||||| |||||||||||
Sbjct  1004430  TATTTTACTATGTTTTAAAA  1004449


> gi|50313010|ref|NC_006041.1| Kluyveromyces lactis NRRL Y-1140 
chromosome E, complete genome
Length=2234072

 Score = 37.4 bits (40),  Expect = 0.19
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  2983     AGATGCGATGCGATGAGATGATATA  3007
                ||||| |||| ||||||||||||||
Sbjct  1250250  AGATGAGATGAGATGAGATGATATA  1250226


 Score = 35.6 bits (38),  Expect = 0.67
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  11     TTAAAAAGGCAGAAAAACTAAGAA  34
              ||||||||| || |||||||||||
Sbjct  45070  TTAAAAAGGGAGGAAAACTAAGAA  45093


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  2981    TAAGATGCGATGCGATGAGATGATAT  3006
               |||||||||||| ||||| |||| ||
Sbjct  741946  TAAGATGCGATGAGATGACATGAGAT  741971


 Score = 33.7 bits (36),  Expect = 2.3
 Identities = 20/21 (96%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  2983     AGATGCGATGCGATGAGATGA  3003
                ||||||||||||||| |||||
Sbjct  1852306  AGATGCGATGCGATGCGATGA  1852286


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 22/25 (88%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  2259    CAGAGTTCCAATCTATCGTTAGCTT  2283
               |||| ||||||||||| |||| |||
Sbjct  331420  CAGATTTCCAATCTATGGTTACCTT  331444


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 19/20 (95%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  2983    AGATGCGATGCGATGAGATG  3002
               ||||| ||||||||||||||
Sbjct  414041  AGATGAGATGCGATGAGATG  414060


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 20/22 (91%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  397      GTTGAAAACAAATTGTTTGAAA  418
                ||| |||| |||||||||||||
Sbjct  1040741  GTTCAAAAGAAATTGTTTGAAA  1040762


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  1320     CAATCTTGGGTATTTCCAAAGGAGAGA  1346
                ||||||||   |||||||||||| |||
Sbjct  1072848  CAATCTTGTTGATTTCCAAAGGAAAGA  1072874


 Score = 31.9 bits (34),  Expect = 8.2
 Identities = 23/27 (86%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  2809     AACCAATTGATATAGGTCATTATTCGA  2835
                ||||||  ||  |||||||||||||||
Sbjct  1141505  AACCAAAAGAATTAGGTCATTATTCGA  1141479



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 33743516410


  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
GTGGAAGCCATTAAAAAGGCAGAAAAACTAAGAAACAGAGAGAAAGAGTACAAGGAAAATGAAGCCTTTGAAGATGAGTTGGGCAATTTCGTTGAGAAAGGTAACTTCAAAAAGGCCGGTGGCATTGAGGAGATAGAACGCCTAAGAAAACAAAAAGACGAAGAAAATCTGCGTGTTAATTTTGGTCTGATATAGGTACAATAATTTTAAGTAATAGCATTAAAACTCTATTAATAGTTTCAAATCGCTGACATTTGTCAAAATGTCTGCAAATGCGTTCTTCCTTAATTTTAATTGTTCAAGGAAAACTGACAACACCAGTTCTTTTGACGCGACGGACTTTTCCATCGAGAACATATTAGCTGAAGAGAGGTTAAGATCAATTCGCTGAAAAATGTTGAAAACAAATTGTTTGAAAGATCTTCTGCTGCTTTTCTTCCTATTAAAAAGGACAATGAACGATTGAATTACATTTAACGCAACTTCTCTCAGGAACCTTGCAGCCGTTTCCCAAGAATTTAAGCGCTCGTCCAGCATATTATAAGATAGTCTCATCTCAAAGATCCAGAGTAATTTATTATACAGTTGCTTAGATGATCCCAAAACTGTTCCTAGGACATTATACGATGAGCGGTCTTTCCAAACTTCTAGGGTTCTTAGATTTAACTGCAGTGCACAAAAAGGTACATTTGTTGATGTTTCAGATTCTGATGAAGTAACCAAGACTTTTTGTGGGTTTATATAAGTATTGAAAGATTTGAATCCTGTTTGAGCCAGATTATTAAGCCGCTCGATGTATTTCTTGGAAGTTGAAACTATTAGAAAATCATCCACCAGCCGTATTATCATCGGATCTGAATCATTTTCATCAGTAAACTCGGTGTAGAATTCAAGTAGGTCGTCATACAATATATCAACAAGAACGGAAGATAAGGGAGTTCCTTGAAAGAGTCCATCTTTTCTTAAGTAACACTTGCCTCTGTAAAAGATACTGGTTTTGAAGAGTTCCATTTTAACTACTGTTAAAACGTCTTCTTTTGATAAGACAGTAGTTTTGACTGAATCAATTACTAAATCATTTTCCTGGAATTGTATGTCTCCATTTACAGCATGAAGCCTTTTCAGACGAGTGGAAGCAGTTGTCAGTATATCTTGAGATCTAATAAAAAACTGCTGCTCTTCACATATCCGAGCCTCTACCAATTTCATTACTTTCTGAACCGGAATTGAATCATAGCAGGATTGAATGTCAAACTTTAAAAGATAGAGATTCGGTATTTTACCATGTTTTAAAAGTAGCCTTTGCTTATAACTTAATACAATCTTGGGTATTTCCAAAGGAGAGAATGCTTTTGTAAACTTGGTATTTCGTCTCATCCTCAATCTTTCCAGTATAATCTTGGTGGGCTTCAGAGCGTTCGTAACGTAATCATTAAACTCGTTAAACTCTTGTATATTGACTCCTTTACACGGCACCGCTATTATTCTGAAATCGAGGCCTGATTTTTTTGGTATTAAACGAAGATTTCTGTGATTGAACTTGGATTCTGTGAAAGATCTGTGCTGGAAACAATATTTATTCTCAAGCAAATACCTCCTAAAGTAAGATTTCAAAAAAGGTTGTGACATGGTTTTCCAAGTATCATGACGAATATAAACTATATCGACAGTCGACGATAGTTCTGTCACATAGAAAAATGTAGATAGTAATTTTGGGACGTAACAGGAAAGGATCCAAAAAAACAGTTTATAAAGAAGCGCTTGTCGATTTTTCACATCATAATATGGAATCTTTTGAGTTTGTTCACCAGCTGGAAGCCGCCTTGTTTCTAGCCATTTGACATCTTTCACACGCAATCCTTTACATAATTCATCAAATAGTATCTTTGAATGGAGCGGTTTTTTGACAAGTATTGCAATCGCTTTTGATAGAACGCTATAGTTTGAATTTGATCCTAACAGGTCCAATGGGAACGTTTTTCTAACACATACAATGAGCAGTTTGATGACACTTTTGGGTGATGAATAGAAAGTATCTGATTTGGGGCATATATTATTGATGATGTGTCTATATGAAAACCTCTCGTGAGCTCGAATGAGCTCATATAAAATGGGTTTTAGATTATTCAATGCAAAGTTTAGAGAACGAGGTGTCTTACTGCTCTCTGATATTTTCGGAAAAATCTCAGCTATTAACAGCCCCTGATCAGTCTCAATGATATTCTTGTAATCTTGCGGTCTTATCTTATGATATAGAGCAGAGTTCCAATCTATCGTTAGCTTAGTATTTCTTTCCCTCCTATACGACCGATCTAGCCATGCAGGTGGCACCTGAGGCGCGTTAGCGGGGGTTCCAATTATCTGCCTGAAGTAATGGCCGGTGTTGAAATATACGGAATAGTTGATTAACAAATTCACAAAATTGTCAGTGCCAACCAGCTGATGGAACAATCTCCAGCTATTACATTTCAATACACTTACGCTTATGTTCGATGAACGGCAAAACAGTTTGGTCATGACATCTGAATTCTTTCCCAGCTGGTAACCATAAGTCAGTATATTATTCGTAAAATTCTTGTGCAAAAGGTAGAGAATGCATGTTTCTATAGTTTCACAGTGATACGATGAGCTGAAAGTAGAAGATATTTCAATTTCAGGAGGTACGCAATGTTTGCTGTTAACTTGTGCGAAACAGCTGAGTAACAGATTGGATACCCCATTAGAGTCAGCATTGATCAGAATATCCGATTTTCTGAGGGTTTCATAGCACTCTAAAGATTCCAAATATTCGACAAGAATTTTCATCTAAACCAATTGATATAGGTCATTATTCGAAGTCACCTTAGTCATCTCGATGATCAATTTAAGGTTCTTATTAATTATTCTCAGTGTTCATCTTTCTTACGAGCATGATCTAAACTGGTAAATAGTGTTTCGTAGCCTATAATTTCTGGATATGAATTTTTCAATGATAGAAATGTAAGATGCGATGCGATGAGATGATATACTAATATGTAAAGGGTAAAGGAAATGGATGCTTAATTATAGCTCTAGATTTACTAGTTATTCACATGAAAAGCTAACAGTATGGTTAAGAAACATCTGAACCCCACTAAGATCGATTTTATAAAATGCATCGTCGAAGATTGCCTCTGGCAAATTCGAGATACCA
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)