blastn task: ncRNA

Status
finished finished
Modified 2014-05-16T13:59:11Z
CPU time (s) 0.1
Size (bytes) 6000
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna' -num_alignments 250 -evalue 5.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis;
Kluyveromyces lactis NRRL Y-1140
           20,500 sequences; 70,111,562 total letters



Query= query

Length=345
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

  AEAS01000098  Kluyveromyces aestuarii ATCC 18862 contig00103, w...  39.2    0.036
  AEAS01000106  Kluyveromyces aestuarii ATCC 18862 contig00111, w...  35.6    0.44 
  KLAEg220 KLAEg220 undefined product 469367:472660 reverse           35.6    0.44 
  gsASS001Lm                                                          33.7    1.5  


> AEAS01000098  Kluyveromyces aestuarii ATCC 18862 contig00103, 
whole genome shotgun sequence
Length=56028

 Score = 39.2 bits (42),  Expect = 0.036
 Identities = 32/38 (85%), Gaps = 1/38 (2%)
 Strand=Plus/Minus

Query  204    GAAGAG-TGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
              |||||| | |||||| ||||||||||||| | || |||
Sbjct  24077  GAAGAGATTAAAACAGCTAAATCAGGCGGAATAATAAA  24040


> AEAS01000106  Kluyveromyces aestuarii ATCC 18862 contig00111, 
whole genome shotgun sequence
Length=37058

 Score = 35.6 bits (38),  Expect = 0.44
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  10    AGTGGGGAGTAAAGAATAAAGC  31
             |||||| |||||||||||||||
Sbjct  4538  AGTGGGTAGTAAAGAATAAAGC  4517


> KLAEg220 KLAEg220 undefined product 469367:472660 reverse
Length=3294

 Score = 35.6 bits (38),  Expect = 0.44
 Identities = 21/22 (96%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  10    AGTGGGGAGTAAAGAATAAAGC  31
             |||||| |||||||||||||||
Sbjct  1707  AGTGGGTAGTAAAGAATAAAGC  1686


> gsASS001Lm
Length=10741898

 Score = 33.7 bits (36),  Expect = 1.5
 Identities = 26/31 (84%), Gaps = 4/31 (12%)
 Strand=Plus/Minus

Query  267     TTACAGGTGATATTTGTATATGATTATGAAT  297
               |||||||||||    ||||||||||||| ||
Sbjct  634222  TTACAGGTGAT----GTATATGATTATGTAT  634196


 Score = 33.7 bits (36),  Expect = 1.5
 Identities = 23/26 (89%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  317       TCTTTCATTTCTATATTATGTGTAGC  342
                 |||||||||||| |||||| | ||||
Sbjct  10476089  TCTTTCATTTCTTTATTATATATAGC  10476114



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 22119463716


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
ttagggttgagtggggagtaaagaataaagcgaatcctattcgtgtaagccggtctacttattgataacaatattttacaggcggctatcatgtttcagcttacgcattcacagtcaggttggtgctctacatgaataccagcgtttactttcatttacagagtactagcacctccactgtcgctaatactgaatttagttttgaagagtgaaaacaactaaatcaggcggtagaagaaaatcaatagctcatatattcttatatattacaggtgatatttgtatatgattatgaatggcttttcgtagcccgtgatctttcatttctatattatgtgtagctaa
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)