blastn task: ncRNA

Status
finished finished
Modified 2014-05-16T13:49:40Z
CPU time (s) 30.5
Size (bytes) 33458
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna yeast.nt nt' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis;
Kluyveromyces lactis NRRL Y-1140; Saccharomyces cerevisiae; All
GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental
samples or phase 0, 1 or 2 HTGS sequences)
           15,120,236 sequences; 39,156,405,517 total letters



Query= query

Length=345
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

tpg|BK006937.2|  TPA: TPA_inf: Saccharomyces cerevisiae S288c chr...   623    3e-175
emb|FN393062.1|  Saccharomyces cerevisiae EC1118 chromosome III, ...   623    3e-175
emb|X59720.2|  S.cerevisiae chromosome III complete DNA sequence       623    3e-175
  gi|6319780|ref|NC_001135.1| Saccharomyces cerevisiae chromosome...   614    1e-172
ref|XM_001461507.1|  Paramecium tetraurelia hypothetical protein ...  48.2    0.038 
gb|AC154838.2|  Mus musculus BAC clone RP23-64F2 from chromosome ...  44.6    0.46  
gb|CP002304.1|  Halanaerobium hydrogeniformans, complete genome       42.8    1.6   
gb|AC235284.1|  Glycine max strain Williams 82 clone GM_WBb0051L2...  42.8    1.6   
dbj|AP010943.1|  Solanum lycopersicum DNA, chromosome 8, clone: C...  42.8    1.6   
gb|AE014135.3|  Drosophila melanogaster chromosome 4, complete se...  42.8    1.6   
gb|AC010916.9|  Drosophila melanogaster clone BACR11A04, complete...  42.8    1.6   
gb|AC115768.9|  Mus musculus chromosome 19, clone RP23-107E10, co...  42.8    1.6   
emb|AL445240.8|  Human DNA sequence from clone RP11-242A15 on chr...  42.8    1.6   
gb|AC004517.1|AC004517  Homo sapiens chromosome 19, cosmid F19807...  42.8    1.6   
dbj|AP012047.1|  Arcobacter butzleri ED-1 DNA, complete genome        41.0    5.6   
gb|CP002687.1|  Arabidopsis thaliana chromosome 4, complete sequence  41.0    5.6   
gb|CP002686.1|  Arabidopsis thaliana chromosome 3, complete sequence  41.0    5.6   
ref|XM_003290392.1|  Dictyostelium purpureum hypothetical protein...  41.0    5.6   
gb|CP001936.1|  Thermoanaerobacter italicus Ab9, complete genome      41.0    5.6   
gb|AC236981.1|  Tupaia belangeri BAC clone CH275-41H12 from chrom...  41.0    5.6   
dbj|AB257588.1|  Silene latifolia DNA, Y chromosome fragment sequ...  41.0    5.6   
emb|CU467494.10|  Mouse DNA sequence from clone RP24-118O5 on chr...  41.0    5.6   
gb|CP000361.1|  Arcobacter butzleri RM4018, complete genome           41.0    5.6   
emb|AM459542.2|  Vitis vinifera contig VV78X251076.2, whole genom...  41.0    5.6   
emb|AM485923.2|  Vitis vinifera contig VV78X076753.1, whole genom...  41.0    5.6   
ref|XM_001386634.1|  Scheffersomyces stipitis CBS 6054 hypothetic...  41.0    5.6   
gb|CP000502.1|  Scheffersomyces stipitis CBS 6054 chromosome 8, c...  41.0    5.6   
emb|AM454632.1|  Vitis vinifera contig VV78X225378.8, whole genom...  41.0    5.6   
gb|CP000450.1|  Nitrosomonas eutropha C91, complete genome            41.0    5.6   
gb|AC186821.2|  Gallus gallus BAC clone CH261-164M21 from chromos...  41.0    5.6   
gb|AC127697.3|  Mus musculus chromosome 15 clone RP24-83I10, comp...  41.0    5.6   
gb|AC122900.3|  Mus musculus BAC clone RP23-39N24 from 15, comple...  41.0    5.6   
gb|AC154491.2|  Mus musculus BAC clone RP24-106D8 from chromosome...  41.0    5.6   
gb|AC104947.3|  Homo sapiens chromosome 11, clone RP11-1029L14, c...  41.0    5.6   
gb|AC112178.2|  Homo sapiens chromosome 5 clone RP11-114H21, comp...  41.0    5.6   
gb|AC021039.12|  Homo sapiens chromosome 10 clone RP11-478K18, co...  41.0    5.6   
gb|AC099497.2|  Homo sapiens chromosome 5 clone RP11-139A10, comp...  41.0    5.6   
gb|AC008916.7|  Homo sapiens chromosome 5 clone CTD-2271P9, compl...  41.0    5.6   
gb|AC099554.2|  Homo sapiens chromosome 5 clone RP11-61G23, compl...  41.0    5.6   
gb|AC091947.4|  Homo sapiens chromosome 5 clone RP11-367F9, compl...  41.0    5.6   
gb|AC110759.3|  Homo sapiens BAC clone RP11-25H12 from 4, complet...  41.0    5.6   
gb|AC010487.7|AC010487  Homo sapiens chromosome 19 clone CTD-2331...  41.0    5.6   
emb|AL138638.2|  Arabidopsis thaliana DNA chromosome 3, BAC clone...  41.0    5.6   
emb|AL161831.1|  Arabidopsis thaliana DNA chromosome 4, BAC clone...  41.0    5.6   
emb|AL161515.2|  Arabidopsis thaliana DNA chromosome 4, contig fr...  41.0    5.6   
emb|CR974473.23|  Mouse DNA sequence from clone RP23-38P5 on chro...  41.0    5.6   
emb|CT033758.4|  Mouse DNA sequence from clone RP23-430N23 on chr...  41.0    5.6   
emb|BX005342.14|  Zebrafish DNA sequence from clone DKEY-81P7 in ...  41.0    5.6   
gb|AC008959.4|AC008959  Homo sapiens chromosome 5 clone CTD-2354D...  41.0    5.6   


>tpg|BK006937.2| TPA_inf: Saccharomyces cerevisiae S288c chromosome III, complete 
sequence
Length=316620

 Score =  623 bits (690),  Expect = 3e-175
 Identities = 345/345 (100%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176946  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  176887

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176886  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  176827

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176826  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  176767

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176766  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  176707

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176706  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  176647

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176646  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  176602


>emb|FN393062.1| Saccharomyces cerevisiae EC1118 chromosome III, EC1118_1C17 genomic 
scaffold, whole genome shotgun sequence
Length=291998

 Score =  623 bits (690),  Expect = 3e-175
 Identities = 345/345 (100%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  164001  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  163942

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163941  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  163882

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163881  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  163822

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163821  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  163762

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163761  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  163702

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  163701  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  163657


>emb|X59720.2| S.cerevisiae chromosome III complete DNA sequence
Length=316613

 Score =  623 bits (690),  Expect = 3e-175
 Identities = 345/345 (100%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176938  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  176879

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176878  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  176819

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176818  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  176759

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176758  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  176699

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176698  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  176639

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  176638  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  176594


> gi|6319780|ref|NC_001135.1| Saccharomyces cerevisiae chromosome 
III, complete chromosome sequence
Length=315339

 Score =  614 bits (680),  Expect = 1e-172
 Identities = 343/345 (99%), Gaps = 0/345 (0%)
 Strand=Plus/Minus

Query  1       TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175671  TTAGGGTTGAGTGGGGAGTAAAGAATAAAGCGAATCCTATTCGTGTAAGCCGGTCTACTT  175612

Query  61      ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCAGCTTACGCATTCACAGTCAGGT  120
               ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
Sbjct  175611  ATTGATAACAATATTTTACAGGCGGCTATCATGTTTCACGTTACGCATTCACAGTCAGGT  175552

Query  121     TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175551  TGGTGCTCTACATGAATACCAGCGTTTACTTTCATTTACAGAGTACTAGCACCTCCACTG  175492

Query  181     TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175491  TCGCTAATACTGAATTTAGTTTTGAAGAGTGAAAACAACTAAATCAGGCGGTAGAAGAAA  175432

Query  241     ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175431  ATCAATAGCTCATATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAATGGC  175372

Query  301     TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  345
               |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  175371  TTTTCGTAGCCCGTGATCTTTCATTTCTATATTATGTGTAGCTAA  175327


>ref|XM_001461507.1| Paramecium tetraurelia hypothetical protein (GSPATT00026494001) 
partial mRNA
Length=3105

 Score = 48.2 bits (52),  Expect = 0.038
 Identities = 37/44 (85%), Gaps = 0/44 (0%)
 Strand=Plus/Plus

Query  254  ATATTCTTATATATTACAGGTGATATTTGTATATGATTATGAAT  297
            ||| ||| ||| |||||| || ||||||||||| |||| |||||
Sbjct  71   ATACTCTAATAAATTACAAGTCATATTTGTATAGGATTTTGAAT  114


>gb|AC154838.2| Mus musculus BAC clone RP23-64F2 from chromosome 14, complete 
sequence
Length=224431

 Score = 44.6 bits (48),  Expect = 0.46
 Identities = 35/41 (86%), Gaps = 1/41 (2%)
 Strand=Plus/Minus

Query  248     GCTCATATATTCTTATATATTACAGGTGATATTTG-TATAT  287
               ||| ||||||| |||||||||||| ||| ||| || |||||
Sbjct  114405  GCTTATATATTATTATATATTACATGTGCTATATGTTATAT  114365


>gb|CP002304.1| Halanaerobium hydrogeniformans, complete genome
Length=2613117

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 38/47 (81%), Gaps = 2/47 (4%)
 Strand=Plus/Plus

Query  212     AAAACAACTAAATCAGGCGGTAGAAGAAAATCAATAGCTCATATATT  258
               ||||||||||||||||||| |  || ||| ||||||  | | |||||
Sbjct  106643  AAAACAACTAAATCAGGCGCT--AATAAATTCAATAAATTAGATATT  106687


>gb|AC235284.1| Glycine max strain Williams 82 clone GM_WBb0051L20, complete 
sequence
Length=138019

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 36/42 (86%), Gaps = 2/42 (4%)
 Strand=Plus/Minus

Query  252    ATATATTCTTATATATTACAGGTGATATTTGTATATGATTAT  293
              || |||| |||||| |||||  |||||||||||||| |||||
Sbjct  99417  ATTTATTTTTATATTTTACAT-TGATATTTGTATAT-ATTAT  99378


>dbj|AP010943.1| Solanum lycopersicum DNA, chromosome 8, clone: C08SLe0113A16, 
complete sequence
Length=84414

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 40/50 (80%), Gaps = 1/50 (2%)
 Strand=Plus/Plus

Query  232    TAGAAGAAAATCAATAGCTCATATATTCTTATATATTACAGGTGATATTT  281
              ||||||||||| ||||  || || ||| |||| ||||| | |||||| ||
Sbjct  27416  TAGAAGAAAATAAATATTTCCTACATTTTTATTTATTA-AAGTGATAATT  27464


>gb|AE014135.3| Drosophila melanogaster chromosome 4, complete sequence
Length=1351857

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 36/43 (84%), Gaps = 1/43 (2%)
 Strand=Plus/Plus

Query  252     ATATATTCTTATATATTACAG-GTGATATTTGTATATGATTAT  293
               ||||||| |||||| ||| |  || |||||||||||| |||||
Sbjct  818680  ATATATTATTATATTTTATACTGTTATATTTGTATATTATTAT  818722


>gb|AC010916.9| Drosophila melanogaster clone BACR11A04, complete sequence
Length=165458

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 36/43 (84%), Gaps = 1/43 (2%)
 Strand=Plus/Minus

Query  252     ATATATTCTTATATATTACAG-GTGATATTTGTATATGATTAT  293
               ||||||| |||||| ||| |  || |||||||||||| |||||
Sbjct  145381  ATATATTATTATATTTTATACTGTTATATTTGTATATTATTAT  145339


>gb|AC115768.9| Mus musculus chromosome 19, clone RP23-107E10, complete sequence
Length=212161

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 41/50 (82%), Gaps = 2/50 (4%)
 Strand=Plus/Plus

Query  250     TCATATAT-TCTTATATATTACAGGTGATAT-TTGTATATGATTATGAAT  297
               |||||||| |  ||||||||||| || |||| || ||||||| |||| ||
Sbjct  155723  TCATATATATAATATATATTACATGTTATATATTATATATGAATATGTAT  155772


>emb|AL445240.8| Human DNA sequence from clone RP11-242A15 on chromosome 10 Contains 
the 5' end of a novel gene, complete sequence
Length=152898

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  250    TCATATATTCTTATATATTACAGGTGATATTTGTATATGAT  290
              |||||||||  |||||||||||  | |||||| ||||| ||
Sbjct  28531  TCATATATTTCTATATATTACATATAATATTTATATATCAT  28571


>gb|AC004517.1|AC004517 Homo sapiens chromosome 19, cosmid F19807, complete sequence
Length=44062

 Score = 42.8 bits (46),  Expect = 1.6
 Identities = 39/46 (85%), Gaps = 5/46 (10%)
 Strand=Plus/Plus

Query  246    TAGCTCATATATTCTTATATATTACAG-GTG---ATATTTGTATAT  287
              |||||||| |||||||||||| ||||| |||   |||| |||||||
Sbjct  28860  TAGCTCATTTATTCTTATATA-TACAGTGTGTATATATATGTATAT  28904


>dbj|AP012047.1| Arcobacter butzleri ED-1 DNA, complete genome
Length=2256675

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 36/44 (82%), Gaps = 1/44 (2%)
 Strand=Plus/Minus

Query  204      GAAGAG-TGAAAACAACTAAATCAGGCGGTAGAAGAAAATCAAT  246
                |||||| || ||||||||||||| |  | || ||||||| ||||
Sbjct  1766270  GAAGAGATGGAAACAACTAAATCTGAAGCTAAAAGAAAAACAAT  1766227


>gb|CP002687.1| Arabidopsis thaliana chromosome 4, complete sequence
Length=18585056

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 35/42 (84%), Gaps = 1/42 (2%)
 Strand=Plus/Plus

Query  239      AAATCAATAGCTCATATATTCTTATATATTACAGGTGATATT  280
                |||||||||  | ||||||| | ||||||||||||| | |||
Sbjct  6082511  AAATCAATAT-TAATATATTATGATATATTACAGGTAAAATT  6082551


>gb|CP002686.1| Arabidopsis thaliana chromosome 3, complete sequence
Length=23459830

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 29/32 (91%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  193       AATTTAGTTTTGAAGAGTGAAAACAACTAAAT  224
                 |||||||||||||| | |||||| ||||||||
Sbjct  15610647  AATTTAGTTTTGAA-ATTGAAAAAAACTAAAT  15610677


>ref|XM_003290392.1| Dictyostelium purpureum hypothetical protein, mRNA
Length=1290

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  263  TATATTACAGGTGATATTTGTATATGA  289
            |||||||||| |||||||||||| |||
Sbjct  168  TATATTACAGTTGATATTTGTATTTGA  142


>gb|CP001936.1| Thermoanaerobacter italicus Ab9, complete genome
Length=2451061

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  276     ATATTTGTATATGATTATGAATGGCTTTTC  305
               |||||||||||||| ||  |||||||||||
Sbjct  824265  ATATTTGTATATGAATAATAATGGCTTTTC  824294


>gb|AC236981.1| Tupaia belangeri BAC clone CH275-41H12 from chromosome unknown, 
complete sequence
Length=165417

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  185     TAATACTGAATTTAGTTTTGAA  206
               ||||||||||||||||||||||
Sbjct  146018  TAATACTGAATTTAGTTTTGAA  146039


>dbj|AB257588.1| Silene latifolia DNA, Y chromosome fragment sequence
Length=109499

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  259    CTTATATATTACAGGTGATATTTGTATATGAT  290
              ||||||||  ||| ||||||||||||||| ||
Sbjct  17957  CTTATATAAAACATGTGATATTTGTATATCAT  17988


>emb|CU467494.10| Mouse DNA sequence from clone RP24-118O5 on chromosome 17, complete 
sequence
Length=201775

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 34/40 (85%), Gaps = 4/40 (10%)
 Strand=Plus/Minus

Query  258     TCTTATATAT---TACAGGTG-ATATTTGTATATGATTAT  293
               ||||||||||   |||| ||| |||||||||||||| |||
Sbjct  172477  TCTTATATATGTATACATGTGTATATTTGTATATGAATAT  172438


>gb|CP000361.1| Arcobacter butzleri RM4018, complete genome
Length=2341251

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 36/44 (82%), Gaps = 1/44 (2%)
 Strand=Plus/Minus

Query  204      GAAGAG-TGAAAACAACTAAATCAGGCGGTAGAAGAAAATCAAT  246
                |||||| || ||||||||||||| |  | || ||||||| ||||
Sbjct  1888164  GAAGAGATGGAAACAACTAAATCTGAAGCTAAAAGAAAAACAAT  1888121


>emb|AM459542.2| Vitis vinifera contig VV78X251076.2, whole genome shotgun sequence
Length=1335

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 34/42 (81%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  249  CTCATATATTCTTATATATTACAGGTGATATTTGTATATGAT  290
            |||||| |||  |||||  |||  ||||||||||||||| ||
Sbjct  578  CTCATACATTTGTATATGATACTAGTGATATTTGTATATAAT  619


>emb|AM485923.2| Vitis vinifera contig VV78X076753.1, whole genome shotgun sequence
Length=4079

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 33/39 (85%), Gaps = 1/39 (2%)
 Strand=Plus/Minus

Query  231  GTAGAAGAAAATCAATAGCTCATATATTCTTATATATTA  269
            |||||||||||  ||||| | ||||||| || |||||||
Sbjct  97   GTAGAAGAAAAATAATAGATAATATATTATT-TATATTA  60


>ref|XM_001386634.1| Scheffersomyces stipitis CBS 6054 hypothetical protein partial 
mRNA
Length=1247

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 44/56 (79%), Gaps = 2/56 (3%)
 Strand=Plus/Minus

Query  266  ATTACAGGTGATATTTGTATATGATTATGAATGGCTTTTCGTAGCCCGTGATCTTT  321
            ||||||| || |||||| || ||||||||||| | ||   |||| |  ||||||||
Sbjct  363  ATTACAG-TGGTATTTGAATTTGATTATGAATTGATTAATGTAG-CAATGATCTTT  310


>gb|CP000502.1| Scheffersomyces stipitis CBS 6054 chromosome 8, complete sequence
Length=979380

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 44/56 (79%), Gaps = 2/56 (3%)
 Strand=Plus/Plus

Query  266     ATTACAGGTGATATTTGTATATGATTATGAATGGCTTTTCGTAGCCCGTGATCTTT  321
               ||||||| || |||||| || ||||||||||| | ||   |||| |  ||||||||
Sbjct  438082  ATTACAG-TGGTATTTGAATTTGATTATGAATTGATTAATGTAG-CAATGATCTTT  438135


>emb|AM454632.1| Vitis vinifera contig VV78X225378.8, whole genome shotgun sequence
Length=11044

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 34/42 (81%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  249   CTCATATATTCTTATATATTACAGGTGATATTTGTATATGAT  290
             || ||| |||  |||||| |||  ||||||||||||||| ||
Sbjct  5494  CTTATACATTTGTATATAATACTAGTGATATTTGTATATAAT  5535


>gb|CP000450.1| Nitrosomonas eutropha C91, complete genome
Length=2661057

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  186      AATACTGAATTTAGTTTTGAAGAGTGAAAACA  217
                ||||||||||||||||||  ||||||  ||||
Sbjct  1558894  AATACTGAATTTAGTTTTCGAGAGTGCCAACA  1558863


>gb|AC186821.2| Gallus gallus BAC clone CH261-164M21 from chromosome z, complete 
sequence
Length=203417

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 32/37 (87%), Gaps = 1/37 (2%)
 Strand=Plus/Minus

Query  251    CATATATTCTTATATATTACAGGTGATATTTGTATAT  287
              |||||||||||||||||  || || |||||| |||||
Sbjct  77186  CATATATTCTTATATATCCCATGT-ATATTTATATAT  77151


>gb|AC127697.3| Mus musculus chromosome 15 clone RP24-83I10, complete sequence
Length=205653

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  120     TTGGTGCTCTACATGAATACCAGCGTTTACTT  151
               ||| || ||| |||||| ||||||||||||||
Sbjct  186487  TTGTTGATCTTCATGAAAACCAGCGTTTACTT  186518


>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence
Length=203855

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  120     TTGGTGCTCTACATGAATACCAGCGTTTACTT  151
               ||| || ||| |||||| ||||||||||||||
Sbjct  177113  TTGTTGATCTTCATGAAAACCAGCGTTTACTT  177082


>gb|AC154491.2| Mus musculus BAC clone RP24-106D8 from chromosome 17, complete 
sequence
Length=146960

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  244    AATAGCTCATATATTCTTATATATTAC  270
              |||||||| |||||||||||||| |||
Sbjct  10676  AATAGCTCTTATATTCTTATATAATAC  10702


>gb|AC104947.3| Homo sapiens chromosome 11, clone RP11-1029L14, complete sequence
Length=186823

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 34/42 (81%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  244     AATAGCTCATATATTCTTATATATTACAGGTGATATTTGTAT  285
               ||| | ||| |||||||||||| |||  |||| ||||| |||
Sbjct  173831  AATTGATCAAATATTCTTATATTTTAATGGTGTTATTTTTAT  173872


>gb|AC112178.2| Homo sapiens chromosome 5 clone RP11-114H21, complete sequence
Length=159853

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 38/46 (83%), Gaps = 2/46 (4%)
 Strand=Plus/Minus

Query  253     TATATTCTTATATATTACAGGTGATATTTGTATATGAT-TATGAAT  297
               |||||| ||||||||||||  | |||| ||||||| || |||| ||
Sbjct  117185  TATATT-TTATATATTACATATCATATATGTATATTATATATGTAT  117141


>gb|AC021039.12| Homo sapiens chromosome 10 clone RP11-478K18, complete sequence
Length=139537

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  262     ATATATTACAGGTGATATTTGTATATGATTAT  293
               |||||||| | |||||  ||||||||||||||
Sbjct  123619  ATATATTATATGTGATGATTGTATATGATTAT  123588


>gb|AC099497.2| Homo sapiens chromosome 5 clone RP11-139A10, complete sequence
Length=165884

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 37/44 (85%), Gaps = 2/44 (4%)
 Strand=Plus/Plus

Query  249     CTCATATATTCTTATATATTACAG-GTG-ATATTTGTATATGAT  290
               |||||||||||| |||||| | || ||| |||| | ||||||||
Sbjct  134781  CTCATATATTCTCATATATAAGAGTGTGTATATATATATATGAT  134824


>gb|AC008916.7| Homo sapiens chromosome 5 clone CTD-2271P9, complete sequence
Length=133862

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 30/34 (89%), Gaps = 1/34 (2%)
 Strand=Plus/Minus

Query  260    TTATATATTACAGGTGAT-ATTTGTATATGATTA  292
              ||||||||||||  |||| ||||||||||| |||
Sbjct  98218  TTATATATTACATATGATTATTTGTATATGTTTA  98185


>gb|AC099554.2| Homo sapiens chromosome 5 clone RP11-61G23, complete sequence
Length=164920

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 37/44 (85%), Gaps = 2/44 (4%)
 Strand=Plus/Plus

Query  249     CTCATATATTCTTATATATTACAG-GTG-ATATTTGTATATGAT  290
               |||||||||||| |||||| | || ||| |||| | ||||||||
Sbjct  104792  CTCATATATTCTCATATATAAGAGTGTGTATATATATATATGAT  104835


>gb|AC091947.4| Homo sapiens chromosome 5 clone RP11-367F9, complete sequence
Length=170063

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 34/39 (88%), Gaps = 2/39 (5%)
 Strand=Plus/Minus

Query  252    ATATATTCTTATATATTACAGGTG-ATAT-TTGTATATG  288
              ||||||| |||||||||||| ||| |||| || ||||||
Sbjct  76759  ATATATTTTTATATATTACATGTGTATATATTATATATG  76721


>gb|AC110759.3| Homo sapiens BAC clone RP11-25H12 from 4, complete sequence
Length=100802

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  254   ATATTCTTATATATTACAGGTGATATTTGTATATGAT  290
             ||||||||||||||||  ||||||| | | | |||||
Sbjct  4802  ATATTCTTATATATTATTGGTGATAATAGAAAATGAT  4838


>gb|AC010487.7|AC010487 Homo sapiens chromosome 19 clone CTD-2331H12, complete sequence
Length=102341

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 36/44 (82%), Gaps = 1/44 (2%)
 Strand=Plus/Plus

Query  251    CATATATTCTTATATATTACAGGTG-ATATTTGTATATGATTAT  293
              |||||||  |||||||||| |  |  |||||| |||||||||||
Sbjct  16541  CATATATATTTATATATTATACATATATATTTATATATGATTAT  16584


>emb|AL138638.2| Arabidopsis thaliana DNA chromosome 3, BAC clone F23N14
Length=83442

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 29/32 (91%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  193    AATTTAGTTTTGAAGAGTGAAAACAACTAAAT  224
              |||||||||||||| | |||||| ||||||||
Sbjct  77881  AATTTAGTTTTGAA-ATTGAAAAAAACTAAAT  77911


>emb|AL161831.1| Arabidopsis thaliana DNA chromosome 4, BAC clone T25P22 (ESSA 
project)
Length=97876

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 35/42 (84%), Gaps = 1/42 (2%)
 Strand=Plus/Plus

Query  239    AAATCAATAGCTCATATATTCTTATATATTACAGGTGATATT  280
              |||||||||  | ||||||| | ||||||||||||| | |||
Sbjct  52970  AAATCAATAT-TAATATATTATGATATATTACAGGTAAAATT  53010


>emb|AL161515.2| Arabidopsis thaliana DNA chromosome 4, contig fragment No. 27
Length=197394

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 35/42 (84%), Gaps = 1/42 (2%)
 Strand=Plus/Plus

Query  239     AAATCAATAGCTCATATATTCTTATATATTACAGGTGATATT  280
               |||||||||  | ||||||| | ||||||||||||| | |||
Sbjct  100128  AAATCAATAT-TAATATATTATGATATATTACAGGTAAAATT  100168


>emb|CR974473.23| Mouse DNA sequence from clone RP23-38P5 on chromosome 17, complete 
sequence
Length=219471

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 34/40 (85%), Gaps = 4/40 (10%)
 Strand=Plus/Minus

Query  258     TCTTATATAT---TACAGGTG-ATATTTGTATATGATTAT  293
               ||||||||||   |||| ||| |||||||||||||| |||
Sbjct  158619  TCTTATATATGTATACATGTGTATATTTGTATATGAATAT  158580


>emb|CT033758.4| Mouse DNA sequence from clone RP23-430N23 on chromosome 17, complete 
sequence
Length=175359

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  244     AATAGCTCATATATTCTTATATATTAC  270
               |||||||| |||||||||||||| |||
Sbjct  114356  AATAGCTCTTATATTCTTATATAATAC  114382


>emb|BX005342.14| Zebrafish DNA sequence from clone DKEY-81P7 in linkage group 
16 Contains the pafah1b3 gene for platelet-activating factor 
acetylhydrolase isoform Ib gamma subunit, two genes for novel 
proteins similar to vertebrate titin (TTN), three genes for 
novel proteins similar to vertebrate chemokine (C-X-C motif) 
receptor 3 (CXCR3), the tlr21 gene for toll-like receptor 
21, five novel genes and three CpG islands, complete sequence
Length=257502

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 34/39 (88%), Gaps = 2/39 (5%)
 Strand=Plus/Minus

Query  233    AGAAGAAAATCAATAGCTCATATATTCTTAT-ATATTAC  270
              ||| |||| ||| |||||||||||||| ||| |||||||
Sbjct  34200  AGAGGAAAGTCA-TAGCTCATATATTCATATAATATTAC  34163


>gb|AC008959.4|AC008959 Homo sapiens chromosome 5 clone CTD-2354D23, complete sequence
Length=98620

 Score = 41.0 bits (44),  Expect = 5.6
 Identities = 30/34 (89%), Gaps = 1/34 (2%)
 Strand=Plus/Minus

Query  260    TTATATATTACAGGTGAT-ATTTGTATATGATTA  292
              ||||||||||||  |||| ||||||||||| |||
Sbjct  40122  TTATATATTACATATGATTATTTGTATATGTTTA  40089



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 11974431149670


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7

  Database: Saccharomyces cerevisiae
    Posted date:  Jul 14, 2011  9:42 PM
  Number of letters in database: 12,155,026
  Number of sequences in database:  17

  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Nov 30, 2011  4:13 AM
  Number of letters in database: 39,074,138,929
  Number of sequences in database:  15,099,719



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
ttagggttgagtggggagtaaagaataaagcgaatcctattcgtgtaagccggtctacttattgataacaatattttacaggcggctatcatgtttcagcttacgcattcacagtcaggttggtgctctacatgaataccagcgtttactttcatttacagagtactagcacctccactgtcgctaatactgaatttagttttgaagagtgaaaacaactaaatcaggcggtagaagaaaatcaatagctcatatattcttatatattacaggtgatatttgtatatgattatgaatggcttttcgtagcccgtgatctttcatttctatattatgtgtagctaa
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)