blastn task: [no title]

Status
finished finished
Modified 2013-11-06T19:56:30Z
CPU time (s) 188.0
Size (bytes) 607825
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db 'gsASS001Lm.aug.trna.KL.rRNA2.fna gsASS001Lm.aug.trna.KL.rRNA2.ffn Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.fasta Kluyveromyces_aestuarii_ATCC_18862.AEAS00000000_1.aug.ffn Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.fasta Kluyveromyces_wickerhamii_UCD_54_210.AEAV00000000_1.aug.ffn Kluyveromyces_lactis.ffn Kluyveromyces_lactis_Y-1140.fna yeast.nt nt' -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Kluyveromyces dobzhanskii (Sep 2011); Kluyveromyces dobzhanskii
genes (Sep 2011); Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1;
Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes;
Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1; Kluyveromyces
wickerhamii UCD 54 210 AEAV00000000_1 genes; Kluyveromyces lactis;
Kluyveromyces lactis NRRL Y-1140; Saccharomyces cerevisiae; All
GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental
samples or phase 0, 1 or 2 HTGS sequences)
           15,120,236 sequences; 39,156,405,517 total letters



Query= gi|2856|emb|X06997.1| Kluyveromyces lactis LAC12 gene for lactose
permease

Length=7127
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

emb|X06997.1|  Kluyveromyces lactis LAC12 gene for lactose permease   1.285e+04  0.0   
emb|CR382122.1|  Kluyveromyces lactis strain NRRL Y-1140 chromoso...  1.226e+04  0.0   
  gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 c...  1.226e+04  0.0   
ref|XM_452193.1|  Kluyveromyces lactis NRRL Y-1140 hypothetical p...  3182       0.0   
  KLLA0B14861g KLLA0B14861g undefined product 2368517:2370280 rev...  3182       0.0   
ref|XM_452192.1|  Kluyveromyces lactis NRRL Y-1140 hypothetical p...  2284       0.0   
  KLLA0B14839g KLLA0B14839g undefined product 2366679:2367944 rev...  2284       0.0   
  gsASS001Lm                                                          1283       0.0   
  KLDOg3463                                                           1276       0.0   
gb|JF327849.1|  Expression vector LIC-pKLAC-LC2, complete sequence    1182       0.0   
gb|JF327848.1|  Expression vector LIC-pKLAC-LC1, complete sequence    1182       0.0   
gb|HQ236722.1|  Expression vector pKLCF-c, complete sequence          1182       0.0   
gb|HQ214066.1|  Expression vector pKLCF-n, complete sequence          1182       0.0   
gb|FJ010198.1|  Expression vector pKLAC1-Gluc, complete sequence      1182       0.0   
gb|FJ010197.1|  Expression vector pKLMF-FX, complete sequence         1182       0.0   
gb|FJ010196.1|  Expression vector pKLMF-EK, complete sequence         1182       0.0   
gb|EU196354.2|  Expression vector pKLAC2, complete sequence           1182       0.0   
gb|AY968582.1|  Expression vector pKLAC1, complete sequence           1182       0.0   
emb|X05918.1|  Kluyveromyces fragilis beta-glucosidase gene            951       0.0   
emb|Y09281.1|  K.fragilis LAC4 gene, regulatory signal                 753       0.0   
  AEAV01000200  Kluyveromyces wickerhamii UCD 54-210 contig00208,...   742       0.0   
  KLWIg4168 KLWIg4168 undefined product 8462108:8463787 forward        742       0.0   
  AEAS01000242  Kluyveromyces aestuarii ATCC 18862 contig00543, w...   650       0.0   
  KLAEg3794 KLAEg3794 undefined product 8015797:8017485 forward        650       0.0   
dbj|AB293446.1|  Saccharomyces cerevisiae gene for aquaporin Aqy1...   589       1e-163
dbj|AB293445.1|  Saccharomyces cerevisiae gene for aquaporin Aqy1...   589       1e-163
gb|AF288620.1|  Cloning vector pdeltaE1sp1A(CMV-GFP), complete se...   589       1e-163
gb|AY131236.1|  Adenoviral vector Ad-SAR1-x/ASX, complete sequence     589       1e-163
gb|M99566.1|SYNSCOS  sCos cloning vector SfiI containing bacterio...   589       1e-163
gb|AF136442.1|AF136442  Cloning vector pScosBC1, E. coli-Burkhold...   589       1e-163
gb|AF129504.1|AF129504  Cloning vector pWDYcos1.0.1, complete seq...   589       1e-163
gb|U13189.1|CVU13189  Cloning vector pYACneo, complete sequence        587       4e-163
gb|HQ343239.1|  Synthetic construct clone pSB4316, complete sequence   585       1e-162
gb|HQ343238.1|  Synthetic construct clone pSB4288, complete sequence   585       1e-162
gb|HQ343237.1|  Synthetic construct clone pSB4284, complete sequence   585       1e-162
gb|HQ343236.1|  Synthetic construct clone pSB4281, complete sequence   585       1e-162
gb|HQ343235.1|  Expression vector pSB3941, complete sequence           585       1e-162
gb|EU421723.1|  Cloning vector pSB4234, complete sequence              585       1e-162
gb|EF456738.1|  Expression vector pET15-MHL, complete sequence         585       1e-162
gb|EF456736.1|  Expression vector p15TV-L, complete sequence           585       1e-162
gb|EF028675.1|  Cloning vector pDV-NTAP-CYFP, complete sequence        585       1e-162
gb|EF028674.1|  Cloning vector pDV-NTAP-CGFP, complete sequence        585       1e-162
gb|EF028673.1|  Cloning vector pDV-CYFP-CTAP, complete sequence        585       1e-162
gb|EF028672.1|  Cloning vector pDV-CGFP-CTAP, complete sequence        585       1e-162
gb|EF028671.1|  Cloning vector pDV-NYFP-CTAP, complete sequence        585       1e-162
gb|EF028670.1|  Cloning vector pDV-NTAP-NYFP, complete sequence        585       1e-162
gb|EF028669.1|  Cloning vector pDV-CTAP, complete sequence             585       1e-162
gb|EF028668.1|  Cloning vector pDV-CYFP, complete sequence             585       1e-162
gb|EF028667.1|  Cloning vector pDV-CGFP, complete sequence             585       1e-162
gb|EF028666.1|  Cloning vector pDV-NTAP, complete sequence             585       1e-162
gb|EF028665.1|  Cloning vector pDV-NYFP, complete sequence             585       1e-162
gb|EF028664.1|  Cloning vector EXP5(+), complete sequence              585       1e-162
gb|EF028663.1|  Cloning vector EXP4(+), complete sequence              585       1e-162
gb|AY751540.1|  Ubiquitin protease vector pHUsp2-cc, complete seq...   585       1e-162
gb|AY751539.1|  Cloning vector pHUE, complete sequence                 585       1e-162
gb|AY370909.2|  Expression vector pAdEasy-1, complete sequence         585       1e-162
gb|AY159365.1|  Synthetic construct plasmid pSN6 alkaline phospha...   585       1e-162
gb|AF525446.1|  Expression vector pNB-13, complete sequence            585       1e-162
gb|AF525445.1|  Expression vector pETAT-12, complete sequence          585       1e-162
gb|AF525444.1|  Expression vector pETAT-11, complete sequence          585       1e-162
gb|AY042185.1|  Cloning vector pSB3616 alkaline phosphatase (phoA...   585       1e-162
gb|AF316555.1|AF316555  Cloning vector pXZ240, complete sequence       585       1e-162
gb|AF316554.1|AF316554  Cloning vector pJH391, complete sequence       585       1e-162
gb|AF316553.1|AF316553  Cloning vector pJH370, complete sequence       585       1e-162
gb|AF247169.1|AF247169  Expression vector pSB2991 alkaline phosph...   585       1e-162
gb|AF179892.1|AF179892  Cloning vector pLM3, complete sequence         585       1e-162
gb|AF169189.1|AF169189  Cloning vector pLS3, complete sequence         585       1e-162
gb|AF147464.1|AF147464  T7 expression vector pViet, complete sequ...   585       1e-162
gb|AF147463.1|AF147463  T7 Expression vector pNam, complete sequence   585       1e-162
gb|AF133437.1|AF133437  Cloning vector pCYPAC6, complete sequence      585       1e-162
gb|AF123770.1|AF123770  Shuttle vector pPAC-ResQ, complete sequence    585       1e-162
gb|AF087042.1|AF087042  Cloning vector pCALnFLAG, complete sequence    585       1e-162
emb|AJ224005.1|  Retroviral vector plasmid pSF1 (PSNEBH) DNA (515...   585       1e-162
emb|AJ224004.1|  Retroviral vector plasmid pSF1 (NBH) DNA (5138bp)     585       1e-162
gb|U86347.1|ECU86347  Expression vector pCal-n-ek complete sequence    585       1e-162
gb|U36453.1|CVU36453  Expression vector pCALkc, complete sequence      585       1e-162
gb|U36452.1|CVU36452  Expression vector pCALc, complete sequence       585       1e-162
gb|U36454.1|CVU36454  Expression vector pCALn, complete sequence       585       1e-162
gb|U09128.1|XXU09128  pSacBII P1 cloning vector with sacB, kilA, ...   585       1e-162
gb|U02436.1|XXU02436  Cloning vector rpSE937, complete sequence        585       1e-162
gb|JN704639.1|  Uncultured bacterium plasmid pMC2, complete sequence   583       5e-162
gb|JN400387.1|  Expression vector pMON82053, complete sequence         583       5e-162
gb|JN400386.1|  Expression vector pMON74532, complete sequence         583       5e-162
gb|JN400385.1|  Expression vector pMON100407, complete sequence        583       5e-162
gb|JN400384.1|  Expression vector pMON81312, complete sequence         583       5e-162
gb|JN400382.1|  Expression vector pMON98939, complete sequence         583       5e-162
gb|JN400381.1|  Expression vector pMON108080, complete sequence        583       5e-162
gb|JN204911.1|  Biobrick cloning vector BBa_96047, complete sequence   583       5e-162
gb|JN204910.1|  Biobrick cloning vector BBa_96046, complete sequence   583       5e-162
gb|JN204876.1|  Biobrick cloning vector BBa_J96007, complete sequ...   583       5e-162
gb|JN204875.1|  Biobrick cloning vector BBa_J96006, complete sequ...   583       5e-162
gb|JN204874.1|  Biobrick cloning vector BBa_J96005, complete sequ...   583       5e-162
gb|JN204873.1|  Biobrick cloning vector BBa_J96004, complete sequ...   583       5e-162
gb|JN204872.1|  Biobrick cloning vector BBa_J96003, complete sequ...   583       5e-162
gb|JN003423.1|  Escherichia coli strain AS MRE1009 TetC (tetC) ge...   583       5e-162
gb|JN201971.1|  Cloning vector pRR26, complete sequence                583       5e-162
gb|JN201960.1|  Cloning vector pRR25, complete sequence                583       5e-162
gb|JN201959.1|  Cloning vector pRR24, complete sequence                583       5e-162
gb|JN201958.1|  Cloning vector pRR22, complete sequence                583       5e-162
gb|JN201957.1|  Cloning vector pRR23, complete sequence                583       5e-162
gb|JN201956.1|  Cloning vector pRR21, complete sequence                583       5e-162
gb|JF796094.1|  Reporter gene-fusion vector pFU168, complete sequ...   583       5e-162
gb|JF327847.1|  Expression vector LIC-pDEST-LC2, complete sequence     583       5e-162
gb|JF327846.1|  Expression vector LIC-pDEST-LC1, complete sequence     583       5e-162
gb|JF420888.1|  Lux single copy cloning vector pMH33 luxCDABE ope...   583       5e-162
dbj|AB598835.1|  Expression plasmid pBAD-IEE DNA, complete sequence    583       5e-162
emb|FQ311454.1|  Sporisorium reilianum SRZ2 contig_5.00050 comple...   583       5e-162
gb|EU234497.1|  Cosmid vector pPIBTcosTET, complete sequence           583       5e-162
gb|HM219006.1|  Acinetobacter baumannii cloning vector pET-RA, co...   583       5e-162
gb|GU987054.1|  Salmonella enterica subsp. enterica serovar Typhi...   583       5e-162
gb|GU952842.1|  Cloning vector pAB34, complete sequence                583       5e-162
gb|GU952841.1|  Cloning vector pAB32, complete sequence                583       5e-162
gb|FJ389187.1|  Cloning vector pHC82, complete sequence                583       5e-162
gb|FJ389186.1|  Cloning vector pHC68, complete sequence                583       5e-162
gb|FJ389185.1|  Cloning vector pHC67, complete sequence                583       5e-162
gb|FJ389184.1|  Cloning vector pHC65, complete sequence                583       5e-162
gb|FJ389183.1|  Cloning vector pHC40, complete sequence                583       5e-162
gb|FJ389182.1|  Cloning vector pHC38, complete sequence                583       5e-162
gb|FJ389181.1|  Cloning vector pHC36, complete sequence                583       5e-162
dbj|AB526842.1|  Shuttle vector pAY201 DNA, complete sequence          583       5e-162
dbj|AB526841.1|  Shuttle vector pAY205 DNA, complete sequence          583       5e-162
gb|GQ438227.1|  Broad host range vector pBTBXh-4, complete sequence    583       5e-162
gb|GQ438221.1|  Broad host range vector pBMTBX-4, complete sequence    583       5e-162
gb|GQ438215.1|  Broad host range vector pBTBX-4, complete sequence     583       5e-162
gb|GQ371206.1|  Insertion vector pUTTnsTet, complete sequence          583       5e-162
gb|FJ391469.1|  Gateway entry vector pJM1, complete sequence           583       5e-162
gb|EU294195.1|  Cloning vector pSUP81-ZA, complete sequence            583       5e-162
dbj|AP009241.1|  Escherichia coli SE11 plasmid pSE11-1 DNA, compl...   583       5e-162
emb|FM209526.1|  Cloning vector pr8a                                   583       5e-162
emb|FM174471.1|  Cloning vector pRG930cm                               583       5e-162
gb|EU751613.1|  Escherichia coli strain AB041172 tetracycline res...   583       5e-162
gb|EU751612.1|  Escherichia coli strain AB061052 tetracycline res...   583       5e-162
gb|EU751611.1|  Escherichia coli strain RAC-053.1 tetracycline re...   583       5e-162
gb|EU751610.1|  Escherichia coli strain 423 tetracycline resistan...   583       5e-162
gb|EU530621.1|  Cloning vector pStartT2, complete sequence             583       5e-162
gb|EU284111.1|  Cloning vector pBB174, complete sequence               583       5e-162
gb|EU284110.1|  Cloning vector pBB173, complete sequence               583       5e-162
gb|EU284109.1|  Cloning vector pBB175, complete sequence               583       5e-162
gb|EU284108.1|  Cloning vector pCV12, complete sequence                583       5e-162
gb|EU284107.1|  Cloning vector pCV9, complete sequence                 583       5e-162
emb|AM921675.1|  Cloning vector PBAC-RT                                583       5e-162
gb|EU232662.1|  Cloning vector pVMGCRT85, complete sequence            583       5e-162
gb|EU118176.1|  Cloning vector pCM433, complete sequence               583       5e-162
emb|AM743197.2|  Escherichia sp. Sflu5 cryptic plasmid pAK51           583       5e-162
gb|EF456759.1|  Chimeric dengue virus type 1 vector p4(delta)30-D...   583       5e-162
gb|EF456758.1|  Chimeric dengue virus type 1 vector p4-D1L-CME, c...   583       5e-162
gb|EF456757.1|  Chimeric dengue virus type 1 vector p4(delta)30-D...   583       5e-162
gb|EF456756.1|  Chimeric dengue virus type 1 vector p4-D1-ME, com...   583       5e-162
gb|EF363313.1|  Promoter-trap vector pMW82, complete sequence          583       5e-162
gb|EF196094.1|  Shuttle cloning vector pDOJ4, complete sequence        583       5e-162
gb|DQ666283.1|  Cloning vector pRGK 367, complete sequence             583       5e-162
gb|DQ666282.1|  Cloning vector pRGK 366, complete sequence             583       5e-162
emb|AM411028.1|  Acinetobacter baylyi transgene for double kill g...   583       5e-162
gb|DQ517526.1|  Escherichia coli APEC O1 plasmid pAPEC-O1-R, comp...   583       5e-162
gb|DQ058742.1|  Broad host range vector pBTL-4, complete sequence      583       5e-162
gb|DQ058737.1|  Broad host range vector pBMTL-4, complete sequence     583       5e-162
gb|DQ058732.1|  Broad host range vector pBTB-4, complete sequence      583       5e-162
gb|DQ058727.1|  Broad host range vector pBMTB-4, complete sequence     583       5e-162
gb|DQ058722.1|  Broad host range vector pBT-4, complete sequence       583       5e-162
gb|DQ058717.1|  Broad host range vector pBMT-4, complete sequence      583       5e-162
gb|U25059.1|XXU25059  Cloning vector pBBR1MCS-3 REP and LacZ alph...   583       5e-162
gb|AY028776.1|  TnphoZ mutagenesis vector pMHL120, complete sequence   583       5e-162
gb|AY796342.1|  Cloning vector pBlueLysis, complete sequence           583       5e-162
gb|AY744150.1|  Dengue virus type 2 vector p4(delta30)-4995, comp...   583       5e-162
gb|AY744149.1|  Dengue virus type 2 vector p2(delta30), complete ...   583       5e-162
gb|AY744148.1|  Dengue virus type 2 vector p2, complete sequence       583       5e-162
gb|AY817672.1|  SIV vector pCLN8, complete sequence                    583       5e-162
gb|AF055345.1|  Francisella tularensi plasmid pOM1, complete sequ...   583       5e-162
gb|AY046276.1|  IncN plasmid R46, complete sequence                    583       5e-162
gb|AY043299.1|  Aeromonas salmonicida plasmid pRAS3.2, complete s...   583       5e-162
gb|AY428550.1|  Chlamydia suis strain R19 invasin-like protein ge...   583       5e-162
gb|AY428809.1|  Cloning vector pSUP202, complete sequence              583       5e-162
gb|AY303671.1|  Broad host range expression vector pMHE7Tc, compl...   583       5e-162
gb|AY303670.1|  Broad host range expression vector pMHE6Tc, compl...   583       5e-162
gb|AY299697.1|  Broad host range expression vector pMHE5Tc, compl...   583       5e-162
gb|AY299695.1|  Broad host range expression vector pMHE3Tc, compl...   583       5e-162
gb|AY093430.1|  Allelic exchange vector pCM351, complete sequence      583       5e-162
gb|AY093429.1|  Allelic exchange vector pCM184, complete sequence      583       5e-162
gb|AY428068.1|  Expression vector pKM265 complete sequence             583       5e-162
gb|AY428067.1|  Expression vector pKM264 complete sequence             583       5e-162
gb|AY428066.1|  Expression vector pKM263-2xHMK complete sequence       583       5e-162
gb|AY428065.1|  Expression vector pKM263-1xHMK complete sequence       583       5e-162
gb|AY428064.1|  Expression vector pKM263 complete sequence             583       5e-162
gb|AY428063.1|  Expression vector pKM260 complete sequence             583       5e-162
gb|AY230218.1|  Expression vector pDAS112 regulated promoter syst...   583       5e-162
gb|AY243469.1|  Chimeric Dengue virus vector p4(Delta30)-D2-CME, ...   583       5e-162
gb|AY243468.1|  Chimeric Dengue virus vector p4-D2-CME, complete ...   583       5e-162
gb|AY243467.1|  Chimeric Dengue virus vector p4(Delta30)-D2-ME, c...   583       5e-162
gb|AY243466.1|  Chimeric Dengue virus vector p4-D2-ME, complete s...   583       5e-162
gb|AY376438.1|  Dengue virus vector p4(Delta30), complete sequence     583       5e-162
gb|AF012911.1|  Plasmid pETHIS-1, complete sequence                    583       5e-162
gb|AY180162.1|  Shuttle vector pRHBR17, complete sequence              583       5e-162
gb|AY994192.1|  Cloning vector pSJS1472, complete sequence             583       5e-162
gb|AY289598.1|  Cloning vector pHRS-9, complete sequence               583       5e-162
emb|AM055747.1|  Acetobacter pasteurianus pAP2 plasmid, strain CC...   583       5e-162
gb|AF020539.1|  Shuttle vector pCRR1, complete sequence                583       5e-162
gb|M99569.1|SYNPWE15  sCos cloning vector SfiI containing bacteri...   583       5e-162
gb|J01749.1|SYNPBR322  Cloning vector pBR322, complete sequence        583       5e-162
gb|DQ012948.1|  Cloning vector pHR307a, complete sequence              583       5e-162
gb|AY739898.1|  Cloning vector pRGK336, complete sequence              583       5e-162
gb|AY739897.1|  Cloning vector pRGK335, complete sequence              583       5e-162
gb|AY785148.1|  Suicide plasmid pEE3, complete sequence                583       5e-162
emb|AJ639924.1|  Plasmid pB3 complete genome                           583       5e-162
dbj|AB117035.1|  Cloning vector pGETS109 DNA, complete sequence        583       5e-162
dbj|AB089598.1|  Gram-negative bacterium TA59 tetC gene, complete...   583       5e-162
dbj|AB089597.1|  Gram-negative bacterium TA58 tetC gene, complete...   583       5e-162
dbj|AB089596.1|  Gram-negative bacterium TA57 tetC gene, complete...   583       5e-162
gb|AY204705.1|  RNA transcription vector pBRDI2, complete sequence     583       5e-162
gb|AY204704.1|  RNA transcription vector pBRDI1, complete sequence     583       5e-162
gb|AF405698.1|  Reporter vector pVA838, complete sequence              583       5e-162
gb|AF405697.1|  Reporter vector pALH122, complete sequence             583       5e-162
gb|AF405696.1|  Reporter vector pALH109, complete sequence             583       5e-162
emb|AJ297913.2|  Plasmid pIPO2T, complete sequence                     583       5e-162
gb|AY003885.1|  Cloning vector pZR80, complete sequence                583       5e-162
gb|U73849.1|XXU73849  Synthetic transposon Tn5-OT182 carrier plas...   583       5e-162
emb|AJ006407.1|  Bacillus intermedius plasmid pET3xa-barn36, gene...   583       5e-162
gb|U00003.1|PIB8  pIB8 cosmid vector; complete sequence                583       5e-162
gb|DQ123820.1|  Shuttle vector pDOJHR, complete sequence               583       5e-162
gb|AY781401.1|  Synthetic construct transposon mini-Mu transposon...   583       5e-162
gb|AY781399.1|  Synthetic construct transposon mini-Mu transposon...   583       5e-162
gb|AY656170.1|  Dengue virus type 3 vector p3(delta30), complete ...   583       5e-162
gb|AY656169.1|  Dengue virus type 3 vector p3, complete sequence       583       5e-162
gb|AY656168.1|  Chimeric dengue virus vector p4(delta30)-D3L-ME, ...   583       5e-162
gb|AY656167.1|  Chimeric dengue virus vector p4-D3L-ME, complete ...   583       5e-162
gb|AY648301.1|  Dengue virus type 4 vector p4, complete sequence       583       5e-162
gb|AY167049.1|  Escherichia coli invasion plasmid pIS2, complete ...   583       5e-162
dbj|AB057644.1|  Shuttle vector pVA838 DNA, complete sequence          583       5e-162
emb|Y19114.1|  Escherichia coli partial plasmid tetC gene for tet...   583       5e-162
gb|AF134781.1|AF134781  Cloning vector YEP46 complete sequence         583       5e-162
gb|AF129432.2|AF129432  Cloning vector pJAH01, complete sequence       583       5e-162
gb|AF179893.1|AF179893  Cloning vector pLM53, complete sequence        583       5e-162
gb|AF108217.1|AF108217  Cloning vector pLM10, complete sequence        583       5e-162
gb|AF075573.1|AF075573  Cloning vector pWEB, complete sequence         583       5e-162
gb|U89928.1|CVU89928  Cloning vector pHISi-1, complete sequence        583       5e-162
gb|U89927.1|CVU89927  Cloning vector pHISi, complete sequence          583       5e-162
emb|X99274.1|  Artificial sequence DNA for expression vector pNGV1     583       5e-162
gb|U69267.1|IVU69267  Integration vector pSMB47 for Tn5251 and Tn...   583       5e-162
gb|U59231.1|CVU59231  Cloning vector cLHYGpk, complete sequence        583       5e-162
emb|X98612.1|  Artificial cloning vector pjb8                          583       5e-162
gb|U54830.1|SCU54830  Synthetic E. coli Tn3-derived transposon gr...   583       5e-162
gb|U54829.1|SCU54829  Synthetic E. coli Tn3-derived transposon OM...   583       5e-162
gb|U54828.1|SCU54828  Synthetic E. coli Tn3-derived transposon OM...   583       5e-162
gb|U46855.1|CVU46855  Cloning vector pAS1-tet tetracycline resist...   583       5e-162
dbj|D45834.1|SYNPKF339  Size marker plasmid pKF339 DNA, complete ...   583       5e-162
gb|U46780.1|SCU46780  Synthetic construct trap vector for isolati...   583       5e-162
gb|L76273.1|SYNHPH  Cloning vector pMLF2 hygromycin B phosphotran...   583       5e-162
emb|X95387.1|  Expression vector pKK233-3 containing origin of re...   583       5e-162
gb|U39286.1|CVU39286  Cloning vector TLF97-3, phage lambda lacZ t...   583       5e-162
gb|U39285.1|CVU39285  Cloning vector TLF97-2, phage lambda lacZ t...   583       5e-162
gb|U39284.1|CVU39284  Cloning vector TLF97-1, lambda phage lacZ t...   583       5e-162
emb|Z50149.1|  Artificial DNA for plasmid pMin2                        583       5e-162
emb|Z50148.1|  Artificial DNA for plasmid pMin1                        583       5e-162
gb|U37692.1|CVU37692  Cloning vector lambda TXF97, lacZ transcrip...   583       5e-162
gb|U32311.1|CVU32311  Cloning vector pOTSf1Blu, complete sequence      583       5e-162
gb|U22104.1|SCU22104  Cloning vector pAComegaGm, complete sequenc...   583       5e-162
gb|U13868.1|XXU13868  pSVL cloning vector, complete sequence           583       5e-162
gb|U13863.1|XXU13863  pPL-Lambda cloning vector, complete sequence     583       5e-162
gb|U13862.1|XXU13862  pNEO cloning vector, complete sequence           583       5e-162
gb|U13846.1|XXU13846  pCM7 cloning vector, complete sequence           583       5e-162
gb|U13843.1|XXU13843  pBPV cloning vector, complete sequence           583       5e-162
gb|U13206.1|XXU13206  Cloning vector pCOS5, complete sequence          583       5e-162
gb|U07340.1|U07340  Cosmid vector pTL5, complete sequence              583       5e-162
gb|L20318.1|SYNPETHISK  pET-HisK expression vector (from E. coli)...   583       5e-162
gb|L20317.1|SYNPETHIS  pET-His expression vector (from E. coli) D...   583       5e-162
gb|U03461.1|U03461  Cloning vector pDO19, complete sequence            583       5e-162
gb|U03460.1|U03460  Cloning vector pDO184, complete sequence           583       5e-162
gb|U03459.1|U03459  Cloning vector pDO17, complete sequence            583       5e-162
gb|U03501.1|YRP7  Yeast replicating vector YRp7, complete sequence     583       5e-162
gb|U03499.1|YEP213  Yeast episomal vector YEp213, complete sequence    583       5e-162
gb|U03498.1|YEP13  Yeast episomal vector YEp13, complete sequence      583       5e-162
gb|U03497.1|PBM272  Yeast centromere vector pBM272 with inducible...   583       5e-162
gb|U02444.1|U02444  Cloning vector pKK388-1, complete sequence         583       5e-162
gb|U02439.1|XXU02439  Cloning vector pKK233-2, complete sequence       583       5e-162
gb|U02429.1|XXU02429  Cloning vector pEUK-C1, complete sequence        583       5e-162
emb|X70276.1|  Yeast centromere-containing shuttle vector YCp50        583       5e-162
gb|U01086.1|XXU01086  Cloning vector pYAC4 for artificial chromos...   583       5e-162
emb|X70478.1|  Plasmid pKK233-2 expression vector (from Pharmacia)     583       5e-162
gb|L09157.1|SYNYIP5V  YIp5 yeast integrating plasmid                   583       5e-162
gb|L09156.1|SYNYEP24V  YEp24 yeast extrachromosomal plasmid            583       5e-162
gb|L09158.1|SYNTRP17V  YRp17 yeast replicating plasmid                 583       5e-162
gb|L19900.1|SYNSVPHEP  Cloning vector cosmid svPHEP DNA sequence ...   583       5e-162
gb|L09155.1|SYNPWT571V  pWT571 expression vector                       583       5e-162
gb|L09154.1|SYNPWT551V  pWT551 expression vector                       583       5e-162
gb|L09153.1|SYNPWT511V  pWT511 expression vector                       583       5e-162
gb|L09152.1|SYNPV34V  pV34 cosmid cloning vector                       583       5e-162
gb|L08955.1|SYNPTRS3V  pTrS3 cloning vector with E.coli trp promo...   583       5e-162
gb|L08936.1|SYNPMC1871  pMC1871 cloning vector                         583       5e-162
gb|L08935.1|SYNPMC1511  pMC1511 cloning vector                         583       5e-162
gb|L08929.1|SYNPLBU3V  pLBU3 cloning vector for cloning strong pr...   583       5e-162
gb|L08928.1|SYNPKTH606  pKTH606 cloning vector                         583       5e-162
gb|L08927.1|SYNPKTH605  pKTH605 cloning vector                         583       5e-162
gb|L08926.1|SYNPKTH604  pKTH604 cloning vector                         583       5e-162
gb|L08925.1|SYNPKTH601  pKTH601 cloning vector                         583       5e-162
gb|L08873.1|SYNPHC79V  pHC79 cosmid cloning vector                     583       5e-162
gb|L08859.1|SYNPBR329V  pBR329 cloning vector                          583       5e-162
gb|L08858.1|SYNPBR328V  pBR328 cloning vector                          583       5e-162
gb|L08856.1|SYNPBR327V  pBR327 cloning vector                          583       5e-162
gb|L08857.1|SYNPBR327P  pBR327par cloning vector (more stable der...   583       5e-162
gb|L08855.1|SYNPBR325V  pBR325 cloning vector                          583       5e-162
gb|L08853.1|SYNPAT153V  pAT153 cloning vector                          583       5e-162
gb|L08817.1|SYNPAA37XV  pAA3.7X cloning vector                         583       5e-162
gb|L08919.1|SYNJRD158V  pJRD158 cloning vector                         583       5e-162
gb|L19899.1|SYNCVPTCF  Cloning vector cosmid pTCF DNA sequence en...   583       5e-162
dbj|D13251.1|SYNPLGLACZ  Unidentified cloning vector pLGlacz7 DNA      583       5e-162
gb|M77749.1|SYNPKK223V  pKK223-3 cloning vector from PL-Pharmacia      583       5e-162
gb|M98046.1|SYNPCS19X  pCS19 Cloning vector (URA3) gene, (cI) gen...   583       5e-162
gb|J01753.1|SYNPBR329  Plasmid pBR329, complete genome                 583       5e-162
gb|M88537.1|SYNCOLCTAP  Expression cloning vector pNP6Col-CTAP co...   583       5e-162
gb|M88538.1|SYNCLCTAPS  Expression cloning vector pNP6CRMCTAP col...   583       5e-162
gb|M88539.1|SYNCLCTAPA  Expression cloning vector pNP6CTAP colici...   583       5e-162
gb|M20189.1|SYNAA113M  Sequencing vector pAA113M DNA                   583       5e-162
gb|M11320.1|PLMCG  Plasmid pAA3.7X from E.coli, complete genome        583       5e-162
emb|X01453.1|  Plasmid vector pJRD158 DNA sequence                     583       5e-162
emb|X06403.1|  Cloning vector pACYC184                                 583       5e-162
emb|V00083.1|  Artificial cloning vehicle pBR327, derived from pB...   583       5e-162
emb|X01654.1|  Salmonella low copy number plasmid pSC101               583       5e-162
gb|EU603327.1|  Escherichia-Pseudomonas shuttle vector pHERD26T, ...   581       2e-161
gb|EU332348.1|  Cloning vector pEX18Tc-pheS, complete sequence         581       2e-161
gb|EU250578.1|  Broad host range reporter vector pMJ445, complete...   581       2e-161
gb|EU186086.1|  Binary vector pCLEAN-S167, complete sequence           581       2e-161
gb|EU186085.1|  Binary vector pCLEAN-S161, complete sequence           581       2e-161
gb|EU048870.1|  Cloning vector pSoup, complete sequence                581       2e-161
gb|EU024546.1|  Cloning vector pCPP5702, complete sequence             581       2e-161
gb|DQ230318.1|  Shuttle/allelic-replacement vector pMQ83, complet...   581       2e-161
gb|AF251497.1|  Cloning vector HKBS1, complete sequence                581       2e-161
gb|AF140579.1|  Integration vector mini-CTX-lacZ, complete sequence    581       2e-161
gb|AF140578.1|  Integration vector mini-CTX-GFP, complete sequence     581       2e-161
gb|AF140577.1|  Integration vector mini-CTX2, complete sequence        581       2e-161
gb|AF140576.1|  Integration vector mini-CTX1, complete sequence        581       2e-161
gb|AF047519.1|  Cloning vector pEX18Tc, complete sequence              581       2e-161
gb|AY364166.1|  Transposon delivery vector pUT-miniTn5-gfp-tet, c...   581       2e-161
gb|AY652437.1|  Promoter-probe vector pXH203, complete sequence        581       2e-161
gb|DQ119286.1|  Expression vector pBAD322T, complete sequence          581       2e-161
gb|AF438204.1|  Positive selection vector pMTet1, complete sequence    581       2e-161
gb|U07168.1|U07168  Cloning vector pUCP26, Escherichia-Pseudomona...   581       2e-161
gb|AY712950.1|  Tetracycline resistance FRT vector pFTC1, complet...   581       2e-161
gb|AY597273.1|  Flp expression vector pFLP3, complete sequence         581       2e-161
gb|AY237646.1|  Cloning vector pHRGFPTC, complete sequence             581       2e-161
emb|AJ302086.1|  Synthetic construct for alkane-responsive expres...   581       2e-161
emb|AJ272004.1|  Cloning vector pPW78                                  581       2e-161
gb|AF169190.1|AF169190  Cloning vector pLS13, complete sequence        581       2e-161
gb|AF062082.1|AF062082  Cloning vector p34S-Tc, complete sequence      581       2e-161
gb|AF061928.1|AF061928  Plasposon pTnMod-Cm'OTc, complete sequence     581       2e-161
gb|AF061927.1|AF061927  Plasposon pTnMod-CmOTc, complete sequence      581       2e-161
gb|AF061925.1|AF061925  Plasposon pTnMod-OTc', complete sequence       581       2e-161
gb|AF061924.1|AF061924  Plasposon pTnMod-OTc, complete sequence        581       2e-161
gb|AF035682.1|  Cloning vector pLG338/30, complete sequence            581       2e-161
gb|U17139.1|CVPSIT  Phagemid cloning vector pSIT, complete sequence    581       2e-161
emb|AJ223123.1|  Artificial DNA; cloning vector pIN-III-ompA3          580       6e-161
emb|AJ223122.1|  Artificial DNA; cloning vector pIN-III-ompA2          580       6e-161
emb|AJ223121.1|  Artificial DNA; cloning vector pIN-III-ompA1          580       6e-161
emb|AJ223120.1|  Artificial DNA; cloning vector pNIV212                580       6e-161
emb|AJ223119.1|  Artificial DNA; cloning vector pNIV145                580       6e-161
emb|AJ223118.1|  Artificial DNA; cloning vector pIN-III-ompA-HinD      580       6e-161
emb|AJ223117.1|  Artificial DNA; cloning vector pNIV144                580       6e-161
emb|AJ223116.1|  Artificial DNA; cloning vector pNIV143                580       6e-161
emb|AJ223115.1|  Artificial DNA; cloning vector pNIV136                580       6e-161
gb|U52109.1|CVU52109  Cloning vector pLK-neo DNA                       580       6e-161
gb|U40578.1|CVU40578  Cloning vector pOR262, pINIIIompA3-rat P450...   580       6e-161
gb|U40577.1|CVU40577  Secretion-expression vector pINIIIompA3, co...   580       6e-161
dbj|AB545980.1|  Cloning vector pTip-istAB-sacB DNA, complete seq...   578       2e-160
gb|EF133466.1|  Cloning vector pKOS405-159, complete sequence          578       2e-160
dbj|AB127605.1|  Expression vector pNit-RT2 DNA, complete sequence     578       2e-160
dbj|AB127604.1|  Expression vector pNit-RT1 DNA, complete sequence     578       2e-160
dbj|AB127601.1|  Expression vector pNit-QT2 DNA, complete sequence     578       2e-160
dbj|AB127600.1|  Expression vector pNit-QT1 DNA, complete sequence     578       2e-160
dbj|AB127597.1|  Expression vector pTip-RT2 DNA, complete sequence     578       2e-160
dbj|AB127596.1|  Expression vector pTip-RT1 DNA, complete sequence     578       2e-160
dbj|AB127593.1|  Expression vector pTip-QT2 DNA, complete sequence     578       2e-160
dbj|AB127592.1|  Expression vector pTip-QT1 DNA, complete sequence     578       2e-160
dbj|AB094126.1|  Expression vector pTip-LCH2 DNA, complete sequence    578       2e-160
dbj|AB094125.1|  Expression vector pTip-LNH2 DNA, complete sequence    578       2e-160
dbj|AB094070.1|  Expression vector pTip-LCH1 DNA, complete sequence    578       2e-160
dbj|AB094069.1|  Expression vector pTip-LNH1 DNA, complete sequence    578       2e-160
dbj|AB094068.1|  Expression vector pTip-CH2 DNA, complete sequence     578       2e-160
dbj|AB094067.1|  Expression vector pTip-NH2 DNA, complete sequence     578       2e-160
dbj|AB094066.1|  Expression vector pTip-CH1 DNA, complete sequence     578       2e-160
dbj|AB094065.1|  Expression vector pTip-NH1 DNA, complete sequence     578       2e-160
gb|HQ624982.1|  Shuttle vector pRMU824Tc, complete sequence            576       7e-160
gb|EU825945.1|  Reporter vector pMK2030, complete sequence             576       7e-160
emb|AM295100.1|  Acetobacter pasteurianus pAP4 plasmid, type stra...   576       7e-160
gb|DQ823233.1|  Expression vector mce4, complete sequence              576       7e-160
gb|DQ823232.1|  Expression vector mce3, complete sequence              576       7e-160
gb|DQ823231.1|  Expression vector mce2, complete sequence              576       7e-160
gb|AY423865.1|  Cloning vector pMK2017, complete sequence              576       7e-160
gb|AF521666.1|  Cloning vector pLOI2065 complete sequence              576       7e-160
gb|AF361441.1|AF361441  Cloning vector pTRG, complete sequence         576       7e-160
gb|U47103.2|CVU47103  Cloning vector pALTER<R>-Ex2, complete sequ...   576       7e-160
gb|U47102.2|CVU47102  Cloning vector pALTER<R>-Ex1, complete sequ...   576       7e-160
gb|DQ157769.1|  Allelic exchange vector pJK100, complete sequence      576       7e-160
emb|X65334.2|  Cloning vector pALTER(R)-1                              576       7e-160
gb|U35135.1|XXU35135  Plasmid pBSL193 cloning vector, complete se...   576       7e-160
gb|U35134.1|XXU35134  Plasmid pBSL190 cloning vector, complete se...   576       7e-160
emb|Z12112.1|  pWE15A cosmid vector DNA                                576       7e-160
emb|X65279.1|  pWE15 cosmid vector DNA                                 576       7e-160
gb|FJ158001.1|  Uncultured bacterium clone 2 tetracycline resista...   574       3e-159
gb|DQ882849.1|  Cloning vector pYESW29' Escherichia-Saccharomyces...   569       1e-157
gb|AY428551.1|  Chlamydia suis strain R27 tetR(C)-invasin fusion ...   569       1e-157
gb|AF016889.1|AF016889  Cloning vector pWSK29, complete sequence       569       1e-157
  AEAS01000168  Kluyveromyces aestuarii ATCC 18862 contig00181, w...   558       2e-154
  KLAEg2394 KLAEg2394 undefined product 5057548:5058951 forward        558       2e-154
gb|HQ333266.1|  Escherichia coli strain A21 tetracycline resistan...   554       2e-153
gb|DQ205473.1|  Salmonella typhimurium strain SLPS1-1 tetracyclin...   554       2e-153
gb|AY043298.1|  Aeromonas salmonicida subsp. salmonicida plasmid ...   551       3e-152
gb|EU496104.1|  BioBrick cloning vector pSB3T5-I52001, complete s...   540       5e-149
gb|EU496101.1|  BioBrick cloning vector pSB4T5-I52001, complete s...   540       5e-149
gb|EU496095.1|  Synthetic construct tetracycline resistance prote...   540       5e-149
gb|HQ399583.1|  Uncultured bacterium clone C48 tetracycline resis...   536       7e-148
gb|HQ399581.1|  Uncultured bacterium clone C37 tetracycline resis...   536       7e-148
gb|HQ399584.1|  Uncultured bacterium clone C74 tetracycline resis...   531       3e-146
gb|HQ399582.1|  Uncultured bacterium clone C45 tetracycline resis...   531       3e-146
gb|HQ399580.1|  Uncultured bacterium clone C34 tetracycline resis...   531       3e-146
gb|HQ399578.1|  Uncultured bacterium clone C27 tetracycline resis...   531       3e-146
gb|HQ399579.1|  Uncultured bacterium clone C28 tetracycline resis...   531       3e-146
gb|HQ399577.1|  Uncultured bacterium clone C19 tetracycline resis...   531       3e-146
gb|HQ399576.1|  Uncultured bacterium clone C12 tetracycline resis...   531       3e-146
gb|HQ399575.1|  Uncultured bacterium clone C8 tetracycline resist...   531       3e-146
gb|HQ399573.1|  Uncultured bacterium clone C5 tetracycline resist...   531       3e-146
gb|HQ399574.1|  Uncultured bacterium clone C6 tetracycline resist...   531       3e-146
gb|JN792439.1|  Expression vector pNIC-Bio3 plasmid pNIC-Bio3, co...   529       1e-145
gb|JF912192.1|  Expression vector pNIC-H102, complete sequence         529       1e-145
gb|JF912191.1|  Expression vector pNIC-Bio2, complete sequence         529       1e-145
gb|JF522100.1|  Cloning vector pGTVL2, complete sequence               529       1e-145
gb|GU725055.1|  Bacterial expression vector pBEN1-SGC, complete s...   529       1e-145
emb|FN677494.1|  Cloning vector pNIC-NHS                               529       1e-145
gb|GU452710.1|  Expression vector pNIC-ZB, complete sequence           529       1e-145
gb|GU269914.1|  Expression vector pNH-TrxT, complete sequence          529       1e-145
gb|FJ545754.1|  Expression vector RHP-AmpS, complete sequence          529       1e-145
gb|EU862244.1|  Burkholderia replicative vector pMo168, complete ...   529       1e-145
gb|EU862243.1|  Burkholderia suicide vector pMo130, complete sequ...   529       1e-145
gb|EU680847.1|  Expression vector p0GWA, complete sequence             529       1e-145
gb|EU680846.1|  Expression vector pXGWA, complete sequence             529       1e-145
gb|EU680845.1|  Expression vector pNGWA, complete sequence             529       1e-145
gb|EU680844.1|  Expression vector pMGWA, complete sequence             529       1e-145
gb|EU680843.1|  Expression vector pHXGWA, complete sequence            529       1e-145
gb|EU680842.1|  Expression vector pHNGWA, complete sequence            529       1e-145
gb|EU680841.1|  Expression vector pHMGWA, complete sequence            529       1e-145
gb|EU680840.1|  Expression vector pHGWA, complete sequence             529       1e-145
gb|EU680839.1|  Expression vector pHGGWA, complete sequence            529       1e-145
gb|EU680838.1|  Expression vector pGGWA, complete sequence             529       1e-145
gb|EU337983.1|  Expression vector pKLD116, complete sequence           529       1e-145
gb|EU337982.1|  Expression vector pKLD66, complete sequence            529       1e-145
gb|EU337981.1|  Expression vector pTEV5, complete sequence             529       1e-145
gb|EU337980.1|  Expression vector pTEV3, complete sequence             529       1e-145
gb|EU337979.1|  Expression vector pTEV4, complete sequence             529       1e-145
gb|EF550209.1|  Cloning vector pET21b+PA, complete sequence            529       1e-145
gb|EF442786.1|  Expression vector pET32a-LIC, complete sequence        529       1e-145
gb|EF442785.1|  Expression vector pET28a-LIC, complete sequence        529       1e-145
gb|EF456739.1|  Expression vector pET28GST-LIC, complete sequence      529       1e-145
gb|EF456737.1|  Expression vector pET21a-LIC, complete sequence        529       1e-145
gb|EF456735.1|  Expression vector pET28-MHL, complete sequence         529       1e-145
gb|EF205334.1|  Expression vector pETS2SUL, complete sequence          529       1e-145
gb|EF205333.1|  Expression vector pETHSUL, complete sequence           529       1e-145
gb|EF199845.1|  Expression vector pNIC-NHT-CF, complete sequence       529       1e-145
gb|EF199844.1|  Expression vector pNIC-CTHF, complete sequence         529       1e-145
gb|EF199843.1|  Expression vector pNIC-CH, complete sequence           529       1e-145
gb|EF198106.1|  Expression vector pNIC28-Bsa4, complete sequence       529       1e-145
gb|AY033554.1|  Fusion protein expression vector pTAG2K, complete...   529       1e-145
gb|AF117644.1|AF117644  Expression vector pH911, complete sequence     529       1e-145
gb|AF116269.1|AF116269  Expression vector p864INS, complete sequence   529       1e-145
dbj|AB161698.1|  Expression vector pCop-F2 DNA, complete sequence      529       1e-145
dbj|AB161697.1|  Expression vector pCop-F1 DNA, complete sequence      529       1e-145
dbj|AB161696.1|  Expression vector pCop-H2 DNA, complete sequence      529       1e-145
dbj|AB161695.1|  Expression vector pCop-H1 DNA, complete sequence      529       1e-145
gb|AF525443.1|  Expression vector pNB-3, complete sequence             529       1e-145
gb|AF525442.1|  Expression vector pETAT-2, complete sequence           529       1e-145
gb|AF525441.1|  Expression vector pETAT-1, complete sequence           529       1e-145
gb|AF533984.1|  Cloning vector pIA423, complete sequence               529       1e-145
gb|AF117645.1|AF117645  Expression vector p892INS, complete sequence   529       1e-145
gb|AF097413.1|AF097413  Expression vector pHIS-parallel1, complet...   529       1e-145
gb|AF055298.1|AF055298  Expression vector pPK121, complete sequence    529       1e-145
gb|U16722.1|XXU16722  Cloning vector pLACT7, complete sequence         529       1e-145
gb|AY569780.1|  Cloning vector pTCCR-Auto, complete sequence           524       4e-144
gb|AY569779.1|  Cloning vector pTCCR, complete sequence                524       4e-144
emb|Z32692.1|  Expression vector pT7T7 DNA                             524       4e-144
emb|Z32691.1|  Expression vector pT7T7/T7hGH DNA, strain HM174         524       4e-144
gb|DQ504436.1|  Expression vector pT7MT, complete sequence             520       5e-143
gb|U51558.1|EVU51558  Expression vector pEXT22, complete sequence      520       5e-143
gb|U51557.1|EVU51557  Expression vector pEXT20, complete sequence      520       5e-143
gb|U51556.1|EVU51556  Expression vector pACT3, complete sequence       520       5e-143
gb|DQ910311.1|  Serratia sp. PH-P2-27 TetC (tetC) gene, partial cds    518       2e-142
gb|FJ950709.1|  Pseudomonas sp. c163 tetracycline resistance prot...   517       6e-142
gb|FJ950707.1|  Stenotrophomonas maltophilia strain c115 tetracyc...   515       2e-141
emb|AL010273.1|  Plasmodium falciparum DNA *** SEQUENCING IN PROG...   513       7e-141
gb|HQ333265.1|  Escherichia coli strain G8 tetracycline resistanc...   497       6e-136
emb|X78991.1|  S.cerevisiae (S288C) PRE3 gene                          430       7e-116
gb|CP002504.1|  Eremothecium cymbalariae DBVPG#7215 chromosome 8,...   414       5e-111
gb|DQ478715.1|  Escherichia coli strain TT-11 plasmid KE4 class C...   376       1e-99 
gb|DQ316137.1|  Pseudomonas sp. SO-A5-26 oxytetracycline resistan...   376       1e-99 
gb|HM371191.1|  Bacterium QC5 tetracycline-resistance protein C (...   322       3e-83 
emb|Z96748.1|  H.sapiens telomeric DNA sequence, clone 8QTEL004, ...   311       5e-80 
emb|Z96159.1|  H.sapiens telomeric DNA sequence, clone 10PTEL063,...   300       9e-77 
gb|AY171578.1|  Uncultured bacterium clone BC-AC-3 putative tetra...   271       4e-68 
gb|AF519766.1|  Cloning vector pMAK705, complete sequence              262       2e-65 
gb|AE016817.6|  Ashbya gossypii ATCC 10895 chromosome IV, complet...   250       1e-61 
ref|NM_209687.1|  Ashbya gossypii ATCC 10895 ADR238Cp (AGOS_ADR23...   250       1e-61 
gb|U13186.1|CVU13186  Cloning vector pbetagal-Control, complete s...   239       2e-58 
gb|U13185.1|CVU13185  Cloning vector pbetagal-Enhancer, complete ...   239       2e-58 
gb|HQ425563.1|  Reporter vector pFila, complete sequence               237       9e-58 
gb|HQ644137.1|  Mammalian expression vector pCK146, complete sequ...   237       9e-58 


>emb|X06997.1| Kluyveromyces lactis LAC12 gene for lactose permease
Length=7127

 Score = 1.285e+04 bits (14254),  Expect = 0.0
 Identities = 7127/7127 (100%), Gaps = 0/7127 (0%)
 Strand=Plus/Plus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420

Query  421   CCCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGG  480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421   CCCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGG  480

Query  481   TATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGT  540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481   TATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGT  540

Query  541   GACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACA  600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  541   GACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACA  600

Query  601   TGGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCA  660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  601   TGGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCA  660

Query  661   AAGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCT  720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  661   AAGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCT  720

Query  721   AGCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCG  780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  721   AGCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCG  780

Query  781   AACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCA  840
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  781   AACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCA  840

Query  841   CAGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGA  900
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  841   CAGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGA  900

Query  901   CAGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAAC  960
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  901   CAGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAAC  960

Query  961   CAGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGA  1020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  961   CAGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGA  1020

Query  1021  AAAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTA  1080
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1021  AAAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTA  1080

Query  1081  GTATCGTCATTTAATTTTTTTTGGAATTGGCAAGTTACCTGCGTGGCTCTATACCGAATG  1140
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1081  GTATCGTCATTTAATTTTTTTTGGAATTGGCAAGTTACCTGCGTGGCTCTATACCGAATG  1140

Query  1141  AACCCCGACCCTGGCCGTTCGGTGCACCGAGCGCGTTTACGTGTGTACACGCTTTTGTAA  1200
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1141  AACCCCGACCCTGGCCGTTCGGTGCACCGAGCGCGTTTACGTGTGTACACGCTTTTGTAA  1200

Query  1201  GAAAGAAACTCGGGTCTGCGTGGGCCTGCAACGTGACTTAGCAATACCCGCGCGTCAGAT  1260
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1201  GAAAGAAACTCGGGTCTGCGTGGGCCTGCAACGTGACTTAGCAATACCCGCGCGTCAGAT  1260

Query  1261  TTAACATATTCGGGATTCTTCCCTCCGTACTAGAAAGTTGACAATAAGATGTCCATACTG  1320
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1261  TTAACATATTCGGGATTCTTCCCTCCGTACTAGAAAGTTGACAATAAGATGTCCATACTG  1320

Query  1321  TTGTTGATACCTTGCTACTCTAGCTCATTATGACAAGGACAATCGGTTAATTGGAGGTCT  1380
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1321  TTGTTGATACCTTGCTACTCTAGCTCATTATGACAAGGACAATCGGTTAATTGGAGGTCT  1380

Query  1381  AAATGGTGTATCAAGGTATATAAAGGCAGTAACTTTCAATGTTGAGTTGGGCTGTAGTTC  1440
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1381  AAATGGTGTATCAAGGTATATAAAGGCAGTAACTTTCAATGTTGAGTTGGGCTGTAGTTC  1440

Query  1441  AAGGTGGTTGTAGCTTCTGGAACATATATATGCTATTCAATATAGCTGGAAAGTGTAAGC  1500
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1441  AAGGTGGTTGTAGCTTCTGGAACATATATATGCTATTCAATATAGCTGGAAAGTGTAAGC  1500

Query  1501  TAAACAGCAAACAAAAGTCTCTGTGTGTTGTCTTATAATTATATCCTTCAGTCAGTGTTA  1560
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1501  TAAACAGCAAACAAAAGTCTCTGTGTGTTGTCTTATAATTATATCCTTCAGTCAGTGTTA  1560

Query  1561  ATGATTAAAGACAGAATTACGAAAAAATAAAACAAGACGATAATCAGTTTTCAAAATGGC  1620
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1561  ATGATTAAAGACAGAATTACGAAAAAATAAAACAAGACGATAATCAGTTTTCAAAATGGC  1620

Query  1621  AGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAGCATAA  1680
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1621  AGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAGCATAA  1680

Query  1681  AGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGATAATAC  1740
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1681  AGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGATAATAC  1740

Query  1741  TTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTCTTACC  1800
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1741  TTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTCTTACC  1800

Query  1801  AGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTG  1860
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1801  AGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTG  1860

Query  1861  TGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATA  1920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1861  TGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATA  1920

Query  1921  TTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTAT  1980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1921  TTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTAT  1980

Query  1981  TTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAG  2040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1981  TTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAG  2040

Query  2041  AAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTT  2100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2041  AAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTT  2100

Query  2101  AACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAAT  2160
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2101  AACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAAT  2160

Query  2161  CGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAA  2220
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2161  CGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAA  2220

Query  2221  GGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCAC  2280
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2221  GGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCAC  2280

Query  2281  TTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTT  2340
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2281  TTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTT  2340

Query  2341  ACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAG  2400
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2341  ACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAG  2400

Query  2401  ATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTT  2460
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2401  ATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTT  2460

Query  2461  AAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTT  2520
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2461  AAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTT  2520

Query  2521  CCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAAC  2580
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2521  CCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAAC  2580

Query  2581  GAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTC  2640
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2581  GAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTC  2640

Query  2641  CGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAG  2700
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2641  CGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAG  2700

Query  2701  TGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAAT  2760
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2701  TGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAAT  2760

Query  2761  TTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTC  2820
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2761  TTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTC  2820

Query  2821  AGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAA  2880
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2821  AGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAA  2880

Query  2881  GAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTC  2940
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2881  GAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTC  2940

Query  2941  TTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAG  3000
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2941  TTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAG  3000

Query  3001  ATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATT  3060
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3001  ATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATT  3060

Query  3061  TGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTT  3120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3061  TGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTT  3120

Query  3121  CGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTT  3180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3121  CGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTT  3180

Query  3181  AGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGATCAAGC  3240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3181  AGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGATCAAGC  3240

Query  3241  ATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAATGC  3300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3241  ATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAATGC  3300

Query  3301  TCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTTTC  3360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3301  TCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTTTC  3360

Query  3361  AGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTTTC  3420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3361  AGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTTTC  3420

Query  3421  CGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGTCT  3480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3421  CGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGTCT  3480

Query  3481  TGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAACAG  3540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3481  TGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAACAG  3540

Query  3541  TTACTGTTAGACGTTAGCACATGGGCCGGTATGTCATTGAAGTACGTTTAAATTGCCTGA  3600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3541  TTACTGTTAGACGTTAGCACATGGGCCGGTATGTCATTGAAGTACGTTTAAATTGCCTGA  3600

Query  3601  ATTGGGAAAAGTATTGACCTTTGAGCCGGTTGCATACCGCCTTGCGGTATGCAGTTTGGC  3660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3601  ATTGGGAAAAGTATTGACCTTTGAGCCGGTTGCATACCGCCTTGCGGTATGCAGTTTGGC  3660

Query  3661  TCGGTTTTCCCAGCACGCATGTGGGCATCATTTCCACACGTGTGAACCCTCGGCAGTTAA  3720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3661  TCGGTTTTCCCAGCACGCATGTGGGCATCATTTCCACACGTGTGAACCCTCGGCAGTTAA  3720

Query  3721  ATGTGTGCATTTAGGATCGGCTAATAGTTGTTTTTAGCTTCAGCTTCAGCTCATCGGATT  3780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3721  ATGTGTGCATTTAGGATCGGCTAATAGTTGTTTTTAGCTTCAGCTTCAGCTCATCGGATT  3780

Query  3781  TTGTGAAACATATAAATCTGGCGTCAATTGAGTCTCTCGAATGGTTGAAAGGTCAATTCA  3840
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3781  TTGTGAAACATATAAATCTGGCGTCAATTGAGTCTCTCGAATGGTTGAAAGGTCAATTCA  3840

Query  3841  GGTTGGAATTTTGTATTATGTTAGCTATATGGGATTGATCAAAAAAACCAGCCAAGGATT  3900
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3841  GGTTGGAATTTTGTATTATGTTAGCTATATGGGATTGATCAAAAAAACCAGCCAAGGATT  3900

Query  3901  CAGAGAATTACAGCGCAAGCTCAGGTAGCACTCCAGTTTTAAACATAAAAAATGAAATTC  3960
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3901  CAGAGAATTACAGCGCAAGCTCAGGTAGCACTCCAGTTTTAAACATAAAAAATGAAATTC  3960

Query  3961  TCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACCGTCAGTGCT  4020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3961  TCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACCGTCAGTGCT  4020

Query  4021  AACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGTTTGAGTGAA  4080
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4021  AACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGTTTGAGTGAA  4080

Query  4081  ATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTCGAAGGTGCC  4140
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4081  ATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTCGAAGGTGCC  4140

Query  4141  GCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAGGCTGCTGGT  4200
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4141  GCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAGGCTGCTGGT  4200

Query  4201  GATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTACTGGGCTTTG  4260
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4201  GATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTACTGGGCTTTG  4260

Query  4261  ACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTCGCCTTGGAT  4320
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4261  ACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTCGCCTTGGAT  4320

Query  4321  GATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTGTTGGACACT  4380
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4321  GATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTGTTGGACACT  4380

Query  4381  AAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTCCAAGGTATG  4440
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4381  AAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTCCAAGGTATG  4440

Query  4441  AACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAACCCATTGATT  4500
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4441  AACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAACCCATTGATT  4500

Query  4501  TTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAACTTTGAAGAT  4560
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4501  TTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAACTTTGAAGAT  4560

Query  4561  TTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACTCCAAATATG  4620
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4561  TTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACTCCAAATATG  4620

Query  4621  ACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAGGACTTCTTG  4680
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4621  ACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAGGACTTCTTG  4680

Query  4681  GCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTGACCTTCGAT  4740
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4681  GCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTGACCTTCGAT  4740

Query  4741  GAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGTGGCGTTATC  4800
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4741  GAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGTGGCGTTATC  4800

Query  4801  CCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCTCAATTGGCT  4860
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4801  CCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCTCAATTGGCT  4860

Query  4861  AGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGACGCCAATGTT  4920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4861  AGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGACGCCAATGTT  4920

Query  4921  TTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACCACTTACATG  4980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4921  TTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACCACTTACATG  4980

Query  4981  ATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCAGCTCCAAAT  5040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4981  ATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCAGCTCCAAAT  5040

Query  5041  GTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAAACTTGGGAA  5100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5041  GTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAAACTTGGGAA  5100

Query  5101  GATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACTACCGTTTCT  5160
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5101  GATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACTACCGTTTCT  5160

Query  5161  GCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAGTGCTGATGA  5220
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5161  GCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAGTGCTGATGA  5220

Query  5221  AACTAGTGCTACCGCTACATCTTCTTCCAACAGCACTTCTGCTGAAACTTTAAGCTCTTC  5280
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5221  AACTAGTGCTACCGCTACATCTTCTTCCAACAGCACTTCTGCTGAAACTTTAAGCTCTTC  5280

Query  5281  CGCCGGTGCTCCATCAATGAGCACTTCTCCGGTAACGTCTTGTTGGGTGTCATTGCTGCC  5340
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5281  CGCCGGTGCTCCATCAATGAGCACTTCTCCGGTAACGTCTTGTTGGGTGTCATTGCTGCC  5340

Query  5341  TTTTTCTTATGAAAAGATATCGACTCAAAGGAGTAGCAGCACACTCCTATAGAGAAACTA  5400
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5341  TTTTTCTTATGAAAAGATATCGACTCAAAGGAGTAGCAGCACACTCCTATAGAGAAACTA  5400

Query  5401  GAGTGAAAACGGCAGTTCACTCTTAGTTAATATTATTTATTCCGTACAAATAGAACAGTT  5460
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5401  GAGTGAAAACGGCAGTTCACTCTTAGTTAATATTATTTATTCCGTACAAATAGAACAGTT  5460

Query  5461  GAAAAGTGACGCTTTTATAAAATAAGAACTTGATTTTGATTTGACCTTTTAATTATTAAC  5520
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5461  GAAAAGTGACGCTTTTATAAAATAAGAACTTGATTTTGATTTGACCTTTTAATTATTAAC  5520

Query  5521  CTTATCATTGAATAATAAGTATTATTTCCTTTTACTTGATATCTTCTTAGTCTTGACAAC  5580
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5521  CTTATCATTGAATAATAAGTATTATTTCCTTTTACTTGATATCTTCTTAGTCTTGACAAC  5580

Query  5581  TGAAATATTGTACGTCTGTCTTGAAATTTAGCTAGTGGTTCAAGAACCGTCATAGGAAAA  5640
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5581  TGAAATATTGTACGTCTGTCTTGAAATTTAGCTAGTGGTTCAAGAACCGTCATAGGAAAA  5640

Query  5641  AATACCTATTTTTTGTGGTATGCTGTTAGTAATGAATATATGTTTTGATTGTATATCTAA  5700
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5641  AATACCTATTTTTTGTGGTATGCTGTTAGTAATGAATATATGTTTTGATTGTATATCTAA  5700

Query  5701  TCGAGAAAAAGAAATGCAGAATGACAGAGACTCCTGTCTGGTTTCAATGTCATGAAAAGT  5760
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5701  TCGAGAAAAAGAAATGCAGAATGACAGAGACTCCTGTCTGGTTTCAATGTCATGAAAAGT  5760

Query  5761  TGTGCATAAGCAAACTTAACAATTAGATAAGATGGAAAAGTTCAAGTACTCCCCTCCCCA  5820
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5761  TGTGCATAAGCAAACTTAACAATTAGATAAGATGGAAAAGTTCAAGTACTCCCCTCCCCA  5820

Query  5821  TTGTTGATTCTGAATTGTAATACCTTGTCCTAATCGGAATTTTCATGACAAGAGGGTCAA  5880
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5821  TTGTTGATTCTGAATTGTAATACCTTGTCCTAATCGGAATTTTCATGACAAGAGGGTCAA  5880

Query  5881  GCCCAACTTTCTTTTAATGCCCTAGTCACTAATATCTCATTTTCATTTTCCGCAGTTAGA  5940
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5881  GCCCAACTTTCTTTTAATGCCCTAGTCACTAATATCTCATTTTCATTTTCCGCAGTTAGA  5940

Query  5941  TTGGTTAGATGTGGCAGAATTTTTGGAACGAACCTCCCGTGGGTTGTCTAATATTAAATA  6000
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5941  TTGGTTAGATGTGGCAGAATTTTTGGAACGAACCTCCCGTGGGTTGTCTAATATTAAATA  6000

Query  6001  CAGACACTTTATAACCAGTATTCTTTTTTTTTCCTTATTATTCTCATTTATTTCTCTCAT  6060
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6001  CAGACACTTTATAACCAGTATTCTTTTTTTTTCCTTATTATTCTCATTTATTTCTCTCAT  6060

Query  6061  TACTTTTGTCCAGGAATATCTTAACTCTGGCATCAATCACTGAAGCAAAGTTCCACGTCG  6120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6061  TACTTTTGTCCAGGAATATCTTAACTCTGGCATCAATCACTGAAGCAAAGTTCCACGTCG  6120

Query  6121  GGGTTCGGCAGTAAACCCATACTGTCTTTCGTGCCCTCCTTATAAACTTTTCACCTAAGT  6180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6121  GGGTTCGGCAGTAAACCCATACTGTCTTTCGTGCCCTCCTTATAAACTTTTCACCTAAGT  6180

Query  6181  AAACATTAGTTCTTAGTATTCCAAATTTCGTACACCAGCTATCATTATAACGATCAGTAT  6240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6181  AAACATTAGTTCTTAGTATTCCAAATTTCGTACACCAGCTATCATTATAACGATCAGTAT  6240

Query  6241  ACTGCAAAGCTTCAAAAGTTGAGAGTTGACGTGCCTTCCCTAACAAAACCCATCCCATAT  6300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6241  ACTGCAAAGCTTCAAAAGTTGAGAGTTGACGTGCCTTCCCTAACAAAACCCATCCCATAT  6300

Query  6301  CCTTTTTGTCCAACATCTCAAACTTTATTTCAGTTTTGTCTAGTTTCTGTGTTATGCAGA  6360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6301  CCTTTTTGTCCAACATCTCAAACTTTATTTCAGTTTTGTCTAGTTTCTGTGTTATGCAGA  6360

Query  6361  TAAGCTGTGCATATAAATGTTGGAAATAAGCTAAGCTGTTACGTTTTGTTCTCAGTTGTT  6420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6361  TAAGCTGTGCATATAAATGTTGGAAATAAGCTAAGCTGTTACGTTTTGTTCTCAGTTGTT  6420

Query  6421  AGCAAGAGCAGTAAATCAAAAATGATTGTTCTTTTGGAACCACCCAAGTAAAAAACATAT  6480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6421  AGCAAGAGCAGTAAATCAAAAATGATTGTTCTTTTGGAACCACCCAAGTAAAAAACATAT  6480

Query  6481  CCACATCTGTAAGTGTCCGCGATAAAACCGAACCCGAAAGTGAGATTCCTCCCATTATTA  6540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6481  CCACATCTGTAAGTGTCCGCGATAAAACCGAACCCGAAAGTGAGATTCCTCCCATTATTA  6540

Query  6541  CGCACGAAGGAGTTATTCTCATCTTGTCAGTAGCCTTATCCGTATCCGCTTTTTTATTAT  6600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6541  CGCACGAAGGAGTTATTCTCATCTTGTCAGTAGCCTTATCCGTATCCGCTTTTTTATTAT  6600

Query  6601  TACCGTGACATTCACTAAGCTATTTTGCTAGCCCACTCCTAACACATAGCGTTTTGAGCG  6660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6601  TACCGTGACATTCACTAAGCTATTTTGCTAGCCCACTCCTAACACATAGCGTTTTGAGCG  6660

Query  6661  TCTTGGGTACTTACTATGAAAATGACAGTTAACTACTTTTGACTAGTCACAGGTTTTAGA  6720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6661  TCTTGGGTACTTACTATGAAAATGACAGTTAACTACTTTTGACTAGTCACAGGTTTTAGA  6720

Query  6721  TCAAAGAATCTTGGGAAAAAGATCGTATTTTATAGTTAATTTTATTGTTTCATATCTATT  6780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6721  TCAAAGAATCTTGGGAAAAAGATCGTATTTTATAGTTAATTTTATTGTTTCATATCTATT  6780

Query  6781  ATTTTGAGGTGCTTTACGGACTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAG  6840
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6781  ATTTTGAGGTGCTTTACGGACTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAG  6840

Query  6841  CTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTAT  6900
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6841  CTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTAT  6900

Query  6901  CATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTT  6960
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6901  CATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTT  6960

Query  6961  TCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCT  7020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6961  TCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCT  7020

Query  7021  CGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTAT  7080
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7021  CGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTAT  7080

Query  7081  CGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7081  CGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCG  7127


>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B complete 
sequence
Length=1320834

 Score = 1.226e+04 bits (13598),  Expect = 0.0
 Identities = 6806/6809 (99%), Gaps = 1/6809 (0%)
 Strand=Plus/Minus

Query  1        GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309305  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  1309246

Query  61       GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309245  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  1309186

Query  121      CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309185  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  1309126

Query  181      ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309125  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  1309066

Query  241      TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309065  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  1309006

Query  301      AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309005  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  1308946

Query  361      ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308945  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  1308886

Query  421      CCCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGG  480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308885  CCCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGG  1308826

Query  481      TATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGT  540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308825  TATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGT  1308766

Query  541      GACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACA  600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308765  GACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACA  1308706

Query  601      TGGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCA  660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308705  TGGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCA  1308646

Query  661      AAGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCT  720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308645  AAGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCT  1308586

Query  721      AGCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCG  780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308585  AGCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCG  1308526

Query  781      AACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCA  840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308525  AACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCA  1308466

Query  841      CAGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGA  900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308465  CAGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGA  1308406

Query  901      CAGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAAC  960
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308405  CAGAAGGCAAAAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAAC  1308346

Query  961      CAGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGA  1020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308345  CAGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGA  1308286

Query  1021     AAAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTA  1080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308285  AAAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTA  1308226

Query  1081     GTATCGTCATTTAATTTTTTTTGGAATTGGCAAGTTACCTGCGTGGCTCTATACCGAATG  1140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308225  GTATCGTCATTTAATTTTTTTTGGAATTGGCAAGTTACCTGCGTGGCTCTATACCGAATG  1308166

Query  1141     AACCCCGACCCTGGCCGTTCGGTGCACCGAGCGCGTTTACGTGTGTACACGCTTTTGTAA  1200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308165  AACCCCGACCCTGGCCGTTCGGTGCACCGAGCGCGTTTACGTGTGTACACGCTTTTGTAA  1308106

Query  1201     GAAAGAAACTCGGGTCTGCGTGGGCCTGCAACGTGACTTAGCAATACCCGCGCGTCAGAT  1260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308105  GAAAGAAACTCGGGTCTGCGTGGGCCTGCAACGTGACTTAGCAATACCCGCGCGTCAGAT  1308046

Query  1261     TTAACATATTCGGGATTCTTCCCTCCGTACTAGAAAGTTGACAATAAGATGTCCATACTG  1320
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308045  TTAACATATTCGGGATTCTTCCCTCCGTACTAGAAAGTTGACAATAAGATGTCCATACTG  1307986

Query  1321     TTGTTGATACCTTGCTACTCTAGCTCATTATGACAAGGACAATCGGTTAATTGGAGGTCT  1380
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307985  TTGTTGATACCTTGCTACTCTAGCTCATTATGACAAGGACAATCGGTTAATTGGAGGTCT  1307926

Query  1381     AAATGGTGTATCAAGGTATATAAAGGCAGTAACTTTCAATGTTGAGTTGGGCTGTAGTTC  1440
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307925  AAATGGTGTATCAAGGTATATAAAGGCAGTAACTTTCAATGTTGAGTTGGGCTGTAGTTC  1307866

Query  1441     AAGGTGGTTGTAGCTTCTGGAACATATATATGCTATTCAATATAGCTGGAAAGTGTAAGC  1500
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307865  AAGGTGGTTGTAGCTTCTGGAACATATATATGCTATTCAATATAGCTGGAAAGTGTAAGC  1307806

Query  1501     TAAACAGCAAACAAAAGTCTCTGTGTGTTGTCTTATAATTATATCCTTCAGTCAGTGTTA  1560
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307805  TAAACAGCAAACAAAAGTCTCTGTGTGTTGTCTTATAATTATATCCTTCAGTCAGTGTTA  1307746

Query  1561     ATGATTAAAGACAGAATTACGAAAAAATAAAACAAGACGATAATCAGTTTTCAAAATGGC  1620
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307745  ATGATTAAAGACAGAATTACGAAAAAATAAAACAAGACGATAATCAGTTTTCAAAATGGC  1307686

Query  1621     AGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAGCATAA  1680
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307685  AGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAGCATAA  1307626

Query  1681     AGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGATAATAC  1740
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307625  AGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGATAATAC  1307566

Query  1741     TTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTCTTACC  1800
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307565  TTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTCTTACC  1307506

Query  1801     AGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTG  1860
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307505  AGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTG  1307446

Query  1861     TGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATA  1920
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307445  TGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATA  1307386

Query  1921     TTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTAT  1980
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307385  TTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTAT  1307326

Query  1981     TTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAG  2040
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307325  TTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAG  1307266

Query  2041     AAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTT  2100
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307265  AAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTT  1307206

Query  2101     AACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAAT  2160
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307205  AACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAAT  1307146

Query  2161     CGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAA  2220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307145  CGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAA  1307086

Query  2221     GGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCAC  2280
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307085  GGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCAC  1307026

Query  2281     TTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTT  2340
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307025  TTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTT  1306966

Query  2341     ACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAG  2400
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306965  ACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAG  1306906

Query  2401     ATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTT  2460
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306905  ATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTT  1306846

Query  2461     AAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTT  2520
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306845  AAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTT  1306786

Query  2521     CCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAAC  2580
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306785  CCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAAC  1306726

Query  2581     GAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTC  2640
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306725  GAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTC  1306666

Query  2641     CGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAG  2700
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306665  CGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAG  1306606

Query  2701     TGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAAT  2760
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306605  TGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAAT  1306546

Query  2761     TTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTC  2820
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306545  TTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTC  1306486

Query  2821     AGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAA  2880
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306485  AGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAA  1306426

Query  2881     GAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTC  2940
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306425  GAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTC  1306366

Query  2941     TTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAG  3000
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306365  TTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAG  1306306

Query  3001     ATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATT  3060
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306305  ATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATT  1306246

Query  3061     TGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTT  3120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306245  TGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTT  1306186

Query  3121     CGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTT  3180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306185  CGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTT  1306126

Query  3181     AGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGATCAAGC  3240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306125  AGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGATCAAGC  1306066

Query  3241     ATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAATGC  3300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306065  ATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAATGC  1306006

Query  3301     TCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTTTC  3360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306005  TCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTTTC  1305946

Query  3361     AGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTTTC  3420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305945  AGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTTTC  1305886

Query  3421     CGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGTCT  3480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305885  CGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGTCT  1305826

Query  3481     TGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAACAG  3540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305825  TGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAACAG  1305766

Query  3541     TTACTGTTAGACGTTAGCACATGGGCCGGTATGTCATTGAAGTACGTTTAAATTGCCTGA  3600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305765  TTACTGTTAGACGTTAGCACATGGGCCGGTATGTCATTGAAGTACGTTTAAATTGCCTGA  1305706

Query  3601     ATTGGGAAAAGTATTGACCTTTGAGCCGGTTGCATACCGCCTTGCGGTATGCAGTTTGGC  3660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305705  ATTGGGAAAAGTATTGACCTTTGAGCCGGTTGCATACCGCCTTGCGGTATGCAGTTTGGC  1305646

Query  3661     TCGGTTTTCCCAGCACGCATGTGGGCATCATTTCCACACGTGTGAACCCTCGGCAGTTAA  3720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305645  TCGGTTTTCCCAGCACGCATGTGGGCATCATTTCCACACGTGTGAACCCTCGGCAGTTAA  1305586

Query  3721     ATGTGTGCATTTAGGATCGGCTAATAGTTGTTTTTAGCTTCAGCTTCAGCTCATCGGATT  3780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305585  ATGTGTGCATTTAGGATCGGCTAATAGTTGTTTTTAGCTTCAGCTTCAGCTCATCGGATT  1305526

Query  3781     TTGTGAAACATATAAATCTGGCGTCAATTGAGTCTCTCGAATGGTTGAAAGGTCAATTCA  3840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305525  TTGTGAAACATATAAATCTGGCGTCAATTGAGTCTCTCGAATGGTTGAAAGGTCAATTCA  1305466

Query  3841     GGTTGGAATTTTGTATTATGTTAGCTATATGGGATTGATCAAAAAAACCAGCCAAGGATT  3900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305465  GGTTGGAATTTTGTATTATGTTAGCTATATGGGATTGATCAAAAAAACCAGCCAAGGATT  1305406

Query  3901     CAGAGAATTACAGCGCAAGCTCAGGTAGCACTCCAGTTTTAAACATAAAAAATGAAATTC  3960
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305405  CAGAGAATTACAGCGCAAGCTCAGGTAGCACTCCAGTTTTAAACATAAAAAATGAAATTC  1305346

Query  3961     TCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACCGTCAGTGCT  4020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305345  TCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACCGTCAGTGCT  1305286

Query  4021     AACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGTTTGAGTGAA  4080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305285  AACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGTTTGAGTGAA  1305226

Query  4081     ATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTCGAAGGTGCC  4140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305225  ATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTCGAAGGTGCC  1305166

Query  4141     GCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAGGCTGCTGGT  4200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305165  GCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAGGCTGCTGGT  1305106

Query  4201     GATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTACTGGGCTTTG  4260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305105  GATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTACTGGGCTTTG  1305046

Query  4261     ACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTCGCCTTGGAT  4320
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305045  ACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTCGCCTTGGAT  1304986

Query  4321     GATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTGTTGGACACT  4380
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304985  GATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTGTTGGACACT  1304926

Query  4381     AAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTCCAAGGTATG  4440
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304925  AAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTCCAAGGTATG  1304866

Query  4441     AACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAACCCATTGATT  4500
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304865  AACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAACCCATTGATT  1304806

Query  4501     TTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAACTTTGAAGAT  4560
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304805  TTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAACTTTGAAGAT  1304746

Query  4561     TTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACTCCAAATATG  4620
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304745  TTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACTCCAAATATG  1304686

Query  4621     ACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAGGACTTCTTG  4680
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304685  ACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAGGACTTCTTG  1304626

Query  4681     GCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTGACCTTCGAT  4740
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304625  GCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTGACCTTCGAT  1304566

Query  4741     GAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGTGGCGTTATC  4800
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304565  GAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGTGGCGTTATC  1304506

Query  4801     CCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCTCAATTGGCT  4860
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304505  CCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCTCAATTGGCT  1304446

Query  4861     AGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGACGCCAATGTT  4920
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304445  AGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGACGCCAATGTT  1304386

Query  4921     TTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACCACTTACATG  4980
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304385  TTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACCACTTACATG  1304326

Query  4981     ATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCAGCTCCAAAT  5040
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304325  ATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCAGCTCCAAAT  1304266

Query  5041     GTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAAACTTGGGAA  5100
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304265  GTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAAACTTGGGAA  1304206

Query  5101     GATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACTACCGTTTCT  5160
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304205  GATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACTACCGTTTCT  1304146

Query  5161     GCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAGTGCTGATGA  5220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304145  GCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAGTGCTGATGA  1304086

Query  5221     AACTAGTGCTACCGCTACATCTTCTTCCAACAGCACTTCTGCTGAAACTTTAAGCTCTTC  5280
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304085  AACTAGTGCTACCGCTACATCTTCTTCCAACAGCACTTCTGCTGAAACTTTAAGCTCTTC  1304026

Query  5281     CGCCGGTGCTCCATCAATGAGCA-CTTCTCCGGTAACGTCTTGTTGGGTGTCATTGCTGC  5339
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct  1304025  CGCCGGTGCTCCATCAATGAGCACCTTCTCCGGTAACGTCTTGTTGGGTGTCATTGCTGC  1303966

Query  5340     CTTTTTCTTATGAAAAGATATCGACTCAAAGGAGTAGCAGCACACTCCTATAGAGAAACT  5399
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303965  CTTTTTCTTATGAAAAGATATCGACTCAAAGGAGTAGCAGCACACTCCTATAGAGAAACT  1303906

Query  5400     AGAGTGAAAACGGCAGTTCACTCTTAGTTAATATTATTTATTCCGTACAAATAGAACAGT  5459
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303905  AGAGTGAAAACGGCAGTTCACTCTTAGTTAATATTATTTATTCCGTACAAATAGAACAGT  1303846

Query  5460     TGAAAAGTGACGCTTTTATAAAATAAGAACTTGATTTTGATTTGACCTTTTAATTATTAA  5519
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303845  TGAAAAGTGACGCTTTTATAAAATAAGAACTTGATTTTGATTTGACCTTTTAATTATTAA  1303786

Query  5520     CCTTATCATTGAATAATAAGTATTATTTCCTTTTACTTGATATCTTCTTAGTCTTGACAA  5579
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303785  CCTTATCATTGAATAATAAGTATTATTTCCTTTTACTTGATATCTTCTTAGTCTTGACAA  1303726

Query  5580     CTGAAATATTGTACGTCTGTCTTGAAATTTAGCTAGTGGTTCAAGAACCGTCATAGGAAA  5639
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303725  CTGAAATATTGTACGTCTGTCTTGAAATTTAGCTAGTGGTTCAAGAACCGTCATAGGAAA  1303666

Query  5640     AAATACCTATTTTTTGTGGTATGCTGTTAGTAATGAATATATGTTTTGATTGTATATCTA  5699
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303665  AAATACCTATTTTTTCTGGTATGCTGTTAGTAATGAATATATGTTTTGATTGTATATCTA  1303606

Query  5700     ATCGAGAAAAAGAAATGCAGAATGACAGAGACTCCTGTCTGGTTTCAATGTCATGAAAAG  5759
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303605  ATCGAGAAAAAGAAATGCAGAATGACAGAGACTCCTGTCTGGTTTCAATGTCATGAAAAG  1303546

Query  5760     TTGTGCATAAGCAAACTTAACAATTAGATAAGATGGAAAAGTTCAAGTACTCCCCTCCCC  5819
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303545  TTGTGCATAAGCAAACTTAACAATTAGATAAGATGGAAAAGTTCAAGTACTCCCCTCCCC  1303486

Query  5820     ATTGTTGATTCTGAATTGTAATACCTTGTCCTAATCGGAATTTTCATGACAAGAGGGTCA  5879
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303485  ATTGTTGATTCTGAATTGTAATACCTTGTCCTAATCGGAATTTTCATGACAAGAGGGTCA  1303426

Query  5880     AGCCCAACTTTCTTTTAATGCCCTAGTCACTAATATCTCATTTTCATTTTCCGCAGTTAG  5939
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303425  AGCCCAACTTTCTTTTAATGCCCTAGTCACTAATATCTCATTTTCATTTTCCGCAGTTAG  1303366

Query  5940     ATTGGTTAGATGTGGCAGAATTTTTGGAACGAACCTCCCGTGGGTTGTCTAATATTAAAT  5999
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303365  ATTGGTTAGATGTGGCAGAATTTTTGGAACGAACCTCCCGTGGGTTGTCTAATATTAAAT  1303306

Query  6000     ACAGACACTTTATAACCAGTATTCTTTTTTTTTCCTTATTATTCTCATTTATTTCTCTCA  6059
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303305  ACAGACACTTTATAACCAGTATTCTTTTTTTTTCCTTATTATTCTCATTTATTTCTCTCA  1303246

Query  6060     TTACTTTTGTCCAGGAATATCTTAACTCTGGCATCAATCACTGAAGCAAAGTTCCACGTC  6119
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303245  TTACTTTTGTCCAGGAATATCTTAACTCTGGCATCAATCACTGAAGCAAAGTTCCACGTC  1303186

Query  6120     GGGGTTCGGCAGTAAACCCATACTGTCTTTCGTGCCCTCCTTATAAACTTTTCACCTAAG  6179
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303185  GGGGTTCGGCAGTAAACCCATACTGTCTTTCGTGCCCTCCTTATAAACTTTTCACCTAAG  1303126

Query  6180     TAAACATTAGTTCTTAGTATTCCAAATTTCGTACACCAGCTATCATTATAACGATCAGTA  6239
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303125  TAAACATTAGTTCTTAGTATTCCAAATTTCGTACACCAGCTATCATTATAACGATCAGTA  1303066

Query  6240     TACTGCAAAGCTTCAAAAGTTGAGAGTTGACGTGCCTTCCCTAACAAAACCCATCCCATA  6299
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303065  TACTGCAAAGCTTCAAAAGTTGAGAGTTGACGTGCCTTCCCTAACAAAACCCATCCCATA  1303006

Query  6300     TCCTTTTTGTCCAACATCTCAAACTTTATTTCAGTTTTGTCTAGTTTCTGTGTTATGCAG  6359
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303005  TCCTTTTTGTCCAACATCTCAAACTTTATTTCAGTTTTGTCTAGTTTCTGTGTTATGCAG  1302946

Query  6360     ATAAGCTGTGCATATAAATGTTGGAAATAAGCTAAGCTGTTACGTTTTGTTCTCAGTTGT  6419
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302945  ATAAGCTGTGCATATAAATGTTGGAAATAAGCTAAGCTGTTACGTTTTGTTCTCAGTTGT  1302886

Query  6420     TAGCAAGAGCAGTAAATCAAAAATGATTGTTCTTTTGGAACCACCCAAGTAAAAAACATA  6479
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302885  TAGCAAGAGCAGTAAATCAAAAATGATTGTTCTTTTGGAACCACCCAAGTAAAAAACATA  1302826

Query  6480     TCCACATCTGTAAGTGTCCGCGATAAAACCGAACCCGAAAGTGAGATTCCTCCCATTATT  6539
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302825  TCCACATCTGTAAGTGTCCGCGATAAAACCGAACCCGAAAGTGAGATTCCTCCCATTATT  1302766

Query  6540     ACGCACGAAGGAGTTATTCTCATCTTGTCAGTAGCCTTATCCGTATCCGCTTTTTTATTA  6599
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302765  ACGCACGAAGGAGTTATTCTCATCTTGTCAGTAGCCTTATCCGTATCCGCTTTTTTATTA  1302706

Query  6600     TTACCGTGACATTCACTAAGCTATTTTGCTAGCCCACTCCTAACACATAGCGTTTTGAGC  6659
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302705  TTACCGTGACATTCACTAAGCTATTTTGCTAGCCCACTCCTAACACATAGCGTTTTGAGC  1302646

Query  6660     GTCTTGGGTACTTACTATGAAAATGACAGTTAACTACTTTTGACTAGTCACAGGTTTTAG  6719
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302645  GTCTTGGGTACTTACTATGAAAATGACAGTTAACTACTTTTGACTAGTCACAGGTTTTAG  1302586

Query  6720     ATCAAAGAATCTTGGGAAAAAGATCGTATTTTATAGTTAATTTTATTGTTTCATATCTAT  6779
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302585  ATCAAAGAATCTTGGGAAAAAGATCGTATTTTATAGTTAATTTTATTGTTTCATATCTAT  1302526

Query  6780     TATTTTGAGGTGCTTTACGGACTCCTCGA  6808
                |||||||||||||||||||||||||||||
Sbjct  1302525  TATTTTGAGGTGCTTTACGGACTCCTCGA  1302497


> gi|50313007|ref|NC_006038.1| Kluyveromyces lactis NRRL Y-1140 
chromosome B, complete genome
Length=1320834

 Score = 1.226e+04 bits (13598),  Expect = 0.0
 Identities = 6806/6809 (99%), Gaps = 1/6809 (0%)
 Strand=Plus/Minus

Query  1        GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309305  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  1309246

Query  61       GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309245  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  1309186

Query  121      CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309185  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  1309126

Query  181      ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309125  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  1309066

Query  241      TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309065  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  1309006

Query  301      AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1309005  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  1308946

Query  361      ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308945  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  1308886

Query  421      CCCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGG  480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308885  CCCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGG  1308826

Query  481      TATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGT  540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308825  TATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGT  1308766

Query  541      GACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACA  600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308765  GACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACA  1308706

Query  601      TGGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCA  660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308705  TGGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCA  1308646

Query  661      AAGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCT  720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308645  AAGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCT  1308586

Query  721      AGCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCG  780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308585  AGCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCG  1308526

Query  781      AACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCA  840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308525  AACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCA  1308466

Query  841      CAGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGA  900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308465  CAGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGA  1308406

Query  901      CAGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAAC  960
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308405  CAGAAGGCAAAAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAAC  1308346

Query  961      CAGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGA  1020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308345  CAGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGA  1308286

Query  1021     AAAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTA  1080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308285  AAAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTA  1308226

Query  1081     GTATCGTCATTTAATTTTTTTTGGAATTGGCAAGTTACCTGCGTGGCTCTATACCGAATG  1140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308225  GTATCGTCATTTAATTTTTTTTGGAATTGGCAAGTTACCTGCGTGGCTCTATACCGAATG  1308166

Query  1141     AACCCCGACCCTGGCCGTTCGGTGCACCGAGCGCGTTTACGTGTGTACACGCTTTTGTAA  1200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308165  AACCCCGACCCTGGCCGTTCGGTGCACCGAGCGCGTTTACGTGTGTACACGCTTTTGTAA  1308106

Query  1201     GAAAGAAACTCGGGTCTGCGTGGGCCTGCAACGTGACTTAGCAATACCCGCGCGTCAGAT  1260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308105  GAAAGAAACTCGGGTCTGCGTGGGCCTGCAACGTGACTTAGCAATACCCGCGCGTCAGAT  1308046

Query  1261     TTAACATATTCGGGATTCTTCCCTCCGTACTAGAAAGTTGACAATAAGATGTCCATACTG  1320
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1308045  TTAACATATTCGGGATTCTTCCCTCCGTACTAGAAAGTTGACAATAAGATGTCCATACTG  1307986

Query  1321     TTGTTGATACCTTGCTACTCTAGCTCATTATGACAAGGACAATCGGTTAATTGGAGGTCT  1380
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307985  TTGTTGATACCTTGCTACTCTAGCTCATTATGACAAGGACAATCGGTTAATTGGAGGTCT  1307926

Query  1381     AAATGGTGTATCAAGGTATATAAAGGCAGTAACTTTCAATGTTGAGTTGGGCTGTAGTTC  1440
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307925  AAATGGTGTATCAAGGTATATAAAGGCAGTAACTTTCAATGTTGAGTTGGGCTGTAGTTC  1307866

Query  1441     AAGGTGGTTGTAGCTTCTGGAACATATATATGCTATTCAATATAGCTGGAAAGTGTAAGC  1500
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307865  AAGGTGGTTGTAGCTTCTGGAACATATATATGCTATTCAATATAGCTGGAAAGTGTAAGC  1307806

Query  1501     TAAACAGCAAACAAAAGTCTCTGTGTGTTGTCTTATAATTATATCCTTCAGTCAGTGTTA  1560
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307805  TAAACAGCAAACAAAAGTCTCTGTGTGTTGTCTTATAATTATATCCTTCAGTCAGTGTTA  1307746

Query  1561     ATGATTAAAGACAGAATTACGAAAAAATAAAACAAGACGATAATCAGTTTTCAAAATGGC  1620
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307745  ATGATTAAAGACAGAATTACGAAAAAATAAAACAAGACGATAATCAGTTTTCAAAATGGC  1307686

Query  1621     AGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAGCATAA  1680
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307685  AGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAGCATAA  1307626

Query  1681     AGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGATAATAC  1740
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307625  AGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGATAATAC  1307566

Query  1741     TTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTCTTACC  1800
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307565  TTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTCTTACC  1307506

Query  1801     AGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTG  1860
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307505  AGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTG  1307446

Query  1861     TGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATA  1920
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307445  TGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATA  1307386

Query  1921     TTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTAT  1980
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307385  TTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTAT  1307326

Query  1981     TTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAG  2040
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307325  TTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAG  1307266

Query  2041     AAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTT  2100
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307265  AAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTT  1307206

Query  2101     AACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAAT  2160
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307205  AACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAAT  1307146

Query  2161     CGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAA  2220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307145  CGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAA  1307086

Query  2221     GGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCAC  2280
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307085  GGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCAC  1307026

Query  2281     TTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTT  2340
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1307025  TTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTT  1306966

Query  2341     ACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAG  2400
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306965  ACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAG  1306906

Query  2401     ATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTT  2460
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306905  ATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTT  1306846

Query  2461     AAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTT  2520
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306845  AAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTT  1306786

Query  2521     CCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAAC  2580
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306785  CCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAAC  1306726

Query  2581     GAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTC  2640
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306725  GAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTC  1306666

Query  2641     CGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAG  2700
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306665  CGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAG  1306606

Query  2701     TGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAAT  2760
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306605  TGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAAT  1306546

Query  2761     TTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTC  2820
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306545  TTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTC  1306486

Query  2821     AGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAA  2880
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306485  AGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAA  1306426

Query  2881     GAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTC  2940
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306425  GAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTC  1306366

Query  2941     TTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAG  3000
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306365  TTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAG  1306306

Query  3001     ATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATT  3060
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306305  ATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATT  1306246

Query  3061     TGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTT  3120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306245  TGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTT  1306186

Query  3121     CGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTT  3180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306185  CGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTT  1306126

Query  3181     AGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGATCAAGC  3240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306125  AGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGATCAAGC  1306066

Query  3241     ATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAATGC  3300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306065  ATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAATGC  1306006

Query  3301     TCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTTTC  3360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1306005  TCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTTTC  1305946

Query  3361     AGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTTTC  3420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305945  AGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTTTC  1305886

Query  3421     CGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGTCT  3480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305885  CGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGTCT  1305826

Query  3481     TGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAACAG  3540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305825  TGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAACAG  1305766

Query  3541     TTACTGTTAGACGTTAGCACATGGGCCGGTATGTCATTGAAGTACGTTTAAATTGCCTGA  3600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305765  TTACTGTTAGACGTTAGCACATGGGCCGGTATGTCATTGAAGTACGTTTAAATTGCCTGA  1305706

Query  3601     ATTGGGAAAAGTATTGACCTTTGAGCCGGTTGCATACCGCCTTGCGGTATGCAGTTTGGC  3660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305705  ATTGGGAAAAGTATTGACCTTTGAGCCGGTTGCATACCGCCTTGCGGTATGCAGTTTGGC  1305646

Query  3661     TCGGTTTTCCCAGCACGCATGTGGGCATCATTTCCACACGTGTGAACCCTCGGCAGTTAA  3720
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305645  TCGGTTTTCCCAGCACGCATGTGGGCATCATTTCCACACGTGTGAACCCTCGGCAGTTAA  1305586

Query  3721     ATGTGTGCATTTAGGATCGGCTAATAGTTGTTTTTAGCTTCAGCTTCAGCTCATCGGATT  3780
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305585  ATGTGTGCATTTAGGATCGGCTAATAGTTGTTTTTAGCTTCAGCTTCAGCTCATCGGATT  1305526

Query  3781     TTGTGAAACATATAAATCTGGCGTCAATTGAGTCTCTCGAATGGTTGAAAGGTCAATTCA  3840
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305525  TTGTGAAACATATAAATCTGGCGTCAATTGAGTCTCTCGAATGGTTGAAAGGTCAATTCA  1305466

Query  3841     GGTTGGAATTTTGTATTATGTTAGCTATATGGGATTGATCAAAAAAACCAGCCAAGGATT  3900
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305465  GGTTGGAATTTTGTATTATGTTAGCTATATGGGATTGATCAAAAAAACCAGCCAAGGATT  1305406

Query  3901     CAGAGAATTACAGCGCAAGCTCAGGTAGCACTCCAGTTTTAAACATAAAAAATGAAATTC  3960
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305405  CAGAGAATTACAGCGCAAGCTCAGGTAGCACTCCAGTTTTAAACATAAAAAATGAAATTC  1305346

Query  3961     TCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACCGTCAGTGCT  4020
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305345  TCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACCGTCAGTGCT  1305286

Query  4021     AACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGTTTGAGTGAA  4080
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305285  AACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGTTTGAGTGAA  1305226

Query  4081     ATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTCGAAGGTGCC  4140
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305225  ATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTCGAAGGTGCC  1305166

Query  4141     GCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAGGCTGCTGGT  4200
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305165  GCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAGGCTGCTGGT  1305106

Query  4201     GATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTACTGGGCTTTG  4260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305105  GATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTACTGGGCTTTG  1305046

Query  4261     ACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTCGCCTTGGAT  4320
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1305045  ACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTCGCCTTGGAT  1304986

Query  4321     GATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTGTTGGACACT  4380
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304985  GATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTGTTGGACACT  1304926

Query  4381     AAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTCCAAGGTATG  4440
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304925  AAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTCCAAGGTATG  1304866

Query  4441     AACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAACCCATTGATT  4500
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304865  AACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAACCCATTGATT  1304806

Query  4501     TTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAACTTTGAAGAT  4560
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304805  TTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAACTTTGAAGAT  1304746

Query  4561     TTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACTCCAAATATG  4620
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304745  TTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACTCCAAATATG  1304686

Query  4621     ACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAGGACTTCTTG  4680
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304685  ACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAGGACTTCTTG  1304626

Query  4681     GCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTGACCTTCGAT  4740
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304625  GCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTGACCTTCGAT  1304566

Query  4741     GAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGTGGCGTTATC  4800
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304565  GAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGTGGCGTTATC  1304506

Query  4801     CCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCTCAATTGGCT  4860
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304505  CCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCTCAATTGGCT  1304446

Query  4861     AGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGACGCCAATGTT  4920
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304445  AGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGACGCCAATGTT  1304386

Query  4921     TTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACCACTTACATG  4980
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304385  TTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACCACTTACATG  1304326

Query  4981     ATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCAGCTCCAAAT  5040
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304325  ATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCAGCTCCAAAT  1304266

Query  5041     GTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAAACTTGGGAA  5100
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304265  GTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAAACTTGGGAA  1304206

Query  5101     GATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACTACCGTTTCT  5160
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304205  GATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACTACCGTTTCT  1304146

Query  5161     GCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAGTGCTGATGA  5220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304145  GCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAGTGCTGATGA  1304086

Query  5221     AACTAGTGCTACCGCTACATCTTCTTCCAACAGCACTTCTGCTGAAACTTTAAGCTCTTC  5280
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1304085  AACTAGTGCTACCGCTACATCTTCTTCCAACAGCACTTCTGCTGAAACTTTAAGCTCTTC  1304026

Query  5281     CGCCGGTGCTCCATCAATGAGCA-CTTCTCCGGTAACGTCTTGTTGGGTGTCATTGCTGC  5339
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct  1304025  CGCCGGTGCTCCATCAATGAGCACCTTCTCCGGTAACGTCTTGTTGGGTGTCATTGCTGC  1303966

Query  5340     CTTTTTCTTATGAAAAGATATCGACTCAAAGGAGTAGCAGCACACTCCTATAGAGAAACT  5399
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303965  CTTTTTCTTATGAAAAGATATCGACTCAAAGGAGTAGCAGCACACTCCTATAGAGAAACT  1303906

Query  5400     AGAGTGAAAACGGCAGTTCACTCTTAGTTAATATTATTTATTCCGTACAAATAGAACAGT  5459
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303905  AGAGTGAAAACGGCAGTTCACTCTTAGTTAATATTATTTATTCCGTACAAATAGAACAGT  1303846

Query  5460     TGAAAAGTGACGCTTTTATAAAATAAGAACTTGATTTTGATTTGACCTTTTAATTATTAA  5519
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303845  TGAAAAGTGACGCTTTTATAAAATAAGAACTTGATTTTGATTTGACCTTTTAATTATTAA  1303786

Query  5520     CCTTATCATTGAATAATAAGTATTATTTCCTTTTACTTGATATCTTCTTAGTCTTGACAA  5579
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303785  CCTTATCATTGAATAATAAGTATTATTTCCTTTTACTTGATATCTTCTTAGTCTTGACAA  1303726

Query  5580     CTGAAATATTGTACGTCTGTCTTGAAATTTAGCTAGTGGTTCAAGAACCGTCATAGGAAA  5639
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303725  CTGAAATATTGTACGTCTGTCTTGAAATTTAGCTAGTGGTTCAAGAACCGTCATAGGAAA  1303666

Query  5640     AAATACCTATTTTTTGTGGTATGCTGTTAGTAATGAATATATGTTTTGATTGTATATCTA  5699
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303665  AAATACCTATTTTTTCTGGTATGCTGTTAGTAATGAATATATGTTTTGATTGTATATCTA  1303606

Query  5700     ATCGAGAAAAAGAAATGCAGAATGACAGAGACTCCTGTCTGGTTTCAATGTCATGAAAAG  5759
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303605  ATCGAGAAAAAGAAATGCAGAATGACAGAGACTCCTGTCTGGTTTCAATGTCATGAAAAG  1303546

Query  5760     TTGTGCATAAGCAAACTTAACAATTAGATAAGATGGAAAAGTTCAAGTACTCCCCTCCCC  5819
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303545  TTGTGCATAAGCAAACTTAACAATTAGATAAGATGGAAAAGTTCAAGTACTCCCCTCCCC  1303486

Query  5820     ATTGTTGATTCTGAATTGTAATACCTTGTCCTAATCGGAATTTTCATGACAAGAGGGTCA  5879
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303485  ATTGTTGATTCTGAATTGTAATACCTTGTCCTAATCGGAATTTTCATGACAAGAGGGTCA  1303426

Query  5880     AGCCCAACTTTCTTTTAATGCCCTAGTCACTAATATCTCATTTTCATTTTCCGCAGTTAG  5939
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303425  AGCCCAACTTTCTTTTAATGCCCTAGTCACTAATATCTCATTTTCATTTTCCGCAGTTAG  1303366

Query  5940     ATTGGTTAGATGTGGCAGAATTTTTGGAACGAACCTCCCGTGGGTTGTCTAATATTAAAT  5999
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303365  ATTGGTTAGATGTGGCAGAATTTTTGGAACGAACCTCCCGTGGGTTGTCTAATATTAAAT  1303306

Query  6000     ACAGACACTTTATAACCAGTATTCTTTTTTTTTCCTTATTATTCTCATTTATTTCTCTCA  6059
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303305  ACAGACACTTTATAACCAGTATTCTTTTTTTTTCCTTATTATTCTCATTTATTTCTCTCA  1303246

Query  6060     TTACTTTTGTCCAGGAATATCTTAACTCTGGCATCAATCACTGAAGCAAAGTTCCACGTC  6119
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303245  TTACTTTTGTCCAGGAATATCTTAACTCTGGCATCAATCACTGAAGCAAAGTTCCACGTC  1303186

Query  6120     GGGGTTCGGCAGTAAACCCATACTGTCTTTCGTGCCCTCCTTATAAACTTTTCACCTAAG  6179
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303185  GGGGTTCGGCAGTAAACCCATACTGTCTTTCGTGCCCTCCTTATAAACTTTTCACCTAAG  1303126

Query  6180     TAAACATTAGTTCTTAGTATTCCAAATTTCGTACACCAGCTATCATTATAACGATCAGTA  6239
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303125  TAAACATTAGTTCTTAGTATTCCAAATTTCGTACACCAGCTATCATTATAACGATCAGTA  1303066

Query  6240     TACTGCAAAGCTTCAAAAGTTGAGAGTTGACGTGCCTTCCCTAACAAAACCCATCCCATA  6299
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303065  TACTGCAAAGCTTCAAAAGTTGAGAGTTGACGTGCCTTCCCTAACAAAACCCATCCCATA  1303006

Query  6300     TCCTTTTTGTCCAACATCTCAAACTTTATTTCAGTTTTGTCTAGTTTCTGTGTTATGCAG  6359
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303005  TCCTTTTTGTCCAACATCTCAAACTTTATTTCAGTTTTGTCTAGTTTCTGTGTTATGCAG  1302946

Query  6360     ATAAGCTGTGCATATAAATGTTGGAAATAAGCTAAGCTGTTACGTTTTGTTCTCAGTTGT  6419
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302945  ATAAGCTGTGCATATAAATGTTGGAAATAAGCTAAGCTGTTACGTTTTGTTCTCAGTTGT  1302886

Query  6420     TAGCAAGAGCAGTAAATCAAAAATGATTGTTCTTTTGGAACCACCCAAGTAAAAAACATA  6479
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302885  TAGCAAGAGCAGTAAATCAAAAATGATTGTTCTTTTGGAACCACCCAAGTAAAAAACATA  1302826

Query  6480     TCCACATCTGTAAGTGTCCGCGATAAAACCGAACCCGAAAGTGAGATTCCTCCCATTATT  6539
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302825  TCCACATCTGTAAGTGTCCGCGATAAAACCGAACCCGAAAGTGAGATTCCTCCCATTATT  1302766

Query  6540     ACGCACGAAGGAGTTATTCTCATCTTGTCAGTAGCCTTATCCGTATCCGCTTTTTTATTA  6599
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302765  ACGCACGAAGGAGTTATTCTCATCTTGTCAGTAGCCTTATCCGTATCCGCTTTTTTATTA  1302706

Query  6600     TTACCGTGACATTCACTAAGCTATTTTGCTAGCCCACTCCTAACACATAGCGTTTTGAGC  6659
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302705  TTACCGTGACATTCACTAAGCTATTTTGCTAGCCCACTCCTAACACATAGCGTTTTGAGC  1302646

Query  6660     GTCTTGGGTACTTACTATGAAAATGACAGTTAACTACTTTTGACTAGTCACAGGTTTTAG  6719
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302645  GTCTTGGGTACTTACTATGAAAATGACAGTTAACTACTTTTGACTAGTCACAGGTTTTAG  1302586

Query  6720     ATCAAAGAATCTTGGGAAAAAGATCGTATTTTATAGTTAATTTTATTGTTTCATATCTAT  6779
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302585  ATCAAAGAATCTTGGGAAAAAGATCGTATTTTATAGTTAATTTTATTGTTTCATATCTAT  1302526

Query  6780     TATTTTGAGGTGCTTTACGGACTCCTCGA  6808
                |||||||||||||||||||||||||||||
Sbjct  1302525  TATTTTGAGGTGCTTTACGGACTCCTCGA  1302497


>ref|XM_452193.1| Kluyveromyces lactis NRRL Y-1140 hypothetical protein partial 
mRNA
Length=1764

 Score = 3182 bits (3528),  Expect = 0.0
 Identities = 1764/1764 (100%), Gaps = 0/1764 (0%)
 Strand=Plus/Plus

Query  1616  ATGGCAGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAG  1675
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1     ATGGCAGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAG  60

Query  1676  CATAAAGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGAT  1735
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61    CATAAAGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGAT  120

Query  1736  AATACTTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTC  1795
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121   AATACTTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTC  180

Query  1796  TTACCAGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATAT  1855
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181   TTACCAGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATAT  240

Query  1856  CTGTGTGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGAT  1915
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241   CTGTGTGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGAT  300

Query  1916  GCATATTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTC  1975
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301   GCATATTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTC  360

Query  1976  TCTATTTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAA  2035
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361   TCTATTTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAA  420

Query  2036  GGTAGAAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCG  2095
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421   GGTAGAAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCG  480

Query  2096  TCTTTAACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCT  2155
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481   TCTTTAACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCT  540

Query  2156  ACAATCGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGA  2215
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  541   ACAATCGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGA  600

Query  2216  GGTAAGGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTT  2275
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  601   GGTAAGGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTT  660

Query  2276  AGCACTTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTA  2335
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  661   AGCACTTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTA  720

Query  2336  TACTTACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCT  2395
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  721   TACTTACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCT  780

Query  2396  CCAAGATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATAC  2455
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  781   CCAAGATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATAC  840

Query  2456  CACTTAAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAA  2515
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  841   CACTTAAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAA  900

Query  2516  TCTTTCCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTC  2575
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  901   TCTTTCCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTC  960

Query  2576  AGAACGAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAA  2635
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  961   AGAACGAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAA  1020

Query  2636  TTTTCCGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATG  2695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1021  TTTTCCGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATG  1080

Query  2696  AAGAGTGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCT  2755
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1081  AAGAGTGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCT  1140

Query  2756  TCAATTTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCT  2815
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1141  TCAATTTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCT  1200

Query  2816  ATCTCAGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAG  2875
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1201  ATCTCAGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAG  1260

Query  2876  ACTAAGAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATC  2935
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1261  ACTAAGAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATC  1320

Query  2936  TTTTCTTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTG  2995
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1321  TTTTCTTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTG  1380

Query  2996  ACGAGATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAAT  3055
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1381  ACGAGATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAAT  1440

Query  3056  CAATTTGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTT  3115
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1441  CAATTTGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTT  1500

Query  3116  TTCTTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGA  3175
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1501  TTCTTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGA  1560

Query  3176  AGCTTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGAT  3235
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1561  AGCTTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGAT  1620

Query  3236  CAAGCATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCA  3295
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1621  CAAGCATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCA  1680

Query  3296  AATGCTCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAG  3355
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1681  AATGCTCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAG  1740

Query  3356  CTTTCAGAGGCAGAATCTGTTTAA  3379
             ||||||||||||||||||||||||
Sbjct  1741  CTTTCAGAGGCAGAATCTGTTTAA  1764


> KLLA0B14861g KLLA0B14861g undefined product 2368517:2370280 reverse
Length=1764

 Score = 3182 bits (3528),  Expect = 0.0
 Identities = 1764/1764 (100%), Gaps = 0/1764 (0%)
 Strand=Plus/Plus

Query  1616  ATGGCAGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAG  1675
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1     ATGGCAGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAG  60

Query  1676  CATAAAGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGAT  1735
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61    CATAAAGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGAT  120

Query  1736  AATACTTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTC  1795
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121   AATACTTCTGGATTGAAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTC  180

Query  1796  TTACCAGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATAT  1855
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181   TTACCAGGTTACTTGTCGAAGCAATATTACAAATTGTACGGTTTATGTTTTATAACATAT  240

Query  1856  CTGTGTGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGAT  1915
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241   CTGTGTGCTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGAT  300

Query  1916  GCATATTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTC  1975
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301   GCATATTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTC  360

Query  1976  TCTATTTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAA  2035
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361   TCTATTTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAA  420

Query  2036  GGTAGAAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCG  2095
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421   GGTAGAAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCG  480

Query  2096  TCTTTAACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCT  2155
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481   TCTTTAACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCT  540

Query  2156  ACAATCGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGA  2215
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  541   ACAATCGCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGA  600

Query  2216  GGTAAGGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTT  2275
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  601   GGTAAGGTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTT  660

Query  2276  AGCACTTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTA  2335
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  661   AGCACTTACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTA  720

Query  2336  TACTTACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCT  2395
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  721   TACTTACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCT  780

Query  2396  CCAAGATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATAC  2455
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  781   CCAAGATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATAC  840

Query  2456  CACTTAAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAA  2515
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  841   CACTTAAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAA  900

Query  2516  TCTTTCCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTC  2575
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  901   TCTTTCCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTC  960

Query  2576  AGAACGAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAA  2635
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  961   AGAACGAGATCGGATAGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAA  1020

Query  2636  TTTTCCGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATG  2695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1021  TTTTCCGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATG  1080

Query  2696  AAGAGTGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCT  2755
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1081  AAGAGTGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCT  1140

Query  2756  TCAATTTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCT  2815
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1141  TCAATTTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCT  1200

Query  2816  ATCTCAGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAG  2875
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1201  ATCTCAGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAG  1260

Query  2876  ACTAAGAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATC  2935
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1261  ACTAAGAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATC  1320

Query  2936  TTTTCTTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTG  2995
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1321  TTTTCTTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTG  1380

Query  2996  ACGAGATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAAT  3055
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1381  ACGAGATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAAT  1440

Query  3056  CAATTTGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTT  3115
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1441  CAATTTGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTT  1500

Query  3116  TTCTTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGA  3175
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1501  TTCTTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGA  1560

Query  3176  AGCTTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGAT  3235
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1561  AGCTTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGAT  1620

Query  3236  CAAGCATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCA  3295
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1621  CAAGCATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCA  1680

Query  3296  AATGCTCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAG  3355
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1681  AATGCTCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAG  1740

Query  3356  CTTTCAGAGGCAGAATCTGTTTAA  3379
             ||||||||||||||||||||||||
Sbjct  1741  CTTTCAGAGGCAGAATCTGTTTAA  1764


>ref|XM_452192.1| Kluyveromyces lactis NRRL Y-1140 hypothetical protein partial 
mRNA
Length=1266

 Score = 2284 bits (2532),  Expect = 0.0
 Identities = 1266/1266 (100%), Gaps = 0/1266 (0%)
 Strand=Plus/Plus

Query  3952  ATGAAATTCTCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACC  4011
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1     ATGAAATTCTCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACC  60

Query  4012  GTCAGTGCTAACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGT  4071
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61    GTCAGTGCTAACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGT  120

Query  4072  TTGAGTGAAATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTC  4131
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121   TTGAGTGAAATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTC  180

Query  4132  GAAGGTGCCGCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAG  4191
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181   GAAGGTGCCGCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAG  240

Query  4192  GCTGCTGGTGATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTAC  4251
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241   GCTGCTGGTGATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTAC  300

Query  4252  TGGGCTTTGACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTC  4311
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301   TGGGCTTTGACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTC  360

Query  4312  GCCTTGGATGATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTG  4371
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361   GCCTTGGATGATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTG  420

Query  4372  TTGGACACTAAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTC  4431
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421   TTGGACACTAAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTC  480

Query  4432  CAAGGTATGAACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAAC  4491
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481   CAAGGTATGAACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAAC  540

Query  4492  CCATTGATTTTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAAC  4551
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  541   CCATTGATTTTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAAC  600

Query  4552  TTTGAAGATTTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACT  4611
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  601   TTTGAAGATTTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACT  660

Query  4612  CCAAATATGACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAG  4671
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  661   CCAAATATGACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAG  720

Query  4672  GACTTCTTGGCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTG  4731
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  721   GACTTCTTGGCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTG  780

Query  4732  ACCTTCGATGAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGT  4791
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  781   ACCTTCGATGAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGT  840

Query  4792  GGCGTTATCCCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCT  4851
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  841   GGCGTTATCCCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCT  900

Query  4852  CAATTGGCTAGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGAC  4911
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  901   CAATTGGCTAGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGAC  960

Query  4912  GCCAATGTTTTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACC  4971
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  961   GCCAATGTTTTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACC  1020

Query  4972  ACTTACATGATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCA  5031
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1021  ACTTACATGATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCA  1080

Query  5032  GCTCCAAATGTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAA  5091
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1081  GCTCCAAATGTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAA  1140

Query  5092  ACTTGGGAAGATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACT  5151
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1141  ACTTGGGAAGATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACT  1200

Query  5152  ACCGTTTCTGCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAG  5211
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1201  ACCGTTTCTGCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAG  1260

Query  5212  TGCTGA  5217
             ||||||
Sbjct  1261  TGCTGA  1266


> KLLA0B14839g KLLA0B14839g undefined product 2366679:2367944 reverse
Length=1266

 Score = 2284 bits (2532),  Expect = 0.0
 Identities = 1266/1266 (100%), Gaps = 0/1266 (0%)
 Strand=Plus/Plus

Query  3952  ATGAAATTCTCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACC  4011
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1     ATGAAATTCTCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGCCTTAAATGCCGTTACC  60

Query  4012  GTCAGTGCTAACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGT  4071
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61    GTCAGTGCTAACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAGT  120

Query  4072  TTGAGTGAAATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTC  4131
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121   TTGAGTGAAATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGTC  180

Query  4132  GAAGGTGCCGCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAG  4191
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181   GAAGGTGCCGCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAG  240

Query  4192  GCTGCTGGTGATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTAC  4251
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241   GCTGCTGGTGATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTAC  300

Query  4252  TGGGCTTTGACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTC  4311
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301   TGGGCTTTGACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTC  360

Query  4312  GCCTTGGATGATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTG  4371
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361   GCCTTGGATGATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGATTTG  420

Query  4372  TTGGACACTAAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTC  4431
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421   TTGGACACTAAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGGTTTC  480

Query  4432  CAAGGTATGAACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAAC  4491
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481   CAAGGTATGAACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACATAAC  540

Query  4492  CCATTGATTTTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAAC  4551
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  541   CCATTGATTTTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAAC  600

Query  4552  TTTGAAGATTTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACT  4611
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  601   TTTGAAGATTTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACT  660

Query  4612  CCAAATATGACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAG  4671
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  661   CCAAATATGACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAG  720

Query  4672  GACTTCTTGGCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTG  4731
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  721   GACTTCTTGGCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTG  780

Query  4732  ACCTTCGATGAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGT  4791
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  781   ACCTTCGATGAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTTGGGT  840

Query  4792  GGCGTTATCCCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCT  4851
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  841   GGCGTTATCCCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTACTCT  900

Query  4852  CAATTGGCTAGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGAC  4911
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  901   CAATTGGCTAGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGGTGAC  960

Query  4912  GCCAATGTTTTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACC  4971
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  961   GCCAATGTTTTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACACC  1020

Query  4972  ACTTACATGATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCA  5031
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1021  ACTTACATGATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCA  1080

Query  5032  GCTCCAAATGTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAA  5091
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1081  GCTCCAAATGTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAA  1140

Query  5092  ACTTGGGAAGATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACT  5151
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1141  ACTTGGGAAGATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACT  1200

Query  5152  ACCGTTTCTGCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAG  5211
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1201  ACCGTTTCTGCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTACCGACAG  1260

Query  5212  TGCTGA  5217
             ||||||
Sbjct  1261  TGCTGA  1266


> gsASS001Lm
Length=10741898

 Score = 1283 bits (1422),  Expect = 0.0
 Identities = 1141/1419 (81%), Gaps = 25/1419 (1%)
 Strand=Plus/Minus

Query  3949     AAAATGAAATTCTCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGC-CTTAAATGCCGT  4007
                |||||||||||||||||||||||  |  | || || |||||  | |  ||||| | ||||
Sbjct  7549187  AAAATGAAATTCTCCGATTTTAGCCTATTAGGGTTGGGTGCCATAGTGCTTAACT-CCGT  7549129

Query  4008     TACCGTCAGTGCTAACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCC  4067
                |   |||| ||| ||||||||||||||  | ||||||||||||||||||||  | |||||
Sbjct  7549128  TGGTGTCAATGCCAACACTGCTGACACTTCCTTGTTGAGAACTTACTCTACGGTGTCTCC  7549069

Query  4068     AAGTTTGAGTGAAATTGAATCCGC---CGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTC  4124
                ||||   ||||  |||||    ||   ||||||    ||||    ||| || |    |||
Sbjct  7549068  AAGTGCCAGTGCCATTGAGCAAGCTATCGCTTCC---ACTGTTCCTGCCGAAGAAACTTC  7549012

Query  4125     AGATGTCGAAGGTGCCGCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTA  4184
                   ||| |||||||| ||||||||||  |||| ||| || | ||||||||||||||||||
Sbjct  7549011  CAGTGTTGAAGGTGCTGCTTTCAAGAACTTCTACATCATTTACTTGGAAAACACCGATTA  7548952

Query  4185     CGACAAGGCTGCTGGTGATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGAC  4244
                |||||| ||||| ||||| |||  |||| | ||| ||||    |||||||| ||||||||
Sbjct  7548951  CGACAAAGCTGCCGGTGACGAAAGCCTTGCCTGGTTGGCCACTCAAGGTATCACCTTGAC  7548892

Query  4245     CAACTACTGGGCTTTGACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGA  4304
                ||||||||||||||||||||| ||||| |||||||||||||||||||| ||   ||||||
Sbjct  7548891  CAACTACTGGGCTTTGACTCATCCTTCTGAACCAAACTATTTGGCTTCCGTTTCTGGTGA  7548832

Query  4305     TTACTTCGCCTTGGATGATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGT  4364
                 |||||||||||||| ||||||||||| ||| |  ||||||| || || || | ||| ||
Sbjct  7548831  CTACTTCGCCTTGGACGATGACAGATTCATTGCCTTGCCATCTAACGTCTCCACCATTGT  7548772

Query  4365     TGATTTGTTGGACACTAAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGC  4424
                ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct  7548771  TGACTTGTTGGACACTAAGGGTATCTCTTGGGCTGAGTACCAAGAACACTCTCCATATGC  7548712

Query  4425     TGGTTTCCAAGGTATGAACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAA  4484
                 |||||| | ||| | |||| ||| ||||| || || | ||||| ||| || ||||||||
Sbjct  7548711  AGGTTTCGAGGGTTTCAACTACTCGAACCAGGAAACTTTCGCCAATGACTACGTCAGAAA  7548652

Query  4485     ACATAACCCATTGATTTTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACAT  4544
                 || || |||||| | |||||||| |  |||  ||||||||| || ||||||||||||||
Sbjct  7548651  GCACAATCCATTGGTCTTGTTCGACAGTGTTACCAACAACGAGACCCGTTTGGCTAACAT  7548592

Query  4545     TAAGAACTTTGAAGATTTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTT  4604
                 |||||||||||||| ||| ||  ||| || |  ||| | ||||| ||||||||||| ||
Sbjct  7548591  CAAGAACTTTGAAGACTTCGACGCTGATGTCGCCAACAAGAAGTTGCCTCAATACGCCTT  7548532

Query  4605     CATTACTCCAAATATGACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATG  4664
                ||| || ||||| ||||| |||||||||||||||||||| ||| | || || ||||| ||
Sbjct  7548531  CATCACACCAAACATGACCAACGATGGTCATGACACCACCATCAAGTTCGCCGGTAAGTG  7548472

Query  4665     GTCAAAGGACTTCTTGGCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGT  4724
                | | |||||||||||||  ||||| ||  ||||||| ||||||||| | |||||||| ||
Sbjct  7548471  GGCTAAGGACTTCTTGGAACCATTGTTGCAAAACGAATACTTCATGAACGACACTTTAGT  7548412

Query  4725     CTTGTTGACCTTCGATGAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTT  4784
                ||||||||||||||||||||| ||||||||  | ||||||||||||||||||||| ||||
Sbjct  7548411  CTTGTTGACCTTCGATGAAAACGAAACCTACAGCATCAAGAACAAGGTCTTCTCCGTCTT  7548352

Query  4785     GTTGGGTGGCGTTATCCCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCA  4844
                ||||||||| |||||||| ||    |||||||||||||  ||||| ||||| || |||||
Sbjct  7548351  GTTGGGTGGTGTTATCCCGGACAGCTTGAAGGGTACCACTGATGACACTTTTTACGACCA  7548292

Query  4845     TTACTCTCAATTGGCTAGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGA  4904
                |||| | |||||| | |||||  |||||||||||||||||||||||||||| ||||||||
Sbjct  7548291  TTACACACAATTGTCCAGTGTGCAAGCCAACTGGGATTTGCCTCATTTAGGAAGACACGA  7548232

Query  4905     TGGTGACGCCAATGTTTTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGT  4964
                |   |||||||| |||||| || ||||||| || || || |||||||||||| |||||||
Sbjct  7548231  TTTCGACGCCAACGTTTTGCAACTTGTTGCCAATGCCACTAACATCACCAACCTTGAAGT  7548172

Query  4965     TGACACCACTTACA---TGATCAACGAAACCTATATTGGTTACTTGAACGATTACAACAT  5021
                ||||||||||||||   ||| ||||||||| || || ||||||||||||||    ||| |
Sbjct  7548171  TGACACCACTTACATGGTGAACAACGAAACATACATCGGTTACTTGAACGACCGTAACGT  7548112

Query  5022     TGAATTGCCAGCTCCAAATGTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTC  5081
                |   ||||||||||||||||| || || || ||||||||||||||||| |||||||||||
Sbjct  7548111  TCCTTTGCCAGCTCCAAATGTGACCGCCATCAACAGAAACGGTCAACCTATCTTGGACTC  7548052

Query  5082     CATCAAGGAAACTTGGGAAGATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTC  5141
                | |||||||||| ||||||||||||||    || |||||||||| ||||||||  |||||
Sbjct  7548051  CGTCAAGGAAACCTGGGAAGATGAATACAACAACCAAGTCTCTGCATCCTACTTCACTTC  7547992

Query  5142     CACCACTACTACCGTTTCTGCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCG  5201
                 |||||||||||||||||||| ||||| || |||||||||||| || ||  |||| || |
Sbjct  7547991  TACCACTACTACCGTTTCTGCTGATGTCACCGATGCTGAAACCATCGCC-GTTTCCACTG  7547933

Query  5202     CTACCGACAGTGCTG---ATGAAACTAG------TGCTACCGCTACATCTTCTTCCAACA  5252
                 |||      |||||   | ||| | ||      ||||||  ||||  ||||||||||||
Sbjct  7547932  GTAC---TTCTGCTGGCCACGAAGCCAGTGCTGCTGCTACTACTACTGCTTCTTCCAACA  7547876

Query  5253     GCACTTCTGCTGAAACTTTAAGCTCTTCCGCCGGTGCTCCATCAATGAGCA-CTTCTCCG  5311
                 ||||||| |||     |  ||| |||| || |||||| ||||  |||||| ||| ||||
Sbjct  7547875  CCACTTCTTCTGGTGTCTCCAGCGCTTCTGCAGGTGCTGCATCTTTGAGCACCTTATCCG  7547816

Query  5312     GTAACGTCTTGTTGGGTGTCATTGCTGCCTTTTTCTTAT  5350
                ||||| | || ||||||||  | |||||  | |||||||
Sbjct  7547815  GTAACATTTTCTTGGGTGTTTTGGCTGCTCTATTCTTAT  7547777


 Score = 50.0 bits (54),  Expect = 0.25
 Identities = 40/47 (86%), Gaps = 1/47 (2%)
 Strand=Plus/Plus

Query  278     ACAAACAAAAACTGAAAA-ATGGAAAATAAAAAATGAAAAAGCAAGC  323
               ||||| ||||| |||||| |||||||| ||||  |||||||| ||||
Sbjct  863021  ACAAAGAAAAAATGAAAAAATGGAAAAAAAAATGTGAAAAAGAAAGC  863067


 Score = 48.2 bits (52),  Expect = 0.86
 Identities = 31/34 (92%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  277      CACAAACAAAAACTGAAAAATGGAAAATAAAAAA  310
                ||||||||||| |||||||||  |||||||||||
Sbjct  5965746  CACAAACAAAATCTGAAAAATAAAAAATAAAAAA  5965713


> KLDOg3463
Length=1407

 Score = 1276 bits (1414),  Expect = 0.0
 Identities = 1137/1415 (81%), Gaps = 25/1415 (1%)
 Strand=Plus/Plus

Query  3952  ATGAAATTCTCCGATTTTAGTGTTCTCGGATTAGGTGCTCTTGC-CTTAAATGCCGTTAC  4010
             ||||||||||||||||||||  |  | || || |||||  | |  ||||| | |||||  
Sbjct  1     ATGAAATTCTCCGATTTTAGCCTATTAGGGTTGGGTGCCATAGTGCTTAACT-CCGTTGG  59

Query  4011  CGTCAGTGCTAACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTATCTCTCCAAG  4070
              |||| ||| ||||||||||||||  | ||||||||||||||||||||  | ||||||||
Sbjct  60    TGTCAATGCCAACACTGCTGACACTTCCTTGTTGAGAACTTACTCTACGGTGTCTCCAAG  119

Query  4071  TTTGAGTGAAATTGAATCCGC---CGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGA  4127
             |   ||||  |||||    ||   ||||||    ||||    ||| || |    |||   
Sbjct  120   TGCCAGTGCCATTGAGCAAGCTATCGCTTCC---ACTGTTCCTGCCGAAGAAACTTCCAG  176

Query  4128  TGTCGAAGGTGCCGCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGA  4187
             ||| |||||||| ||||||||||  |||| ||| || | |||||||||||||||||||||
Sbjct  177   TGTTGAAGGTGCTGCTTTCAAGAACTTCTACATCATTTACTTGGAAAACACCGATTACGA  236

Query  4188  CAAGGCTGCTGGTGATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAA  4247
             ||| ||||| ||||| |||  |||| | ||| ||||    |||||||| |||||||||||
Sbjct  237   CAAAGCTGCCGGTGACGAAAGCCTTGCCTGGTTGGCCACTCAAGGTATCACCTTGACCAA  296

Query  4248  CTACTGGGCTTTGACTCACCCTTCAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTA  4307
             |||||||||||||||||| ||||| |||||||||||||||||||| ||   |||||| ||
Sbjct  297   CTACTGGGCTTTGACTCATCCTTCTGAACCAAACTATTTGGCTTCCGTTTCTGGTGACTA  356

Query  4308  CTTCGCCTTGGATGATGACAGATTTATTTCTATGCCATCCAATGTGTCTAACATCGTTGA  4367
             |||||||||||| ||||||||||| ||| |  ||||||| || || || | ||| |||||
Sbjct  357   CTTCGCCTTGGACGATGACAGATTCATTGCCTTGCCATCTAACGTCTCCACCATTGTTGA  416

Query  4368  TTTGTTGGACACTAAGGGTATCTCTTGGGCTGAATACCAAGAACACTCTCCATATGCTGG  4427
              |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||
Sbjct  417   CTTGTTGGACACTAAGGGTATCTCTTGGGCTGAGTACCAAGAACACTCTCCATATGCAGG  476

Query  4428  TTTCCAAGGTATGAACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCAGAAAACA  4487
             |||| | ||| | |||| ||| ||||| || || | ||||| ||| || |||||||| ||
Sbjct  477   TTTCGAGGGTTTCAACTACTCGAACCAGGAAACTTTCGCCAATGACTACGTCAGAAAGCA  536

Query  4488  TAACCCATTGATTTTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAA  4547
              || |||||| | |||||||| |  |||  ||||||||| || |||||||||||||| ||
Sbjct  537   CAATCCATTGGTCTTGTTCGACAGTGTTACCAACAACGAGACCCGTTTGGCTAACATCAA  596

Query  4548  GAACTTTGAAGATTTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCAT  4607
             |||||||||||| ||| ||  ||| || |  ||| | ||||| ||||||||||| |||||
Sbjct  597   GAACTTTGAAGACTTCGACGCTGATGTCGCCAACAAGAAGTTGCCTCAATACGCCTTCAT  656

Query  4608  TACTCCAAATATGACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTC  4667
              || ||||| ||||| |||||||||||||||||||| ||| | || || ||||| ||| |
Sbjct  657   CACACCAAACATGACCAACGATGGTCATGACACCACCATCAAGTTCGCCGGTAAGTGGGC  716

Query  4668  AAAGGACTTCTTGGCTCCATTATTAGAAAACGATTACTTCATGGAGGACACTTTGGTCTT  4727
              |||||||||||||  ||||| ||  ||||||| ||||||||| | |||||||| |||||
Sbjct  717   TAAGGACTTCTTGGAACCATTGTTGCAAAACGAATACTTCATGAACGACACTTTAGTCTT  776

Query  4728  GTTGACCTTCGATGAAAATGAAACCTATGGTATCAAGAACAAGGTCTTCTCCATCTTGTT  4787
             |||||||||||||||||| ||||||||  | ||||||||||||||||||||| |||||||
Sbjct  777   GTTGACCTTCGATGAAAACGAAACCTACAGCATCAAGAACAAGGTCTTCTCCGTCTTGTT  836

Query  4788  GGGTGGCGTTATCCCAGATGAATTGAAGGGTACCAAGGATGATACTTTCTATGACCATTA  4847
             |||||| |||||||| ||    |||||||||||||  ||||| ||||| || ||||||||
Sbjct  837   GGGTGGTGTTATCCCGGACAGCTTGAAGGGTACCACTGATGACACTTTTTACGACCATTA  896

Query  4848  CTCTCAATTGGCTAGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGACACGATGG  4907
             | | |||||| | |||||  |||||||||||||||||||||||||||| |||||||||  
Sbjct  897   CACACAATTGTCCAGTGTGCAAGCCAACTGGGATTTGCCTCATTTAGGAAGACACGATTT  956

Query  4908  TGACGCCAATGTTTTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGA  4967
              |||||||| |||||| || ||||||| || || || |||||||||||| ||||||||||
Sbjct  957   CGACGCCAACGTTTTGCAACTTGTTGCCAATGCCACTAACATCACCAACCTTGAAGTTGA  1016

Query  4968  CACCACTTACA---TGATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGA  5024
             |||||||||||   ||| ||||||||| || || ||||||||||||||    ||| ||  
Sbjct  1017  CACCACTTACATGGTGAACAACGAAACATACATCGGTTACTTGAACGACCGTAACGTTCC  1076

Query  5025  ATTGCCAGCTCCAAATGTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCAT  5084
              ||||||||||||||||| || || || ||||||||||||||||| |||||||||||| |
Sbjct  1077  TTTGCCAGCTCCAAATGTGACCGCCATCAACAGAAACGGTCAACCTATCTTGGACTCCGT  1136

Query  5085  CAAGGAAACTTGGGAAGATGAATATTCTAAGCAAGTCTCTGAATCCTACTATACTTCCAC  5144
             ||||||||| ||||||||||||||    || |||||||||| ||||||||  ||||| ||
Sbjct  1137  CAAGGAAACCTGGGAAGATGAATACAACAACCAAGTCTCTGCATCCTACTTCACTTCTAC  1196

Query  5145  CACTACTACCGTTTCTGCAGATGTTACTGATGCTGAAACCTTCTCCAATTTCTACCGCTA  5204
             |||||||||||||||||| ||||| || |||||||||||| || ||  |||| || | ||
Sbjct  1197  CACTACTACCGTTTCTGCTGATGTCACCGATGCTGAAACCATCGCC-GTTTCCACTGGTA  1255

Query  5205  CCGACAGTGCTG---ATGAAACTAG------TGCTACCGCTACATCTTCTTCCAACAGCA  5255
             |      |||||   | ||| | ||      ||||||  ||||  |||||||||||| ||
Sbjct  1256  C---TTCTGCTGGCCACGAAGCCAGTGCTGCTGCTACTACTACTGCTTCTTCCAACACCA  1312

Query  5256  CTTCTGCTGAAACTTTAAGCTCTTCCGCCGGTGCTCCATCAATGAGCA-CTTCTCCGGTA  5314
             ||||| |||     |  ||| |||| || |||||| ||||  |||||| ||| |||||||
Sbjct  1313  CTTCTTCTGGTGTCTCCAGCGCTTCTGCAGGTGCTGCATCTTTGAGCACCTTATCCGGTA  1372

Query  5315  ACGTCTTGTTGGGTGTCATTGCTGCCTTTTTCTTA  5349
             || | || ||||||||  | |||||  | ||||||
Sbjct  1373  ACATTTTCTTGGGTGTTTTGGCTGCTCTATTCTTA  1407


>gb|JF327849.1| Expression vector LIC-pKLAC-LC2, complete sequence
Length=10526

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6072  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  6013

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6012  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  5953

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5952  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  5893

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5892  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  5833

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5832  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  5773

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5772  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  5713

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5712  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  5653

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  5652  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  5594

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5593  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  5534

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5533  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  5474

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5473  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  5414


 Score =  771 bits (854),  Expect = 0.0
 Identities = 427/427 (100%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9320  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  9261

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9260  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  9201

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9200  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  9141

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9140  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  9081

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9080  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  9021

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9020  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  8961

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8960  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  8901

Query  421   CCCGCGG  427
             |||||||
Sbjct  8900  CCCGCGG  8894


>gb|JF327848.1| Expression vector LIC-pKLAC-LC1, complete sequence
Length=10540

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6086  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  6027

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6026  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  5967

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5966  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  5907

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5906  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  5847

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5846  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  5787

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5786  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  5727

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5726  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  5667

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  5666  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  5608

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5607  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  5548

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5547  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  5488

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5487  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  5428


 Score =  771 bits (854),  Expect = 0.0
 Identities = 427/427 (100%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9334  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  9275

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9274  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  9215

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9214  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  9155

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9154  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  9095

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9094  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  9035

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9034  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  8975

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8974  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  8915

Query  421   CCCGCGG  427
             |||||||
Sbjct  8914  CCCGCGG  8908


>gb|HQ236722.1| Expression vector pKLCF-c, complete sequence
Length=9353

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4899  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  4840

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4839  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  4780

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4779  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  4720

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4719  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  4660

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4659  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  4600

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4599  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  4540

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4539  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  4480

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  4479  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  4421

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4420  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  4361

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4360  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  4301

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4300  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  4241


 Score =  762 bits (844),  Expect = 0.0
 Identities = 425/427 (99%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8147  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  8088

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8087  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  8028

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8027  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  7968

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7967  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  7908

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7907  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  7848

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||
Sbjct  7847  AAATAAAAAATGAAAAAGCAAGCTAAATTCGAAGAAGGGAAAATTCCGCCTTCTGCAACC  7788

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7787  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  7728

Query  421   CCCGCGG  427
             |||||||
Sbjct  7727  CCCGCGG  7721


>gb|HQ214066.1| Expression vector pKLCF-n, complete sequence
Length=9332

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4878  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  4819

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4818  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  4759

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4758  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  4699

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4698  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  4639

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4638  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  4579

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4578  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  4519

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4518  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  4459

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  4458  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  4400

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4399  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  4340

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4339  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  4280

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4279  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  4220


 Score =  762 bits (844),  Expect = 0.0
 Identities = 425/427 (99%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8126  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  8067

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8066  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  8007

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8006  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  7947

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7946  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  7887

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7886  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  7827

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||
Sbjct  7826  AAATAAAAAATGAAAAAGCAAGCTAAATTCGAAGAAGGGAAAATTCCGCCTTCTGCAACC  7767

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7766  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  7707

Query  421   CCCGCGG  427
             |||||||
Sbjct  7706  CCCGCGG  7700


>gb|FJ010198.1| Expression vector pKLAC1-Gluc, complete sequence
Length=9589

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5135  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  5076

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5075  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  5016

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5015  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  4956

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4955  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  4896

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4895  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  4836

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4835  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  4776

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4775  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  4716

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  4715  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  4657

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4656  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  4597

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4596  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  4537

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4536  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  4477


 Score =  771 bits (854),  Expect = 0.0
 Identities = 427/427 (100%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8383  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  8324

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8323  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  8264

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8263  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  8204

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8203  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  8144

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8143  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  8084

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8083  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  8024

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8023  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  7964

Query  421   CCCGCGG  427
             |||||||
Sbjct  7963  CCCGCGG  7957


>gb|FJ010197.1| Expression vector pKLMF-FX, complete sequence
Length=9988

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5534  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  5475

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5474  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  5415

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5414  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  5355

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5354  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  5295

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5294  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  5235

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5234  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  5175

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5174  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  5115

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  5114  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  5056

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5055  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  4996

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4995  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  4936

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4935  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  4876


 Score =  762 bits (844),  Expect = 0.0
 Identities = 425/427 (99%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8782  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  8723

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8722  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  8663

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8662  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  8603

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8602  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  8543

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8542  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  8483

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||
Sbjct  8482  AAATAAAAAATGAAAAAGCAAGCTAAATTCGAAGAAGGGAAAATTCCGCCTTCTGCAACC  8423

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8422  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  8363

Query  421   CCCGCGG  427
             |||||||
Sbjct  8362  CCCGCGG  8356


>gb|FJ010196.1| Expression vector pKLMF-EK, complete sequence
Length=9991

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5537  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  5478

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5477  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  5418

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5417  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  5358

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5357  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  5298

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5297  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  5238

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5237  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  5178

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5177  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  5118

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  5117  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  5059

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5058  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  4999

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4998  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  4939

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4938  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  4879


 Score =  762 bits (844),  Expect = 0.0
 Identities = 425/427 (99%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8785  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  8726

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8725  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  8666

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8665  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  8606

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8605  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  8546

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8545  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  8486

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||
Sbjct  8485  AAATAAAAAATGAAAAAGCAAGCTAAATTCGAAGAAGGGAAAATTCCGCCTTCTGCAACC  8426

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8425  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  8366

Query  421   CCCGCGG  427
             |||||||
Sbjct  8365  CCCGCGG  8359


>gb|EU196354.2| Expression vector pKLAC2, complete sequence
Length=9107

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4653  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  4594

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4593  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  4534

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4533  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  4474

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4473  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  4414

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4413  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  4354

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4353  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  4294

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4293  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  4234

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  4233  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  4175

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4174  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  4115

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4114  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  4055

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4054  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  3995


 Score =  762 bits (844),  Expect = 0.0
 Identities = 425/427 (99%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7901  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  7842

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7841  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  7782

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7781  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  7722

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7721  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  7662

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7661  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  7602

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||
Sbjct  7601  AAATAAAAAATGAAAAAGCAAGCTAAATTCGAAGAAGGGAAAATTCCGCCTTCTGCAACC  7542

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7541  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  7482

Query  421   CCCGCGG  427
             |||||||
Sbjct  7481  CCCGCGG  7475


>gb|AY968582.1| Expression vector pKLAC1, complete sequence
Length=9091

 Score = 1182 bits (1310),  Expect = 0.0
 Identities = 659/660 (99%), Gaps = 1/660 (0%)
 Strand=Plus/Minus

Query  422   CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  481
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4637  CCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGT  4578

Query  482   ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  541
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4577  ATTTTTGCCAATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTG  4518

Query  542   ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  601
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4517  ACTACTGCTTGGCAAGGCAAATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACAT  4458

Query  602   GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  661
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4457  GGTGGGGTGCCTTTTCGGTCCATAAGTGTAACTAGCTAGCTACAAGTATGTTCTGTGCAA  4398

Query  662   AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  721
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4397  AGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTGGACCTGGTCTGACCTGACCTA  4338

Query  722   GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  781
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4337  GCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTACAAATCGGCGA  4278

Query  782   ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  841
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4277  ACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCAC  4218

Query  842   AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGAC  901
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  4217  AGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGAT-GAC  4159

Query  902   AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  961
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4158  AGAAGGCAAGAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACC  4099

Query  962   AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  1021
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4098  AGATTAAGTTCTAGGCCAAGAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAA  4039

Query  1022  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  1081
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4038  AAAAACCTAATTTGACAGTCTCGGAATTTTATCTATCTGTTCCTTTCCTTTGGTTACTAG  3979


 Score =  771 bits (854),  Expect = 0.0
 Identities = 427/427 (100%), Gaps = 0/427 (0%)
 Strand=Plus/Minus

Query  1     GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7885  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  7826

Query  61    GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7825  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  7766

Query  121   CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7765  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  7706

Query  181   ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7705  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  7646

Query  241   TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7645  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  7586

Query  301   AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7585  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  7526

Query  361   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7525  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  7466

Query  421   CCCGCGG  427
             |||||||
Sbjct  7465  CCCGCGG  7459


>emb|X05918.1| Kluyveromyces fragilis beta-glucosidase gene
Length=4193

 Score =  951 bits (1054),  Expect = 0.0
 Identities = 546/553 (99%), Gaps = 4/553 (0%)
 Strand=Plus/Minus

Query  2999  AGATCTAAGGCCCAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAA  3058
             |||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||
Sbjct  4193  AGATCTAAGGCCCAACTCCTCAACATGTTGGTTTCTGGTGTTGCCCAATTTGTTAATCAA  4134

Query  3059  TTTGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTC  3118
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct  4133  TTTGCTACTCCAAAGGCA-TGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTC  4075

Query  3119  TTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGC  3178
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4074  TTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGC  4015

Query  3179  TTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATCCGTTGATCAA  3238
             |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||
Sbjct  4014  TTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGG-ATC-GTTGATCAA  3957

Query  3239  GCATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAAT  3298
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3956  GCATTCTTGGCTCA-GTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAGTTGCAAAT  3898

Query  3299  GCTCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTT  3358
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3897  GCTCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTT  3838

Query  3359  TCAGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTT  3418
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3837  TCAGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTT  3778

Query  3419  TCCGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGT  3478
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3777  TCCGTACTTCATAATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGT  3718

Query  3479  CTTGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAAC  3538
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3717  CTTGTGGAATTCATCAATTAAAAAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAAC  3658

Query  3539  AGTTACTGTTAGA  3551
             |||||||||||||
Sbjct  3657  AGTTACTGTTAGA  3645


>emb|Y09281.1| K.fragilis LAC4 gene, regulatory signal
Length=1969

 Score =  753 bits (834),  Expect = 0.0
 Identities = 419/420 (99%), Gaps = 0/420 (0%)
 Strand=Plus/Minus

Query  1    GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  420  GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCT  361

Query  61   GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  360  GCTCTTTTCTTTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCC  301

Query  121  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  300  CTAAGTCCTTTGAAGATTCGGGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTT  241

Query  181  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  240  ACTTTTGTGGGGGGTGGAAAAGTCGATTAGGATCTTGCAGCACAGAAACTGCGCAGGGGT  181

Query  241  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  180  TTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACAAACAAAAACTGAAAAATGGA  121

Query  301  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACC  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct  120  AAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCCTTCTGCAACG  61

Query  361  ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  60   ACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC  1


> AEAV01000200  Kluyveromyces wickerhamii UCD 54-210 contig00208, 
whole genome shotgun sequence
Length=27421

 Score =  742 bits (822),  Expect = 0.0
 Identities = 1004/1381 (73%), Gaps = 30/1381 (2%)
 Strand=Plus/Minus

Query  1863   CTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATATT  1922
              |||| |||||||| | ||| ||| | || ||||||||||| |||||    || |  || |
Sbjct  20362  CTACCATGCAAGGGTTTGACGGGTCGTTGATGGGTTCTATTTATACGATGGAAGACTACT  20303

Query  1923   TGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTATTT  1982
              || | || ||| | || || || || || ||  ||||||| ||||| ||||| |||||||
Sbjct  20302  TGGATTATTACGACTTAGACATCAATTCGTCTACTGGTACCGGTCTTGTGTTTTCTATTT  20243

Query  1983   TCAACGTTGGTCAAATTTGCGGTGCATTCTTT-GTTCCTCTTATGGATTGGAAAGGTAGA  2041
               |||  | || || ||||| |||||||||||| | || | | |||||||||||||| |||
Sbjct  20242  ACAATATCGGCCAGATTTGTGGTGCATTCTTTTGCTCGT-TGATGGATTGGAAAGGAAGA  20184

Query  2042   AAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTTA  2101
              ||   ||| || ||  |||| |||   |||| |||  | |||||  | ||| |   |   
Sbjct  20183  AAGATTGCCATCTTGGTTGGATGTACCGGTGCTGTCGTCGGTGCCGTGATTACAGGTGCT  20124

Query  2102   ACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAATC  2161
              ||  | || |   |||   | || ||||| ||||||||| |  |||| || ||||| || 
Sbjct  20123  ACTTCTACGAGAGGTGGGCTTATCGGTGGCAGATGGTTCTTATCCTTCTTTGCTACGATT  20064

Query  2162   GCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAAG  2221
              || ||  | || || |||||||| ||||  ||||| |||||| ||||  | |||||||| 
Sbjct  20063  GCAAACTCTGCGGCCCCAACATATTGTGTGGAAGTTGCTCCACCTCATATGAGAGGTAAA  20004

Query  2222   GTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCACT  2281
              ||||| |||||||| |||||  | |||| |||||||||| |    ||||| || |  || 
Sbjct  20003  GTTGCTGGTCTTTACAACACATTGTGGTATGTCGGTTCCTTGACCGCTGCATTCACTACC  19944

Query  2282   TACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTTA  2341
              |||||||| |||||| |  || ||    ||  |||| |||| |||||||| || ||| | 
Sbjct  19943  TACGGTACAAACAAACATCTCGCTGGTACCAGCAAGTCTTTCAAGATTCCTTTGTACGTC  19884

Query  2342   CAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAGA  2401
              |||||| | ||||||||| ||||   ||| ||||| ||| | ||||| || |||||||||
Sbjct  19883  CAAATGGTATTCCCAGGTATTGTTGCTATCTTTGGCTGGCTGATCCCTGAGTCTCCAAGA  19824

Query  2402   TGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCA---C  2458
              ||||| || |||||||| ||||| ||||| |||||  |||||||| |||| || ||   |
Sbjct  19823  TGGTTAGTCGGTGTTGGTCGTGAAGAAGAGGCTCGGAAATTCATTGTCAAGTATCATTGC  19764

Query  2459   TTAAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCT  2518
                 |||| |||   ||  ||||||||| | ||||| || ||||||||||| || ||||| 
Sbjct  19763  GGTAATGACGA---AAACCATCCATTAATTGATATTGAAATGGCAGAAATGATCGAATCA  19707

Query  2519   TTCCATGGTACAGATTTATCAAACCCTCTAGA-AATGTTAGATGTAAGGAGCTTATTCAG  2577
              ||| |  | |   || ||||| | || || || | |  ||||||| ||   ||| |||||
Sbjct  19706  TTCAAGAGCAACAATCTATCAGATCC-CTTGACAGTCATAGATGTCAGACCCTTGTTCAG  19648

Query  2578   AACGAGATCGGATAGGTACAGAGCAATG-TTGGTTATACTTATGGCTTGGTTCGGTCAAT  2636
              ||| | ||| ||  | ||||| ||   | ||  |  ||  ||||||||||||||||||||
Sbjct  19647  AACCAAATCTGACCGTTACAG-GCTGGGTTTAATCGTAGCTATGGCTTGGTTCGGTCAAT  19589

Query  2637   TTTCCGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGA  2696
              | |||||||| ||||| ||||||||||| |||||||||||||| |  || || || ||||
Sbjct  19588  TCTCCGGTAATAATGTTTGTTCGTACTACTTGCCTACCATGTTAACTAAGGTCGGAATGA  19529

Query  2697   --AGAGTGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTC  2754
                   ||||||  |  |||||||| ||||||||||| |||||||| ||  | ||| | ||
Sbjct  19528  CTTCGGTGTCTACT--AATGTGTTGATGAATGGTGTCTATTCCATTGTTTCGTGGGTCTC  19471

Query  2755   TTCAATTTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAG-GGAAGGTTTCCTTGGT-  2812
               ||| |    ||| | |||      |||||| | || |||||   || ||||   || | 
Sbjct  19470  CTCAGTGCTGGGTTCGTTCGCCCACGATAAGGTCGGCAGAAGAAAAATGTTT--ATGTTC  19413

Query  2813   TCTATCTCAGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAG  2872
              || |  | ||| || ||  |||| ||||| ||  || | || ||||| |||||||||  |
Sbjct  19412  TCCACTTTAGGGGCCGCCCTAGCCTTGACCGGGTTAGCCATTTGTACAGCTCGTTAT--G  19355

Query  2873   AAGACTAAGAA--GAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTG  2930
              |||   | | |  | |  |||| ||||| ||| | ||||||||||| ||||| || ||||
Sbjct  19354  AAGTTAATGGATCGGATGGTGCCTCCAAGGGTACCTTGGTGTTCATCTATCTATTCGGTG  19295

Query  2931   GTATCTTTTCTTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAA  2990
                ||||| || ||||| ||||| || |||||| | || ||| || | |||||  |  | |
Sbjct  19294  TCATCTTCTCATTTGCCTTCACCCCTATGCAACCGATTTACCCATCTGAAGTCGCATCCA  19235

Query  2991   ACTTGACGAGATCTAAGGCCCAACTCCTC---AACTTTGTGGTTTCTGGTGTTGCCCAAT  3047
              | ||||  ||||||||||||||  || ||   |||   ||   ||| ||||| ||||| |
Sbjct  19234  ATTTGATCAGATCTAAGGCCCAGTTCGTCTTGAAC---GTCACTTCCGGTGTGGCCCAGT  19178

Query  3048   TTGTTAATCAATTTGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGT  3107
              | || || ||||| ||| |||| ||||||||| | || |||| ||| |||||||| || |
Sbjct  19177  TCGTCAACCAATTCGCTGCTCCTAAGGCAATGCAAAACATCAGATACTGGTTCTACGTAT  19118

Query  3108   TCTACGTTTTCTTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTA  3167
              ||||||| || |||||||| ||||| ||  |  | ||||||||||||||||| ||||| |
Sbjct  19117  TCTACGTGTTTTTCGATATCTTCGAGTTCGTCATCATCTACTTCTTCTTCGTCGAAACCA  19058

Query  3168   AGGGTAGAAGCTTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCAT  3227
              |||| |  | ||| ||||| || ||||  ||||| |||||||| || ||||||||||| |
Sbjct  19057  AGGGCAAGACCTTGGAAGAGTTGGAAGCCGTCTTCGAAGCTCCCAATCCAAGAAAGGCTT  18998

Query  3228   C  3228
              |
Sbjct  18997  C  18997


> KLWIg4168 KLWIg4168 undefined product 8462108:8463787 forward
Length=1680

 Score =  742 bits (822),  Expect = 0.0
 Identities = 1004/1381 (73%), Gaps = 30/1381 (2%)
 Strand=Plus/Plus

Query  1863  CTACTATGCAAGGTTATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATATT  1922
             |||| |||||||| | ||| ||| | || ||||||||||| |||||    || |  || |
Sbjct  203   CTACCATGCAAGGGTTTGACGGGTCGTTGATGGGTTCTATTTATACGATGGAAGACTACT  262

Query  1923  TGAAATACTACCATTTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTATTT  1982
             || | || ||| | || || || || || ||  ||||||| ||||| ||||| |||||||
Sbjct  263   TGGATTATTACGACTTAGACATCAATTCGTCTACTGGTACCGGTCTTGTGTTTTCTATTT  322

Query  1983  TCAACGTTGGTCAAATTTGCGGTGCATTCTTT-GTTCCTCTTATGGATTGGAAAGGTAGA  2041
              |||  | || || ||||| |||||||||||| | || | | |||||||||||||| |||
Sbjct  323   ACAATATCGGCCAGATTTGTGGTGCATTCTTTTGCTCGT-TGATGGATTGGAAAGGAAGA  381

Query  2042  AAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTTA  2101
             ||   ||| || ||  |||| |||   |||| |||  | |||||  | ||| |   |   
Sbjct  382   AAGATTGCCATCTTGGTTGGATGTACCGGTGCTGTCGTCGGTGCCGTGATTACAGGTGCT  441

Query  2102  ACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAATC  2161
             ||  | || |   |||   | || ||||| ||||||||| |  |||| || ||||| || 
Sbjct  442   ACTTCTACGAGAGGTGGGCTTATCGGTGGCAGATGGTTCTTATCCTTCTTTGCTACGATT  501

Query  2162  GCTAATGCAGCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAAG  2221
             || ||  | || || |||||||| ||||  ||||| |||||| ||||  | |||||||| 
Sbjct  502   GCAAACTCTGCGGCCCCAACATATTGTGTGGAAGTTGCTCCACCTCATATGAGAGGTAAA  561

Query  2222  GTTGCAGGTCTTTATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCACT  2281
             ||||| |||||||| |||||  | |||| |||||||||| |    ||||| || |  || 
Sbjct  562   GTTGCTGGTCTTTACAACACATTGTGGTATGTCGGTTCCTTGACCGCTGCATTCACTACC  621

Query  2282  TACGGTACCAACAAAAACTTCCCTAACTCCTCCAAGGCTTTTAAGATTCCATTATACTTA  2341
             |||||||| |||||| |  || ||    ||  |||| |||| |||||||| || ||| | 
Sbjct  622   TACGGTACAAACAAACATCTCGCTGGTACCAGCAAGTCTTTCAAGATTCCTTTGTACGTC  681

Query  2342  CAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAGA  2401
             |||||| | ||||||||| ||||   ||| ||||| ||| | ||||| || |||||||||
Sbjct  682   CAAATGGTATTCCCAGGTATTGTTGCTATCTTTGGCTGGCTGATCCCTGAGTCTCCAAGA  741

Query  2402  TGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCA---C  2458
             ||||| || |||||||| ||||| ||||| |||||  |||||||| |||| || ||   |
Sbjct  742   TGGTTAGTCGGTGTTGGTCGTGAAGAAGAGGCTCGGAAATTCATTGTCAAGTATCATTGC  801

Query  2459  TTAAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCT  2518
                |||| |||   ||  ||||||||| | ||||| || ||||||||||| || ||||| 
Sbjct  802   GGTAATGACGA---AAACCATCCATTAATTGATATTGAAATGGCAGAAATGATCGAATCA  858

Query  2519  TTCCATGGTACAGATTTATCAAACCCTCTAGA-AATGTTAGATGTAAGGAGCTTATTCAG  2577
             ||| |  | |   || ||||| | || || || | |  ||||||| ||   ||| |||||
Sbjct  859   TTCAAGAGCAACAATCTATCAGATCC-CTTGACAGTCATAGATGTCAGACCCTTGTTCAG  917

Query  2578  AACGAGATCGGATAGGTACAGAGCAATG-TTGGTTATACTTATGGCTTGGTTCGGTCAAT  2636
             ||| | ||| ||  | ||||| ||   | ||  |  ||  ||||||||||||||||||||
Sbjct  918   AACCAAATCTGACCGTTACAG-GCTGGGTTTAATCGTAGCTATGGCTTGGTTCGGTCAAT  976

Query  2637  TTTCCGGTAACAATGTGTGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGA  2696
             | |||||||| ||||| ||||||||||| |||||||||||||| |  || || || ||||
Sbjct  977   TCTCCGGTAATAATGTTTGTTCGTACTACTTGCCTACCATGTTAACTAAGGTCGGAATGA  1036

Query  2697  --AGAGTGTCTCATTGAATGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTC  2754
                  ||||||  |  |||||||| ||||||||||| |||||||| ||  | ||| | ||
Sbjct  1037  CTTCGGTGTCTACT--AATGTGTTGATGAATGGTGTCTATTCCATTGTTTCGTGGGTCTC  1094

Query  2755  TTCAATTTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAG-GGAAGGTTTCCTTGGT-  2812
              ||| |    ||| | |||      |||||| | || |||||   || ||||   || | 
Sbjct  1095  CTCAGTGCTGGGTTCGTTCGCCCACGATAAGGTCGGCAGAAGAAAAATGTTT--ATGTTC  1152

Query  2813  TCTATCTCAGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAG  2872
             || |  | ||| || ||  |||| ||||| ||  || | || ||||| |||||||||  |
Sbjct  1153  TCCACTTTAGGGGCCGCCCTAGCCTTGACCGGGTTAGCCATTTGTACAGCTCGTTAT--G  1210

Query  2873  AAGACTAAGAA--GAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTG  2930
             |||   | | |  | |  |||| ||||| ||| | ||||||||||| ||||| || ||||
Sbjct  1211  AAGTTAATGGATCGGATGGTGCCTCCAAGGGTACCTTGGTGTTCATCTATCTATTCGGTG  1270

Query  2931  GTATCTTTTCTTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAA  2990
               ||||| || ||||| ||||| || |||||| | || ||| || | |||||  |  | |
Sbjct  1271  TCATCTTCTCATTTGCCTTCACCCCTATGCAACCGATTTACCCATCTGAAGTCGCATCCA  1330

Query  2991  ACTTGACGAGATCTAAGGCCCAACTCCTC---AACTTTGTGGTTTCTGGTGTTGCCCAAT  3047
             | ||||  ||||||||||||||  || ||   |||   ||   ||| ||||| ||||| |
Sbjct  1331  ATTTGATCAGATCTAAGGCCCAGTTCGTCTTGAAC---GTCACTTCCGGTGTGGCCCAGT  1387

Query  3048  TTGTTAATCAATTTGCTACTCCAAAGGCAATGAAGAATATCAAATATTGGTTCTATGTGT  3107
             | || || ||||| ||| |||| ||||||||| | || |||| ||| |||||||| || |
Sbjct  1388  TCGTCAACCAATTCGCTGCTCCTAAGGCAATGCAAAACATCAGATACTGGTTCTACGTAT  1447

Query  3108  TCTACGTTTTCTTCGATATTTTCGAATTTATTGTTATCTACTTCTTCTTCGTTGAAACTA  3167
             ||||||| || |||||||| ||||| ||  |  | ||||||||||||||||| ||||| |
Sbjct  1448  TCTACGTGTTTTTCGATATCTTCGAGTTCGTCATCATCTACTTCTTCTTCGTCGAAACCA  1507

Query  3168  AGGGTAGAAGCTTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCAT  3227
             |||| |  | ||| ||||| || ||||  ||||| |||||||| || ||||||||||| |
Sbjct  1508  AGGGCAAGACCTTGGAAGAGTTGGAAGCCGTCTTCGAAGCTCCCAATCCAAGAAAGGCTT  1567

Query  3228  C  3228
             |
Sbjct  1568  C  1568


> AEAS01000242  Kluyveromyces aestuarii ATCC 18862 contig00543, 
whole genome shotgun sequence
Length=56607

 Score =  650 bits (720),  Expect = 0.0
 Identities = 998/1416 (71%), Gaps = 8/1416 (0%)
 Strand=Plus/Plus

Query  1817   CAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTGTGCTACTATGCAAGGT  1876
              |||||||  |||||||||||  | ||||| ||    ||  | ||| |||| |||||||||
Sbjct  24941  CAATATTGGAAATTGTACGGCATGTGTTTCATTGTTTACTTCTGTTCTACAATGCAAGGT  25000

Query  1877   TATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATATTTGAAATACTACCAT  1936
              || |||||| | |||||||| ||||| |||||    || || |||||||| |||||| ||
Sbjct  25001  TACGATGGGTCATTAATGGGGTCTATTTATACGATGGAAGCGTATTTGAAGTACTACAAT  25060

Query  1937   TTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTATTTTCAACGTTGGTCAA  1996
              |||||| | ||||| ||| | || || || || || || || |||| |||| | || |||
Sbjct  25061  TTGGATGTGAACTCCTCCACCGGAACAGGGCTTGTTTTTTCAATTTACAACATAGGACAA  25120

Query  1997   ATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAGAAAACCTGCTATTTTA  2056
              || |||||||||||||||||| |  | ||||| |||||||||||||| ||||||||||||
Sbjct  25121  ATCTGCGGTGCATTCTTTGTTTCATTAATGGACTGGAAAGGTAGAAAGCCTGCTATTTTA  25180

Query  2057   ATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTTAACAACAACAAAGAGT  2116
               | || ||| | ||||||||| |||  || |||||  |  ||   ||| | || ||  ||
Sbjct  25181  GTGGGTTGTTTCGGTGTTGTTGTTGCGGCAATTATAACTGCTGCCACATCTACTAAAGGT  25240

Query  2117   GCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAATCGCTAATG--CAGCAG  2174
              || || |||||||||||||||||  ||||||||   ||||| || ||  |||  | ||||
Sbjct  25241  GCTTTGATTGGTGGTAGATGGTTATTGGCCTTTGCTGCTACCATTGC--ATGCTCTGCAG  25298

Query  2175   CTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAAGGTTGCAGGTCTTT  2234
              ||||||  || ||||  || ||||||||||| ||  | ||||||||||| || ||| | |
Sbjct  25299  CTCCAAGCTATTGTGTGGAGGTGGCTCCAGCACATATGAGAGGTAAGGTGGCTGGTTTAT  25358

Query  2235   ATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCACTTACGGTACCAACA  2294
              | || || || |||| ||  || ||  | || || || |||||  |||| ||| |  |  
Sbjct  25359  ACAATACGCTATGGTATGCGGGCTCATTGGTCGCAGCTTTTAGTGCTTATGGTGCAGAGC  25418

Query  2295   AAAACTTCCCTAACTCCTCCAA-GGCTTTTAAGATTCCATTATACTTACAAATGATGTTC  2353
                 ||  ||||      ||||| | |||||||| | |||||||   | ||| | ||||| 
Sbjct  25419  TCCACCACCCT-GGAGATCCAATGTCTTTTAAGCTACCATTATGGCTTCAACTTATGTTT  25477

Query  2354   CCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAGATGGTTGGTTGGT  2413
              |||    | || ||||| ||||| ||| |  | || ||||| || |||||||||||||||
Sbjct  25478  CCATCGTTAGTTTGTATCTTTGGATGGATTCTGCCGGAATCACCTAGATGGTTGGTTGGT  25537

Query  2414   GTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTTAAATGGCGATAGA  2473
              || || ||||| || |||||| |  |||| |||  |||||| || |  || || |||  |
Sbjct  25538  GTGGGACGTGAAGAGGAAGCTAGGAAATTTATTGCCAAATATCATTGCAACGGTGATGAA  25597

Query  2474   ACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTTCCATGGTACAGAT  2533
               |||||||  || | ||| | || || || ||||| |||||||||||||| ||     | 
Sbjct  25598  TCTCATCCTCTAATTGATGTTGAAATTGCTGAAATGATAGAATCTTTCCAAGGCGTTAAA  25657

Query  2534   TTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAACGAGATCGGATAGG  2593
              ||  |  ||||  |     |||| ||| | |||  | |  ||||||| |||||  || | 
Sbjct  25658  TTGGCTGACCCAATCAGGGTGTTGGATTTGAGGCCCCTTGTCAGAACAAGATCCAATCGT  25717

Query  2594   TACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTCCGGTAACAATGTG  2653
              || ||| |     | ||| |    ||||| ||||| |||||||| || ||||||||||| 
Sbjct  25718  TATAGAACGGGTCTAGTTGTTGCAATGGCATGGTTTGGTCAATTCTCTGGTAACAATGTC  25777

Query  2654   TGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAGT-GTCTCATTGAA  2712
              || || || ||||| || || ||| | | |||||| || ||||    |  |  || | ||
Sbjct  25778  TGCTCTTATTATTTACCAACTATGCTAACAAATGTCGGCATGACTTCTACTAGCACT-AA  25836

Query  2713   TGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAATTTGCGGTGCATT  2772
              ||| |||||||||||| |||| ||||| ||  | |||  | | || || |||||| ||||
Sbjct  25837  TGTCTTAATGAATGGTATTTACTCCATTGTTTCATGGGCTGCGTCTATCTGCGGTTCATT  25896

Query  2773   CTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTCAGGTGCTGCATT  2832
                 |  ||| ||  |||| |||||  ||   ||  | ||||| |  | |||| ||||  |
Sbjct  25897  TGCTCATGACAAAGTTGGAAGAAGAAAAATGTTTATGGGTTCCACTTTAGGTTCTGCTCT  25956

Query  2833   AGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAAGAAGAAGAGTGC  2892
              |||  | || ||  || |||| | ||||||| | |   ||   ||   |    |  | ||
Sbjct  25957  AGCTCTTACTGGCTTAGCTATTTCTACTGCTAGATTCAAGGCTACCGGGTCTGACGGAGC  26016

Query  2893   TTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTCTTTTGCTTTCAC  2952
               || | |||| |||| || ||||| |||||||||||||   | || ||||| || || ||
Sbjct  26017  CTCAACTGGTACATTAGTTTTCATCTATCTCTTTGGTGTCGTATTCTCTTTCGCCTTTAC  26076

Query  2953   TCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAGATCTAAGGCCCA  3012
              |||||||||  |||| ||| || | || || ||| | ||  |    ||||| ||  | ||
Sbjct  26077  TCCAATGCAGCCCATCTACCCATCTGAGGTTTCTTCCAATCTACTAAGATCAAAATCTCA  26136

Query  3013   ACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATTTGCTACTCCAAA  3072
              | |  |      |||     ||||||| || |||||||| ||||| |||||  | |||||
Sbjct  26137  ATTAGTTTTGAATGTCACCGCTGGTGTGGCTCAATTTGTCAATCAGTTTGCCGCACCAAA  26196

Query  3073   GGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTTCGATATTTTCGA  3132
              ||| ||| | || ||||  ||||||||||| ||||| ||||||||||| || || || ||
Sbjct  26197  GGCTATGCAAAACATCAGTTATTGGTTCTACGTGTTTTACGTTTTCTTTGACATATTTGA  26256

Query  3133   ATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTTAGAAGAATTAGA  3192
               ||  |  || | || |||||||| || || || ||||||  |  |||||||||  | ||
Sbjct  26257  GTTCTTCATTGTTTATTTCTTCTTTGTCGAGACAAAGGGTTTATCCTTAGAAGAGCTTGA  26316

Query  3193   AGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATC  3228
               ||| | || || |||||||| |||||||| || ||
Sbjct  26317  TGTTATTTTCGATGCTCCAAATCCAAGAAAAGCCTC  26352


> KLAEg3794 KLAEg3794 undefined product 8015797:8017485 forward
Length=1689

 Score =  650 bits (720),  Expect = 0.0
 Identities = 998/1416 (71%), Gaps = 8/1416 (0%)
 Strand=Plus/Plus

Query  1817  CAATATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTGTGCTACTATGCAAGGT  1876
             |||||||  |||||||||||  | ||||| ||    ||  | ||| |||| |||||||||
Sbjct  163   CAATATTGGAAATTGTACGGCATGTGTTTCATTGTTTACTTCTGTTCTACAATGCAAGGT  222

Query  1877  TATGATGGGGCTTTAATGGGTTCTATCTATACCGAAGATGCATATTTGAAATACTACCAT  1936
             || |||||| | |||||||| ||||| |||||    || || |||||||| |||||| ||
Sbjct  223   TACGATGGGTCATTAATGGGGTCTATTTATACGATGGAAGCGTATTTGAAGTACTACAAT  282

Query  1937  TTGGATATTAACTCATCCTCTGGTACTGGTCTAGTGTTCTCTATTTTCAACGTTGGTCAA  1996
             |||||| | ||||| ||| | || || || || || || || |||| |||| | || |||
Sbjct  283   TTGGATGTGAACTCCTCCACCGGAACAGGGCTTGTTTTTTCAATTTACAACATAGGACAA  342

Query  1997  ATTTGCGGTGCATTCTTTGTTCCTCTTATGGATTGGAAAGGTAGAAAACCTGCTATTTTA  2056
             || |||||||||||||||||| |  | ||||| |||||||||||||| ||||||||||||
Sbjct  343   ATCTGCGGTGCATTCTTTGTTTCATTAATGGACTGGAAAGGTAGAAAGCCTGCTATTTTA  402

Query  2057  ATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTTAACAACAACAAAGAGT  2116
              | || ||| | ||||||||| |||  || |||||  |  ||   ||| | || ||  ||
Sbjct  403   GTGGGTTGTTTCGGTGTTGTTGTTGCGGCAATTATAACTGCTGCCACATCTACTAAAGGT  462

Query  2117  GCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAATCGCTAATG--CAGCAG  2174
             || || |||||||||||||||||  ||||||||   ||||| || ||  |||  | ||||
Sbjct  463   GCTTTGATTGGTGGTAGATGGTTATTGGCCTTTGCTGCTACCATTGC--ATGCTCTGCAG  520

Query  2175  CTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAAGGTTGCAGGTCTTT  2234
             ||||||  || ||||  || ||||||||||| ||  | ||||||||||| || ||| | |
Sbjct  521   CTCCAAGCTATTGTGTGGAGGTGGCTCCAGCACATATGAGAGGTAAGGTGGCTGGTTTAT  580

Query  2235  ATAACACCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCACTTACGGTACCAACA  2294
             | || || || |||| ||  || ||  | || || || |||||  |||| ||| |  |  
Sbjct  581   ACAATACGCTATGGTATGCGGGCTCATTGGTCGCAGCTTTTAGTGCTTATGGTGCAGAGC  640

Query  2295  AAAACTTCCCTAACTCCTCCAA-GGCTTTTAAGATTCCATTATACTTACAAATGATGTTC  2353
                ||  ||||      ||||| | |||||||| | |||||||   | ||| | ||||| 
Sbjct  641   TCCACCACCCT-GGAGATCCAATGTCTTTTAAGCTACCATTATGGCTTCAACTTATGTTT  699

Query  2354  CCAGGTCTTGTGTGTATATTTGGTTGGTTAATCCCAGAATCTCCAAGATGGTTGGTTGGT  2413
             |||    | || ||||| ||||| ||| |  | || ||||| || |||||||||||||||
Sbjct  700   CCATCGTTAGTTTGTATCTTTGGATGGATTCTGCCGGAATCACCTAGATGGTTGGTTGGT  759

Query  2414  GTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCAAATACCACTTAAATGGCGATAGA  2473
             || || ||||| || |||||| |  |||| |||  |||||| || |  || || |||  |
Sbjct  760   GTGGGACGTGAAGAGGAAGCTAGGAAATTTATTGCCAAATATCATTGCAACGGTGATGAA  819

Query  2474  ACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTTCCATGGTACAGAT  2533
              |||||||  || | ||| | || || || ||||| |||||||||||||| ||     | 
Sbjct  820   TCTCATCCTCTAATTGATGTTGAAATTGCTGAAATGATAGAATCTTTCCAAGGCGTTAAA  879

Query  2534  TTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAACGAGATCGGATAGG  2593
             ||  |  ||||  |     |||| ||| | |||  | |  ||||||| |||||  || | 
Sbjct  880   TTGGCTGACCCAATCAGGGTGTTGGATTTGAGGCCCCTTGTCAGAACAAGATCCAATCGT  939

Query  2594  TACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTCCGGTAACAATGTG  2653
             || ||| |     | ||| |    ||||| ||||| |||||||| || ||||||||||| 
Sbjct  940   TATAGAACGGGTCTAGTTGTTGCAATGGCATGGTTTGGTCAATTCTCTGGTAACAATGTC  999

Query  2654  TGTTCGTACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAGT-GTCTCATTGAA  2712
             || || || ||||| || || ||| | | |||||| || ||||    |  |  || | ||
Sbjct  1000  TGCTCTTATTATTTACCAACTATGCTAACAAATGTCGGCATGACTTCTACTAGCACT-AA  1058

Query  2713  TGTGTTAATGAATGGTGTTTATTCCATCGTCACTTGGATTTCTTCAATTTGCGGTGCATT  2772
             ||| |||||||||||| |||| ||||| ||  | |||  | | || || |||||| ||||
Sbjct  1059  TGTCTTAATGAATGGTATTTACTCCATTGTTTCATGGGCTGCGTCTATCTGCGGTTCATT  1118

Query  2773  CTTTATTGATAAGATTGGTAGAAGGGAAGGTTTCCTTGGTTCTATCTCAGGTGCTGCATT  2832
                |  ||| ||  |||| |||||  ||   ||  | ||||| |  | |||| ||||  |
Sbjct  1119  TGCTCATGACAAAGTTGGAAGAAGAAAAATGTTTATGGGTTCCACTTTAGGTTCTGCTCT  1178

Query  2833  AGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATGAGAAGACTAAGAAGAAGAGTGC  2892
             |||  | || ||  || |||| | ||||||| | |   ||   ||   |    |  | ||
Sbjct  1179  AGCTCTTACTGGCTTAGCTATTTCTACTGCTAGATTCAAGGCTACCGGGTCTGACGGAGC  1238

Query  2893  TTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTCTTTTGCTTTCAC  2952
              || | |||| |||| || ||||| |||||||||||||   | || ||||| || || ||
Sbjct  1239  CTCAACTGGTACATTAGTTTTCATCTATCTCTTTGGTGTCGTATTCTCTTTCGCCTTTAC  1298

Query  2953  TCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAGATCTAAGGCCCA  3012
             |||||||||  |||| ||| || | || || ||| | ||  |    ||||| ||  | ||
Sbjct  1299  TCCAATGCAGCCCATCTACCCATCTGAGGTTTCTTCCAATCTACTAAGATCAAAATCTCA  1358

Query  3013  ACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATTTGCTACTCCAAA  3072
             | |  |      |||     ||||||| || |||||||| ||||| |||||  | |||||
Sbjct  1359  ATTAGTTTTGAATGTCACCGCTGGTGTGGCTCAATTTGTCAATCAGTTTGCCGCACCAAA  1418

Query  3073  GGCAATGAAGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTTCGATATTTTCGA  3132
             ||| ||| | || ||||  ||||||||||| ||||| ||||||||||| || || || ||
Sbjct  1419  GGCTATGCAAAACATCAGTTATTGGTTCTACGTGTTTTACGTTTTCTTTGACATATTTGA  1478

Query  3133  ATTTATTGTTATCTACTTCTTCTTCGTTGAAACTAAGGGTAGAAGCTTAGAAGAATTAGA  3192
              ||  |  || | || |||||||| || || || ||||||  |  |||||||||  | ||
Sbjct  1479  GTTCTTCATTGTTTATTTCTTCTTTGTCGAGACAAAGGGTTTATCCTTAGAAGAGCTTGA  1538

Query  3193  AGTTGTCTTTGAAGCTCCAAACCCAAGAAAGGCATC  3228
              ||| | || || |||||||| |||||||| || ||
Sbjct  1539  TGTTATTTTCGATGCTCCAAATCCAAGAAAAGCCTC  1574


>dbj|AB293446.1| Saccharomyces cerevisiae gene for aquaporin Aqy1, complete cds, 
clone: COS5
Length=45016

 Score =  589 bits (652),  Expect = 1e-163
 Identities = 326/326 (100%), Gaps = 0/326 (0%)
 Strand=Plus/Plus

Query  6802   TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6861
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  40730  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  40789

Query  6862   CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6921
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  40790  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  40849

Query  6922   GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6981
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  40850  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  40909

Query  6982   CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  7041
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  40910  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  40969

Query  7042   TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  7101
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  40970  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  41029

Query  7102   GCTGGGCTACGTCTTGCTGGCGTTCG  7127
              ||||||||||||||||||||||||||
Sbjct  41030  GCTGGGCTACGTCTTGCTGGCGTTCG  41055


>dbj|AB293445.1| Saccharomyces cerevisiae gene for aquaporin Aqy1, complete cds, 
clone: COS4
Length=43682

 Score =  589 bits (652),  Expect = 1e-163
 Identities = 326/326 (100%), Gaps = 0/326 (0%)
 Strand=Plus/Minus

Query  6802  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6861
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5895  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  5836

Query  6862  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6921
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5835  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  5776

Query  6922  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6981
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5775  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  5716

Query  6982  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  7041
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5715  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  5656

Query  7042  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  7101
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5655  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  5596

Query  7102  GCTGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||||
Sbjct  5595  GCTGGGCTACGTCTTGCTGGCGTTCG  5570


>gb|AF288620.1| Cloning vector pdeltaE1sp1A(CMV-GFP), complete sequence
Length=8068

 Score =  589 bits (652),  Expect = 1e-163
 Identities = 326/326 (100%), Gaps = 0/326 (0%)
 Strand=Plus/Plus

Query  6802  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6861
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4331  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  4390

Query  6862  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6921
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4391  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  4450

Query  6922  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6981
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4451  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  4510

Query  6982  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  7041
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4511  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  4570

Query  7042  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  7101
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4571  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  4630

Query  7102  GCTGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||||
Sbjct  4631  GCTGGGCTACGTCTTGCTGGCGTTCG  4656


>gb|AY131236.1| Adenoviral vector Ad-SAR1-x/ASX, complete sequence
Length=8401

 Score =  589 bits (652),  Expect = 1e-163
 Identities = 326/326 (100%), Gaps = 0/326 (0%)
 Strand=Plus/Plus

Query  6802  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6861
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4664  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  4723

Query  6862  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6921
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4724  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  4783

Query  6922  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6981
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4784  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  4843

Query  6982  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  7041
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4844  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  4903

Query  7042  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  7101
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4904  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  4963

Query  7102  GCTGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||||
Sbjct  4964  GCTGGGCTACGTCTTGCTGGCGTTCG  4989


>gb|M99566.1|SYNSCOS sCos cloning vector SfiI containing bacteriophage promoters and 
flanking restriction sites in sCos vectors
Length=7937

 Score =  589 bits (652),  Expect = 1e-163
 Identities = 326/326 (100%), Gaps = 0/326 (0%)
 Strand=Plus/Plus

Query  6802  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6861
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2228  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  2287

Query  6862  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6921
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2288  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  2347

Query  6922  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6981
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2348  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  2407

Query  6982  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  7041
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2408  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  2467

Query  7042  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  7101
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2468  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  2527

Query  7102  GCTGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||||
Sbjct  2528  GCTGGGCTACGTCTTGCTGGCGTTCG  2553


>gb|AF136442.1|AF136442 Cloning vector pScosBC1, E. coli-Burkholderia shuttle cosmid 
vector, complete sequence
Length=8772

 Score =  589 bits (652),  Expect = 1e-163
 Identities = 326/326 (100%), Gaps = 0/326 (0%)
 Strand=Plus/Plus

Query  6802  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6861
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2228  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  2287

Query  6862  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6921
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2288  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  2347

Query  6922  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6981
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2348  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  2407

Query  6982  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  7041
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2408  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  2467

Query  7042  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  7101
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2468  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  2527

Query  7102  GCTGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||||
Sbjct  2528  GCTGGGCTACGTCTTGCTGGCGTTCG  2553


>gb|AF129504.1|AF129504 Cloning vector pWDYcos1.0.1, complete sequence
Length=7478

 Score =  589 bits (652),  Expect = 1e-163
 Identities = 326/326 (100%), Gaps = 0/326 (0%)
 Strand=Plus/Plus

Query  6802  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6861
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6049  TCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGG  6108

Query  6862  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6921
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6109  CATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGT  6168

Query  6922  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6981
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6169  GCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGAT  6228

Query  6982  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  7041
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6229  CGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGG  6288

Query  7042  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  7101
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6289  TCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGC  6348

Query  7102  GCTGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||||
Sbjct  6349  GCTGGGCTACGTCTTGCTGGCGTTCG  6374


>gb|U13189.1|CVU13189 Cloning vector pYACneo, complete sequence
Length=15827

 Score =  587 bits (650),  Expect = 4e-163
 Identities = 325/325 (100%), Gaps = 0/325 (0%)
 Strand=Plus/Plus

Query  6803  CCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGC  6862
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4762  CCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGC  4821

Query  6863  ATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTG  6922
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4822  ATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTG  4881

Query  6923  CCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATC  6982
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4882  CCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATC  4941

Query  6983  GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  7042
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4942  GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  5001

Query  7043  CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  7102
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5002  CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  5061

Query  7103  CTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||
Sbjct  5062  CTGGGCTACGTCTTGCTGGCGTTCG  5086


>gb|HQ343239.1| Synthetic construct clone pSB4316, complete sequence
Length=7044

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3332  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3391

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3392  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3451

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3452  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3511

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3512  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3571

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3572  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3631

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3632  TGGGCTACGTCTTGCTGGCGTTCG  3655


>gb|HQ343238.1| Synthetic construct clone pSB4288, complete sequence
Length=7326

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3614  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3673

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3674  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3733

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3734  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3793

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3794  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3853

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3854  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3913

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3914  TGGGCTACGTCTTGCTGGCGTTCG  3937


>gb|HQ343237.1| Synthetic construct clone pSB4284, complete sequence
Length=7152

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3440  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3499

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3500  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3559

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3560  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3619

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3620  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3679

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3680  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3739

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3740  TGGGCTACGTCTTGCTGGCGTTCG  3763


>gb|HQ343236.1| Synthetic construct clone pSB4281, complete sequence
Length=7086

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3374  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3433

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3434  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3493

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3494  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3553

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3554  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3613

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3614  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3673

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3674  TGGGCTACGTCTTGCTGGCGTTCG  3697


>gb|HQ343235.1| Expression vector pSB3941, complete sequence
Length=6786

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3074  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3133

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3134  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3193

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3194  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3253

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3254  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3313

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3314  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3373

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3374  TGGGCTACGTCTTGCTGGCGTTCG  3397


>gb|EU421723.1| Cloning vector pSB4234, complete sequence
Length=6828

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3116  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3175

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3176  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3235

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3236  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3295

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3296  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3355

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3356  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3415

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3416  TGGGCTACGTCTTGCTGGCGTTCG  3439


>gb|EF456738.1| Expression vector pET15-MHL, complete sequence
Length=7737

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Minus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3713  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3654

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3653  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3594

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3593  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3534

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3533  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3474

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3473  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3414

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3413  TGGGCTACGTCTTGCTGGCGTTCG  3390


>gb|EF456736.1| Expression vector p15TV-L, complete sequence
Length=7746

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Minus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3713  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3654

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3653  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3594

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3593  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3534

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3533  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3474

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3473  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3414

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3413  TGGGCTACGTCTTGCTGGCGTTCG  3390


>gb|EF028675.1| Cloning vector pDV-NTAP-CYFP, complete sequence
Length=8003

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7653  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7594

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7593  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7534

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7533  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  7474

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7473  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7414

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7413  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7354

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  7353  CGCTGGGCTACGTCTTGCTGGCGTTCG  7327


>gb|EF028674.1| Cloning vector pDV-NTAP-CGFP, complete sequence
Length=8003

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7653  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7594

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7593  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7534

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7533  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  7474

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7473  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7414

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7413  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7354

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  7353  CGCTGGGCTACGTCTTGCTGGCGTTCG  7327


>gb|EF028673.1| Cloning vector pDV-CYFP-CTAP, complete sequence
Length=8021

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7671  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7612

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7611  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7552

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7551  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  7492

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7491  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7432

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7431  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7372

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  7371  CGCTGGGCTACGTCTTGCTGGCGTTCG  7345


>gb|EF028672.1| Cloning vector pDV-CGFP-CTAP, complete sequence
Length=8021

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7671  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7612

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7611  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7552

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7551  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  7492

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7491  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7432

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7431  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7372

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  7371  CGCTGGGCTACGTCTTGCTGGCGTTCG  7345


>gb|EF028671.1| Cloning vector pDV-NYFP-CTAP, complete sequence
Length=8021

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7671  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7612

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7611  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7552

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7551  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  7492

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7491  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7432

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7431  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7372

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  7371  CGCTGGGCTACGTCTTGCTGGCGTTCG  7345


>gb|EF028670.1| Cloning vector pDV-NTAP-NYFP, complete sequence
Length=8003

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7653  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7594

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7593  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7534

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7533  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  7474

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7473  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7414

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7413  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7354

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  7353  CGCTGGGCTACGTCTTGCTGGCGTTCG  7327


>gb|EF028669.1| Cloning vector pDV-CTAP, complete sequence
Length=7307

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6957  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6898

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6897  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6838

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6837  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6778

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6777  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  6718

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6717  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  6658

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  6657  CGCTGGGCTACGTCTTGCTGGCGTTCG  6631


>gb|EF028668.1| Cloning vector pDV-CYFP, complete sequence
Length=7475

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7125  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7066

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7065  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7006

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7005  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6946

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6945  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  6886

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6885  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  6826

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  6825  CGCTGGGCTACGTCTTGCTGGCGTTCG  6799


>gb|EF028667.1| Cloning vector pDV-CGFP, complete sequence
Length=7475

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7125  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7066

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7065  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7006

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7005  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6946

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6945  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  6886

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6885  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  6826

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  6825  CGCTGGGCTACGTCTTGCTGGCGTTCG  6799


>gb|EF028666.1| Cloning vector pDV-NTAP, complete sequence
Length=7289

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6939  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6880

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6879  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6820

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6819  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6760

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6759  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  6700

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6699  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  6640

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  6639  CGCTGGGCTACGTCTTGCTGGCGTTCG  6613


>gb|EF028665.1| Cloning vector pDV-NYFP, complete sequence
Length=7475

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7125  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  7066

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7065  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  7006

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7005  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6946

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6945  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  6886

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6885  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  6826

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  6825  CGCTGGGCTACGTCTTGCTGGCGTTCG  6799


>gb|EF028664.1| Cloning vector EXP5(+), complete sequence
Length=6761

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6411  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6352

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6351  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6292

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6291  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6232

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6231  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  6172

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6171  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  6112

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  6111  CGCTGGGCTACGTCTTGCTGGCGTTCG  6085


>gb|EF028663.1| Cloning vector EXP4(+), complete sequence
Length=6724

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 326/327 (99%), Gaps = 0/327 (0%)
 Strand=Plus/Minus

Query  6801  CTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6860
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6382  CTGCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG  6323

Query  6861  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6322  GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGG  6263

Query  6921  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6262  TGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA  6203

Query  6981  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  7040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6202  TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTG  6143

Query  7041  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  7100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6142  GTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACG  6083

Query  7101  CGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||
Sbjct  6082  CGCTGGGCTACGTCTTGCTGGCGTTCG  6056


>gb|AY751540.1| Ubiquitin protease vector pHUsp2-cc, complete sequence
Length=6777

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Minus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5281  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  5222

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5221  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  5162

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5161  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  5102

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5101  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  5042

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5041  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  4982

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  4981  TGGGCTACGTCTTGCTGGCGTTCG  4958


>gb|AY751539.1| Cloning vector pHUE, complete sequence
Length=5942

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Minus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4446  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  4387

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4386  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  4327

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4326  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  4267

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4266  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  4207

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4206  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  4147

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  4146  TGGGCTACGTCTTGCTGGCGTTCG  4123


>gb|AY370909.2| Expression vector pAdEasy-1, complete sequence
Length=33476

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  27    CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  86

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  87    TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  146

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  147   CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  206

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  207   GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  266

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  267   CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  326

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  327   TGGGCTACGTCTTGCTGGCGTTCG  350


>gb|AY159365.1| Synthetic construct plasmid pSN6 alkaline phosphatase-like protein, 
LacI (lacI), and beta lactamase (bla) genes, complete 
cds
Length=7494

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3782  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3841

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3842  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3901

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3902  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3961

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3962  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  4021

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4022  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  4081

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  4082  TGGGCTACGTCTTGCTGGCGTTCG  4105


>gb|AF525446.1| Expression vector pNB-13, complete sequence
Length=5756

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2044  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2103

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2104  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2163

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2164  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2223

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2224  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2283

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2284  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2343

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2344  TGGGCTACGTCTTGCTGGCGTTCG  2367


>gb|AF525445.1| Expression vector pETAT-12, complete sequence
Length=5789

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2077  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2136

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2137  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2196

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2197  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2256

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2257  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2316

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2376

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2377  TGGGCTACGTCTTGCTGGCGTTCG  2400


>gb|AF525444.1| Expression vector pETAT-11, complete sequence
Length=5789

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2077  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2136

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2137  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2196

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2197  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2256

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2257  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2316

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2376

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2377  TGGGCTACGTCTTGCTGGCGTTCG  2400


>gb|AY042185.1| Cloning vector pSB3616 alkaline phosphatase (phoA), lac repressor 
(lacI), and chloramphenicol acetyltransferase (cat) genes, 
complete cds
Length=7151

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5052  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  5111

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5112  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  5171

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5172  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  5231

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5232  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  5291

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5292  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  5351

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  5352  TGGGCTACGTCTTGCTGGCGTTCG  5375


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6181  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6240

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  6241  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6274


>gb|AF316555.1|AF316555 Cloning vector pXZ240, complete sequence
Length=7014

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2809  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2868

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2869  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2928

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2929  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2988

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2989  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3048

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3049  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3108

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3109  TGGGCTACGTCTTGCTGGCGTTCG  3132


>gb|AF316554.1|AF316554 Cloning vector pJH391, complete sequence
Length=7044

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2839  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2898

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2899  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2958

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2959  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3018

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3019  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3078

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3079  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3138

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3139  TGGGCTACGTCTTGCTGGCGTTCG  3162


>gb|AF316553.1|AF316553 Cloning vector pJH370, complete sequence
Length=5141

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  936   CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  995

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  996   TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  1055

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1056  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  1115

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1116  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  1175

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1176  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  1235

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  1236  TGGGCTACGTCTTGCTGGCGTTCG  1259


>gb|AF247169.1|AF247169 Expression vector pSB2991 alkaline phosphatase (phoA), lac repressor 
(lacI), and beta-lactamase precursor (bla) genes, complete 
cds
Length=7233

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3521  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3580

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3581  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3640

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3641  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3700

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3701  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3760

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3761  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3820

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3821  TGGGCTACGTCTTGCTGGCGTTCG  3844


>gb|AF179892.1|AF179892 Cloning vector pLM3, complete sequence
Length=5042

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  837   CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  896

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  897   TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  956

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  957   CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  1016

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1017  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  1076

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1077  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  1136

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  1137  TGGGCTACGTCTTGCTGGCGTTCG  1160


>gb|AF169189.1|AF169189 Cloning vector pLS3, complete sequence
Length=5070

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  865   CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  924

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  925   TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  984

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  985   CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  1044

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1045  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  1104

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1105  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  1164

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  1165  TGGGCTACGTCTTGCTGGCGTTCG  1188


>gb|AF147464.1|AF147464 T7 expression vector pViet, complete sequence
Length=4985

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3212  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  3271

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3272  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  3331

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3332  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  3391

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3392  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  3451

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3452  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  3511

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  3512  TGGGCTACGTCTTGCTGGCGTTCG  3535


>gb|AF147463.1|AF147463 T7 Expression vector pNam, complete sequence
Length=6278

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4505  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  4564

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4565  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  4624

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4625  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  4684

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4685  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  4744

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4745  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  4804

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  4805  TGGGCTACGTCTTGCTGGCGTTCG  4828


>gb|AF133437.1|AF133437 Cloning vector pCYPAC6, complete sequence
Length=18772

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Minus

Query  6804   CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13924  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  13865

Query  6864   TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  13805

Query  6924   CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13804  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  13745

Query  6984   GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13744  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  13685

Query  7044   CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13684  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  13625

Query  7104   TGGGCTACGTCTTGCTGGCGTTCG  7127
              ||||||||||||||||||||||||
Sbjct  13624  TGGGCTACGTCTTGCTGGCGTTCG  13601


>gb|AF123770.1|AF123770 Shuttle vector pPAC-ResQ, complete sequence
Length=16437

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7310  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  7369

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7370  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  7429

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7430  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  7489

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7490  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7549

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7550  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7609

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  7610  TGGGCTACGTCTTGCTGGCGTTCG  7633


>gb|AF087042.1|AF087042 Cloning vector pCALnFLAG, complete sequence
Length=5825

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2113  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2172

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2173  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2232

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2233  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2292

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2293  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2352

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2353  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2412

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2413  TGGGCTACGTCTTGCTGGCGTTCG  2436


>emb|AJ224005.1| Retroviral vector plasmid pSF1 (PSNEBH) DNA (5154bp)
Length=5154

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2144  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2203

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2204  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2263

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2264  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2323

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2324  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2383

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2384  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2443

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2444  TGGGCTACGTCTTGCTGGCGTTCG  2467


>emb|AJ224004.1| Retroviral vector plasmid pSF1 (NBH) DNA (5138bp)
Length=5138

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2129  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2188

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2189  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2248

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2249  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2308

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2309  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2368

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2369  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2428

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2429  TGGGCTACGTCTTGCTGGCGTTCG  2452


>gb|U86347.1|ECU86347 Expression vector pCal-n-ek complete sequence
Length=5825

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2113  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2172

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2173  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2232

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2233  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2292

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2293  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2352

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2353  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2412

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2413  TGGGCTACGTCTTGCTGGCGTTCG  2436


>gb|U36453.1|CVU36453 Expression vector pCALkc, complete sequence
Length=5810

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2097  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2156

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2157  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2216

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2217  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2276

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2277  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2336

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2337  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2396

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2397  TGGGCTACGTCTTGCTGGCGTTCG  2420


>gb|U36452.1|CVU36452 Expression vector pCALc, complete sequence
Length=5782

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2070  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2129

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2130  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2189

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2190  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2249

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2250  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2309

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2310  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2369

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2370  TGGGCTACGTCTTGCTGGCGTTCG  2393


>gb|U36454.1|CVU36454 Expression vector pCALn, complete sequence
Length=5782

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2070  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  2129

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2130  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  2189

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2190  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  2249

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2250  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  2309

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2310  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  2369

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  2370  TGGGCTACGTCTTGCTGGCGTTCG  2393


>gb|U09128.1|XXU09128 pSacBII P1 cloning vector with sacB, kilA, repL and kanamycin 
resistance genes, complete sequence
Length=16011

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Minus

Query  6804   CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15939  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  15880

Query  6864   TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15879  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  15820

Query  6924   CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15819  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  15760

Query  6984   GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15759  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  15700

Query  7044   CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15699  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  15640

Query  7104   TGGGCTACGTCTTGCTGGCGTTCG  7127
              ||||||||||||||||||||||||
Sbjct  15639  TGGGCTACGTCTTGCTGGCGTTCG  15616


>gb|U02436.1|XXU02436 Cloning vector rpSE937, complete sequence
Length=7798

 Score =  585 bits (648),  Expect = 1e-162
 Identities = 324/324 (100%), Gaps = 0/324 (0%)
 Strand=Plus/Plus

Query  6804  CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  6863
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  604   CTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCA  663

Query  6864  TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  6923
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  664   TGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC  723

Query  6924  CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  6983
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  724   CGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCG  783

Query  6984  GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  7043
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  784   GCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTC  843

Query  7044  CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  7103
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  844   CCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC  903

Query  7104  TGGGCTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||||||
Sbjct  904   TGGGCTACGTCTTGCTGGCGTTCG  927


>gb|JN704639.1| Uncultured bacterium plasmid pMC2, complete sequence
Length=22102

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17479  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  17538

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17539  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  17598

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17599  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  17658

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17659  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  17718

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  17719  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  17778

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  17779  GGGCTACGTCTTGCTGGCGTTCG  17801


>gb|JN400387.1| Expression vector pMON82053, complete sequence
Length=9769

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5415  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5356

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5355  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5296

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5295  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5236

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5235  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5176

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5175  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5116

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5115  GGGCTACGTCTTGCTGGCGTTCG  5093


>gb|JN400386.1| Expression vector pMON74532, complete sequence
Length=9754

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4393  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4334

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4333  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4274

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4273  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4214

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4213  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4154

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4153  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4094

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4093  GGGCTACGTCTTGCTGGCGTTCG  4071


>gb|JN400385.1| Expression vector pMON100407, complete sequence
Length=9837

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5523  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5464

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5463  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5404

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5403  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5344

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5343  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5284

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5283  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5224

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5223  GGGCTACGTCTTGCTGGCGTTCG  5201


>gb|JN400384.1| Expression vector pMON81312, complete sequence
Length=10411

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9683  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  9624

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9623  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  9564

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9563  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  9504

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9503  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  9444

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9443  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  9384

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  9383  GGGCTACGTCTTGCTGGCGTTCG  9361


>gb|JN400382.1| Expression vector pMON98939, complete sequence
Length=10504

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9776  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  9717

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9716  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  9657

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9656  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  9597

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9596  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  9537

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9536  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  9477

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  9476  GGGCTACGTCTTGCTGGCGTTCG  9454


>gb|JN400381.1| Expression vector pMON108080, complete sequence
Length=10566

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4758  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4699

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4698  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4639

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4638  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4579

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4578  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4519

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4518  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4459

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4458  GGGCTACGTCTTGCTGGCGTTCG  4436


>gb|JN204911.1| Biobrick cloning vector BBa_96047, complete sequence
Length=3573

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1842  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1901

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1902  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1961

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1962  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2021

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2022  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2081

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2082  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2141

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2142  GGGCTACGTCTTGCTGGCGTTCG  2164


>gb|JN204910.1| Biobrick cloning vector BBa_96046, complete sequence
Length=3573

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1842  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1901

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1902  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1961

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1962  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2021

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2022  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2081

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2082  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2141

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2142  GGGCTACGTCTTGCTGGCGTTCG  2164


>gb|JN204876.1| Biobrick cloning vector BBa_J96007, complete sequence
Length=3476

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1745  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1804

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1805  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1864

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1865  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1924

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1925  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1984

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1985  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2044

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2045  GGGCTACGTCTTGCTGGCGTTCG  2067


>gb|JN204875.1| Biobrick cloning vector BBa_J96006, complete sequence
Length=3475

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1744  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1803

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1804  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1863

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1864  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1923

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1924  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1983

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1984  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2043

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2044  GGGCTACGTCTTGCTGGCGTTCG  2066


>gb|JN204874.1| Biobrick cloning vector BBa_J96005, complete sequence
Length=3474

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1743  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1802

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1803  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1862

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1863  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1922

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1923  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1982

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1983  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2042

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2043  GGGCTACGTCTTGCTGGCGTTCG  2065


>gb|JN204873.1| Biobrick cloning vector BBa_J96004, complete sequence
Length=3478

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1747  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1806

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1807  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1866

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1867  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1926

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1927  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1986

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1987  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2046

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2047  GGGCTACGTCTTGCTGGCGTTCG  2069


>gb|JN204872.1| Biobrick cloning vector BBa_J96003, complete sequence
Length=3477

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1746  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1805

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1806  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1865

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1866  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1925

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1926  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1985

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1986  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2045

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2046  GGGCTACGTCTTGCTGGCGTTCG  2068


>gb|JN003423.1| Escherichia coli strain AS MRE1009 TetC (tetC) gene, partial 
cds
Length=830

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  286   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  345

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  346   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  405

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  406   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  465

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  466   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  525

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  526   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  585

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  586   GGGCTACGTCTTGCTGGCGTTCG  608


>gb|JN201971.1| Cloning vector pRR26, complete sequence
Length=8799

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1504  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1563

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1564  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1623

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1624  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1683

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1684  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1743

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1744  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1803

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1804  GGGCTACGTCTTGCTGGCGTTCG  1826


>gb|JN201960.1| Cloning vector pRR25, complete sequence
Length=10276

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2981  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3040

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3041  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3100

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3101  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3160

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3161  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3220

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3221  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3280

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3281  GGGCTACGTCTTGCTGGCGTTCG  3303


>gb|JN201959.1| Cloning vector pRR24, complete sequence
Length=10417

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3122  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3181

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3182  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3241

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3242  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3301

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3302  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3361

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3362  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3421

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3422  GGGCTACGTCTTGCTGGCGTTCG  3444


>gb|JN201958.1| Cloning vector pRR22, complete sequence
Length=10198

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2903  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2962

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2963  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3022

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3023  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3082

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3083  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3142

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3143  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3202

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3203  GGGCTACGTCTTGCTGGCGTTCG  3225


>gb|JN201957.1| Cloning vector pRR23, complete sequence
Length=10042

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2747  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2806

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2807  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2866

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2867  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2926

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2927  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2986

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2987  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3046

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3047  GGGCTACGTCTTGCTGGCGTTCG  3069


>gb|JN201956.1| Cloning vector pRR21, complete sequence
Length=9400

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2105  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2164

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2165  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2224

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2225  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2284

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2285  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2344

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2345  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2404

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2405  GGGCTACGTCTTGCTGGCGTTCG  2427


>gb|JF796094.1| Reporter gene-fusion vector pFU168, complete sequence
Length=3197

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2474  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2415

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2414  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2355

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2354  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2295

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2294  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2235

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2234  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2175

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2174  GGGCTACGTCTTGCTGGCGTTCG  2152


>gb|JF327847.1| Expression vector LIC-pDEST-LC2, complete sequence
Length=6349

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5965  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5906

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5905  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5846

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5845  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5786

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5785  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5726

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5725  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5666

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5665  GGGCTACGTCTTGCTGGCGTTCG  5643


>gb|JF327846.1| Expression vector LIC-pDEST-LC1, complete sequence
Length=6366

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5982  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5923

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5922  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5863

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5862  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5803

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5802  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5743

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5742  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5683

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5682  GGGCTACGTCTTGCTGGCGTTCG  5660


>gb|JF420888.1| Lux single copy cloning vector pMH33 luxCDABE operon, complete 
sequence; and tetracycline resistance protein (tetR) gene, 
complete cds
Length=8932

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8310  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  8251

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8250  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  8191

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8190  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  8131

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8130  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  8071

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8070  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  8011

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  8010  GGGCTACGTCTTGCTGGCGTTCG  7988


>dbj|AB598835.1| Expression plasmid pBAD-IEE DNA, complete sequence
Length=7828

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6964  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6905

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6904  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6845

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6844  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6785

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6784  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6725

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6724  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6665

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6664  GGGCTACGTCTTGCTGGCGTTCG  6642


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Minus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5836  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  5777

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  5776  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  5743


>emb|FQ311454.1| Sporisorium reilianum SRZ2 contig_5.00050 complete DNA sequence
Length=2378

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1420  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1361

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1360  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1301

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1300  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1241

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1240  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1181

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1180  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1121

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1120  GGGCTACGTCTTGCTGGCGTTCG  1098


>gb|EU234497.1| Cosmid vector pPIBTcosTET, complete sequence
Length=7384

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4206  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4147

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4146  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4087

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4086  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4027

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4026  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3967

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3966  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3907

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3906  GGGCTACGTCTTGCTGGCGTTCG  3884


>gb|HM219006.1| Acinetobacter baumannii cloning vector pET-RA, complete sequence
Length=6819

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6547  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6488

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6487  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6428

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6427  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6368

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6367  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6308

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6307  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6248

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6247  GGGCTACGTCTTGCTGGCGTTCG  6225


>gb|GU987054.1| Salmonella enterica subsp. enterica serovar Typhimurium strain 
ST256 tetracycline resistance regulatory protein (tetR), tetracycline 
resistance protein class C (tetA(C)), and unknown 
genes, complete cds; and insertion sequence IS26 transposase 
(tnpA) gene, partial cds
Length=2688

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1399  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1458

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1459  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1518

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1519  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1578

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1579  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1638

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1639  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1698

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1699  GGGCTACGTCTTGCTGGCGTTCG  1721


>gb|GU952842.1| Cloning vector pAB34, complete sequence
Length=9194

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4598  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4657

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4658  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4717

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4718  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4777

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4778  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4837

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4838  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4897

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4898  GGGCTACGTCTTGCTGGCGTTCG  4920


>gb|GU952841.1| Cloning vector pAB32, complete sequence
Length=9121

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3529  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3588

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3589  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3648

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3649  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3708

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3709  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3768

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3769  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3828

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3829  GGGCTACGTCTTGCTGGCGTTCG  3851


>gb|FJ389187.1| Cloning vector pHC82, complete sequence
Length=11365

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6769  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6828

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6829  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6888

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6889  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6948

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6949  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7008

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7009  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7068

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  7069  GGGCTACGTCTTGCTGGCGTTCG  7091


>gb|FJ389186.1| Cloning vector pHC68, complete sequence
Length=9191

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4595  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4654

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4655  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4714

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4715  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4774

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4775  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4834

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4835  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4894

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4895  GGGCTACGTCTTGCTGGCGTTCG  4917


>gb|FJ389185.1| Cloning vector pHC67, complete sequence
Length=9157

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4561  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4620

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4621  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4680

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4681  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4740

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4741  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4800

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4801  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4860

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4861  GGGCTACGTCTTGCTGGCGTTCG  4883


>gb|FJ389184.1| Cloning vector pHC65, complete sequence
Length=9177

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4581  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4640

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4641  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4700

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4701  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4760

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4761  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4820

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4821  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4880

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4881  GGGCTACGTCTTGCTGGCGTTCG  4903


>gb|FJ389183.1| Cloning vector pHC40, complete sequence
Length=11365

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6769  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6828

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6829  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6888

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6889  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6948

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6949  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7008

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7009  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7068

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  7069  GGGCTACGTCTTGCTGGCGTTCG  7091


>gb|FJ389182.1| Cloning vector pHC38, complete sequence
Length=8624

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4028  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4087

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4088  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4147

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4148  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4207

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4208  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4267

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4268  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4327

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4328  GGGCTACGTCTTGCTGGCGTTCG  4350


>gb|FJ389181.1| Cloning vector pHC36, complete sequence
Length=8653

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4057  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4116

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4117  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4176

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4177  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4236

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4237  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4296

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4297  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4356

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4357  GGGCTACGTCTTGCTGGCGTTCG  4379


>dbj|AB526842.1| Shuttle vector pAY201 DNA, complete sequence
Length=12408

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  10521  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  10580

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  10581  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  10640

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  10641  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  10700

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  10701  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  10760

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  10761  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  10820

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  10821  GGGCTACGTCTTGCTGGCGTTCG  10843


>dbj|AB526841.1| Shuttle vector pAY205 DNA, complete sequence
Length=13862

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  11975  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12034

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12035  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12094

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12095  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12154

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12155  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12214

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12215  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12274

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12275  GGGCTACGTCTTGCTGGCGTTCG  12297


>gb|GQ438227.1| Broad host range vector pBTBXh-4, complete sequence
Length=4224

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2212  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2271

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2272  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2331

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2332  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2391

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2392  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2451

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2452  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2511

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2512  GGGCTACGTCTTGCTGGCGTTCG  2534


>gb|GQ438221.1| Broad host range vector pBMTBX-4, complete sequence
Length=5454

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3442  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3501

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3502  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3561

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3562  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3621

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3622  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3681

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3682  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3741

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3742  GGGCTACGTCTTGCTGGCGTTCG  3764


>gb|GQ438215.1| Broad host range vector pBTBX-4, complete sequence
Length=4209

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2197  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2256

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2257  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2316

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2376

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2377  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2436

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2437  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2496

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2497  GGGCTACGTCTTGCTGGCGTTCG  2519


>gb|GQ371206.1| Insertion vector pUTTnsTet, complete sequence
Length=9410

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5756  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5815

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5816  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5875

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5876  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5935

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5936  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5995

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5996  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6055

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6056  GGGCTACGTCTTGCTGGCGTTCG  6078


>gb|FJ391469.1| Gateway entry vector pJM1, complete sequence
Length=3780

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1775  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1834

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1835  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1894

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1895  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1954

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1955  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2014

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2015  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2074

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2075  GGGCTACGTCTTGCTGGCGTTCG  2097


>gb|EU294195.1| Cloning vector pSUP81-ZA, complete sequence
Length=11597

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  624   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  683

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  684   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  743

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  744   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  803

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  804   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  863

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  864   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  923

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  924   GGGCTACGTCTTGCTGGCGTTCG  946


 Score =  262 bits (290),  Expect = 2e-65
 Identities = 145/145 (100%), Gaps = 0/145 (0%)
 Strand=Plus/Minus

Query  6983   GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  7042
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  11574  GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  11515

Query  7043   CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  7102
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  11514  CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  11455

Query  7103   CTGGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||||
Sbjct  11454  CTGGGCTACGTCTTGCTGGCGTTCG  11430


>dbj|AP009241.1| Escherichia coli SE11 plasmid pSE11-1 DNA, complete sequence
Length=100021

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7821  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  7880

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7881  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  7940

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7941  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  8000

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8001  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  8060

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8061  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  8120

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  8121  GGGCTACGTCTTGCTGGCGTTCG  8143


>emb|FM209526.1| Cloning vector pr8a
Length=9041

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8393  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  8334

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8333  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  8274

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8273  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  8214

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8213  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  8154

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8153  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  8094

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  8093  GGGCTACGTCTTGCTGGCGTTCG  8071


>emb|FM174471.1| Cloning vector pRG930cm
Length=17256

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1419  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1360

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1359  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1300

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1299  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1240

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1239  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1180

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1179  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1120

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1119  GGGCTACGTCTTGCTGGCGTTCG  1097


 Score =  262 bits (290),  Expect = 2e-65
 Identities = 145/145 (100%), Gaps = 0/145 (0%)
 Strand=Plus/Plus

Query  6983   GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  7042
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14476  GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  14535

Query  7043   CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  7102
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14536  CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  14595

Query  7103   CTGGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||||
Sbjct  14596  CTGGGCTACGTCTTGCTGGCGTTCG  14620


>gb|EU751613.1| Escherichia coli strain AB041172 tetracycline resistance protein 
(tetC) gene, complete cds
Length=1176

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  567   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  626

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  627   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  686

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  687   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  746

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  806

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  807   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  866

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  867   GGGCTACGTCTTGCTGGCGTTCG  889


>gb|EU751612.1| Escherichia coli strain AB061052 tetracycline resistance protein 
(tetC) gene, complete cds
Length=1191

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  567   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  626

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  627   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  686

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  687   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  746

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  806

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  807   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  866

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  867   GGGCTACGTCTTGCTGGCGTTCG  889


>gb|EU751611.1| Escherichia coli strain RAC-053.1 tetracycline resistance protein 
(tetC) gene, complete cds
Length=1191

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  567   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  626

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  627   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  686

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  687   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  746

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  806

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  807   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  866

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  867   GGGCTACGTCTTGCTGGCGTTCG  889


>gb|EU751610.1| Escherichia coli strain 423 tetracycline resistance protein (tetC) 
gene, complete cds
Length=1191

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  567   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  626

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  627   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  686

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  687   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  746

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  806

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  807   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  866

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  867   GGGCTACGTCTTGCTGGCGTTCG  889


>gb|EU530621.1| Cloning vector pStartT2, complete sequence
Length=3265

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1336  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1277

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1276  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1217

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1216  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1157

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1156  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1097

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1096  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1037

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1036  GGGCTACGTCTTGCTGGCGTTCG  1014


>gb|EU284111.1| Cloning vector pBB174, complete sequence
Length=7666

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6371  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6430

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6431  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6490

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6491  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6550

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6551  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6610

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6611  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6670

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6671  GGGCTACGTCTTGCTGGCGTTCG  6693


>gb|EU284110.1| Cloning vector pBB173, complete sequence
Length=7666

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6371  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6430

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6431  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6490

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6491  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6550

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6551  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6610

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6611  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6670

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6671  GGGCTACGTCTTGCTGGCGTTCG  6693


>gb|EU284109.1| Cloning vector pBB175, complete sequence
Length=7612

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6317  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6376

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6377  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6436

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6437  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6496

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6497  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6556

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6557  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6616

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6617  GGGCTACGTCTTGCTGGCGTTCG  6639


>gb|EU284108.1| Cloning vector pCV12, complete sequence
Length=5711

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4416  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4475

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4476  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4535

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4536  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4595

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4596  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4655

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4656  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4715

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4716  GGGCTACGTCTTGCTGGCGTTCG  4738


>gb|EU284107.1| Cloning vector pCV9, complete sequence
Length=2022

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  727   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  786

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  787   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  846

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  847   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  906

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  907   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  966

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  967   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1026

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1027  GGGCTACGTCTTGCTGGCGTTCG  1049


>emb|AM921675.1| Cloning vector PBAC-RT
Length=8349

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1506  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1565

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1566  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1625

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1626  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1685

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1686  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1745

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1746  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1805

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1806  GGGCTACGTCTTGCTGGCGTTCG  1828


>gb|EU232662.1| Cloning vector pVMGCRT85, complete sequence
Length=11368

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5987  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6046

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6047  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6106

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6107  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6166

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6167  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6226

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6227  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6286

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6287  GGGCTACGTCTTGCTGGCGTTCG  6309


>gb|EU118176.1| Cloning vector pCM433, complete sequence
Length=8081

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3485  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3544

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3545  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3604

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3605  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3664

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3665  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3724

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3725  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3784

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3785  GGGCTACGTCTTGCTGGCGTTCG  3807


>emb|AM743197.2| Escherichia sp. Sflu5 cryptic plasmid pAK51
Length=6511

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5947  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6006

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6007  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6066

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6067  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6126

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6127  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6186

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6187  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6246

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6247  GGGCTACGTCTTGCTGGCGTTCG  6269


>gb|EF456759.1| Chimeric dengue virus type 1 vector p4(delta)30-D1L-CME, complete 
sequence
Length=15265

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12056  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12115

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12116  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12175

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12176  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12235

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12236  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12295

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12296  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12355

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12356  GGGCTACGTCTTGCTGGCGTTCG  12378


>gb|EF456758.1| Chimeric dengue virus type 1 vector p4-D1L-CME, complete sequence
Length=15296

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12087  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12146

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12147  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12206

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12207  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12266

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12267  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12326

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12327  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12386

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12387  GGGCTACGTCTTGCTGGCGTTCG  12409


>gb|EF456757.1| Chimeric dengue virus type 1 vector p4(delta)30-D1-ME, complete 
sequence
Length=15239

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12030  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12089

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12090  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12149

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12150  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12209

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12210  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12269

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12270  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12329

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12330  GGGCTACGTCTTGCTGGCGTTCG  12352


>gb|EF456756.1| Chimeric dengue virus type 1 vector p4-D1-ME, complete sequence
Length=15270

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12061  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12120

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12121  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12180

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12181  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12240

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12241  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12300

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12301  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12360

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12361  GGGCTACGTCTTGCTGGCGTTCG  12383


>gb|EF363313.1| Promoter-trap vector pMW82, complete sequence
Length=5129

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4857  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4798

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4797  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4738

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4737  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4678

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4677  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4618

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4617  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4558

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4557  GGGCTACGTCTTGCTGGCGTTCG  4535


>gb|EF196094.1| Shuttle cloning vector pDOJ4, complete sequence
Length=13317

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3348  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3407

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3408  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3467

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3468  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3527

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3528  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3587

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3588  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3647

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3648  GGGCTACGTCTTGCTGGCGTTCG  3670


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6125  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6184

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  6185  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6218


>gb|DQ666283.1| Cloning vector pRGK 367, complete sequence
Length=11776

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7753  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  7812

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7813  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  7872

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7873  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  7932

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7933  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7992

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7993  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  8052

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  8053  GGGCTACGTCTTGCTGGCGTTCG  8075


>gb|DQ666282.1| Cloning vector pRGK 366, complete sequence
Length=11502

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7479  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  7538

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7539  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  7598

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7599  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  7658

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7659  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7718

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7719  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7778

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  7779  GGGCTACGTCTTGCTGGCGTTCG  7801


>emb|AM411028.1| Acinetobacter baylyi transgene for double kill gene cassette, 
strain KH2
Length=11119

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1580  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1521

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1520  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1461

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1460  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1401

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1400  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1341

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1340  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1281

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1280  GGGCTACGTCTTGCTGGCGTTCG  1258


>gb|DQ517526.1| Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence
Length=241387

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  90227  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  90168

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  90167  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  90108

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  90107  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  90048

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  90047  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  89988

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  89987  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  89928

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  89927  GGGCTACGTCTTGCTGGCGTTCG  89905


>gb|DQ058742.1| Broad host range vector pBTL-4, complete sequence
Length=2996

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2197  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2256

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2257  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2316

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2376

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2377  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2436

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2437  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2496

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2497  GGGCTACGTCTTGCTGGCGTTCG  2519


>gb|DQ058737.1| Broad host range vector pBMTL-4, complete sequence
Length=4241

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3442  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3501

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3502  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3561

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3562  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3621

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3622  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3681

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3682  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3741

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3742  GGGCTACGTCTTGCTGGCGTTCG  3764


>gb|DQ058732.1| Broad host range vector pBTB-4, complete sequence
Length=4118

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2197  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2256

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2257  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2316

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2376

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2377  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2436

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2437  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2496

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2497  GGGCTACGTCTTGCTGGCGTTCG  2519


>gb|DQ058727.1| Broad host range vector pBMTB-4, complete sequence
Length=5363

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3442  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3501

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3502  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3561

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3562  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3621

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3622  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3681

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3682  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3741

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3742  GGGCTACGTCTTGCTGGCGTTCG  3764


>gb|DQ058722.1| Broad host range vector pBT-4, complete sequence
Length=2936

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2197  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2256

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2257  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2316

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2317  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2376

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2377  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2436

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2437  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2496

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2497  GGGCTACGTCTTGCTGGCGTTCG  2519


>gb|DQ058717.1| Broad host range vector pBMT-4, complete sequence
Length=4181

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3442  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3501

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3502  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3561

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3562  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3621

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3622  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3681

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3682  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3741

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3742  GGGCTACGTCTTGCTGGCGTTCG  3764


>gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alpha peptide (lacZ alpha) 
genes, complete cds; and unknown gene
Length=5228

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4306  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4247

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4246  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4187

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4186  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4127

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4126  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4067

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4066  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4007

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4006  GGGCTACGTCTTGCTGGCGTTCG  3984


>gb|AY028776.1| TnphoZ mutagenesis vector pMHL120, complete sequence
Length=13561

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7825  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  7766

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7765  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  7706

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7705  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  7646

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7645  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7586

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7585  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7526

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  7525  GGGCTACGTCTTGCTGGCGTTCG  7503


>gb|AY796342.1| Cloning vector pBlueLysis, complete sequence
Length=5443

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2307  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2366

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2367  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2426

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2427  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2486

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2487  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2546

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2547  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2606

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2607  GGGCTACGTCTTGCTGGCGTTCG  2629


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3435  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  3494

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  3495  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  3528


>gb|AY744150.1| Dengue virus type 2 vector p4(delta30)-4995, complete sequence
Length=15129

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12095  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12154

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12155  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12214

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12215  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12274

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12275  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12334

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12335  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12394

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12395  GGGCTACGTCTTGCTGGCGTTCG  12417


>gb|AY744149.1| Dengue virus type 2 vector p2(delta30), complete sequence
Length=15129

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12095  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12154

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12155  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12214

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12215  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12274

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12275  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12334

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12335  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12394

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12395  GGGCTACGTCTTGCTGGCGTTCG  12417


>gb|AY744148.1| Dengue virus type 2 vector p2, complete sequence
Length=15159

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12125  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12184

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12185  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12244

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12245  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12304

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12305  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12364

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12365  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12424

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12425  GGGCTACGTCTTGCTGGCGTTCG  12447


>gb|AY817672.1| SIV vector pCLN8, complete sequence
Length=19831

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  18490  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  18431

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  18430  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  18371

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  18370  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  18311

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  18310  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  18251

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  18250  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  18191

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  18190  GGGCTACGTCTTGCTGGCGTTCG  18168


>gb|AF055345.1| Francisella tularensi plasmid pOM1, complete sequence
Length=4442

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2757  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2816

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2817  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2876

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2877  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2936

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2937  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2996

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2997  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3056

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3057  GGGCTACGTCTTGCTGGCGTTCG  3079


>gb|AY046276.1| IncN plasmid R46, complete sequence
Length=50969

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  43326  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  43385

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  43386  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  43445

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  43446  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  43505

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  43506  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  43565

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  43566  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  43625

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  43626  GGGCTACGTCTTGCTGGCGTTCG  43648


>gb|AY043299.1| Aeromonas salmonicida plasmid pRAS3.2, complete sequence
Length=11823

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4609  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4550

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4549  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4490

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4489  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4430

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4429  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4370

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4369  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4310

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4309  GGGCTACGTCTTGCTGGCGTTCG  4287


>gb|AY428550.1| Chlamydia suis strain R19 invasin-like protein gene, partial 
cds; insertion sequence IScs605, complete sequence; TetR(C) 
(tetR(C)), Tet(C) (tet(C)), MobE (mobE), MobD (mobD), MobC (mobC), 
MobB (mobB), MobA (mobA), RepA (repA), and RepC (repC) 
genes, complete cds; and invasin-like protein gene, partial 
cds
Length=13245

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4113  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4172

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4173  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4232

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4233  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4292

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4293  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4352

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4353  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4412

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4413  GGGCTACGTCTTGCTGGCGTTCG  4435


>gb|AY428809.1| Cloning vector pSUP202, complete sequence
Length=7830

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1241  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1300

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1301  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1360

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1361  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1420

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1421  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1480

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1481  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1540

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1541  GGGCTACGTCTTGCTGGCGTTCG  1563


 Score =  262 bits (290),  Expect = 2e-65
 Identities = 145/145 (100%), Gaps = 0/145 (0%)
 Strand=Plus/Minus

Query  6983  GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  7042
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  594   GGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGT  535

Query  7043  CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  7102
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  534   CCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCG  475

Query  7103  CTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||
Sbjct  474   CTGGGCTACGTCTTGCTGGCGTTCG  450


>gb|AY303671.1| Broad host range expression vector pMHE7Tc, complete sequence
Length=6014

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4928  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4869

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4868  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4809

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4808  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4749

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4748  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4689

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4688  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4629

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4628  GGGCTACGTCTTGCTGGCGTTCG  4606


>gb|AY303670.1| Broad host range expression vector pMHE6Tc, complete sequence
Length=6039

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4858  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4799

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4798  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4739

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4738  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4679

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4678  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4619

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4618  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4559

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4558  GGGCTACGTCTTGCTGGCGTTCG  4536


>gb|AY299697.1| Broad host range expression vector pMHE5Tc, complete sequence
Length=6032

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4944  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4885

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4884  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4825

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4824  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4765

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4764  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4705

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4704  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4645

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4644  GGGCTACGTCTTGCTGGCGTTCG  4622


>gb|AY299695.1| Broad host range expression vector pMHE3Tc, complete sequence
Length=6384

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5307  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5248

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5247  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5188

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5187  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5128

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5127  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5068

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5067  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5008

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5007  GGGCTACGTCTTGCTGGCGTTCG  4985


>gb|AY093430.1| Allelic exchange vector pCM351, complete sequence
Length=6303

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4366  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4425

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4426  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4485

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4486  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4545

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4546  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4605

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4606  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4665

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4666  GGGCTACGTCTTGCTGGCGTTCG  4688


>gb|AY093429.1| Allelic exchange vector pCM184, complete sequence
Length=6760

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4823  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4882

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4883  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4942

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4943  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5002

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5003  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5062

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5063  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5122

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5123  GGGCTACGTCTTGCTGGCGTTCG  5145


>gb|AY428068.1| Expression vector pKM265 complete sequence
Length=4536

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  825   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  884

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  885   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  944

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  945   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1004

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1005  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1064

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1065  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1124

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1125  GGGCTACGTCTTGCTGGCGTTCG  1147


>gb|AY428067.1| Expression vector pKM264 complete sequence
Length=4536

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  825   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  884

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  885   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  944

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  945   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1004

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1005  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1064

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1065  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1124

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1125  GGGCTACGTCTTGCTGGCGTTCG  1147


>gb|AY428066.1| Expression vector pKM263-2xHMK complete sequence
Length=5190

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1479  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1538

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1539  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1598

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1599  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1658

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1659  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1718

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1719  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1778

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1779  GGGCTACGTCTTGCTGGCGTTCG  1801


>gb|AY428065.1| Expression vector pKM263-1xHMK complete sequence
Length=5172

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1461  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1520

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1521  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1580

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1581  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1640

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1641  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1700

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1701  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1760

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1761  GGGCTACGTCTTGCTGGCGTTCG  1783


>gb|AY428064.1| Expression vector pKM263 complete sequence
Length=5151

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1440  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1499

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1500  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1559

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1560  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1619

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1620  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1679

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1680  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1739

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1740  GGGCTACGTCTTGCTGGCGTTCG  1762


>gb|AY428063.1| Expression vector pKM260 complete sequence
Length=4500

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  789   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  848

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  849   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  908

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  909   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  968

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  969   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1028

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1029  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1088

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1089  GGGCTACGTCTTGCTGGCGTTCG  1111


>gb|AY230218.1| Expression vector pDAS112 regulated promoter system for Gram-positive 
species
Length=14928

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  778   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  719

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  718   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  659

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  658   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  599

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  598   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  539

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  538   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  479

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  478   GGGCTACGTCTTGCTGGCGTTCG  456


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Minus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8133  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  8074

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  8073  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  8040


>gb|AY243469.1| Chimeric Dengue virus vector p4(Delta30)-D2-CME, complete sequence
Length=15237

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12028  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12087

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12088  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12147

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12148  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12207

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12208  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12267

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12268  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12327

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12328  GGGCTACGTCTTGCTGGCGTTCG  12350


>gb|AY243468.1| Chimeric Dengue virus vector p4-D2-CME, complete sequence
Length=15268

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12059  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12118

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12119  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12178

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12179  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12238

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12239  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12298

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12299  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12358

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12359  GGGCTACGTCTTGCTGGCGTTCG  12381


>gb|AY243467.1| Chimeric Dengue virus vector p4(Delta30)-D2-ME, complete sequence
Length=15239

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12030  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12089

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12090  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12149

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12150  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12209

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12210  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12269

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12270  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12329

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12330  GGGCTACGTCTTGCTGGCGTTCG  12352


>gb|AY243466.1| Chimeric Dengue virus vector p4-D2-ME, complete sequence
Length=15270

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12061  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12120

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12121  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12180

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12181  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12240

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12241  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12300

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12301  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12360

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12361  GGGCTACGTCTTGCTGGCGTTCG  12383


>gb|AY376438.1| Dengue virus vector p4(Delta30), complete sequence
Length=15239

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12030  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12089

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12090  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12149

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12150  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12209

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12210  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12269

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12270  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12329

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12330  GGGCTACGTCTTGCTGGCGTTCG  12352


>gb|AF012911.1| Plasmid pETHIS-1, complete sequence
Length=4273

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4001  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3942

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3941  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3882

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3881  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3822

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3821  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3762

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3761  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3702

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3701  GGGCTACGTCTTGCTGGCGTTCG  3679


>gb|AY180162.1| Shuttle vector pRHBR17, complete sequence
Length=11241

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  652   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  711

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  712   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  771

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  772   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  831

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  832   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  891

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  892   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  951

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  952   GGGCTACGTCTTGCTGGCGTTCG  974


 Score =  253 bits (280),  Expect = 1e-62
 Identities = 140/140 (100%), Gaps = 0/140 (0%)
 Strand=Plus/Minus

Query  6988   GTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGC  7047
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  11241  GTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGC  11182

Query  7048   CACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGG  7107
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  11181  CACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGG  11122

Query  7108   CTACGTCTTGCTGGCGTTCG  7127
              ||||||||||||||||||||
Sbjct  11121  CTACGTCTTGCTGGCGTTCG  11102


>gb|AY994192.1| Cloning vector pSJS1472, complete sequence
Length=9582

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5871  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5930

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5931  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5990

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5991  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6050

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6051  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6110

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6111  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6170

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6171  GGGCTACGTCTTGCTGGCGTTCG  6193


>gb|AY289598.1| Cloning vector pHRS-9, complete sequence
Length=8530

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1462  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1521

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1522  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1581

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1582  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1641

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1642  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1701

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1702  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1761

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1762  GGGCTACGTCTTGCTGGCGTTCG  1784


 Score =  253 bits (280),  Expect = 1e-62
 Identities = 140/140 (100%), Gaps = 0/140 (0%)
 Strand=Plus/Minus

Query  6988  GTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGC  7047
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8530  GTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGC  8471

Query  7048  CACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGG  7107
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  8470  CACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGG  8411

Query  7108  CTACGTCTTGCTGGCGTTCG  7127
             ||||||||||||||||||||
Sbjct  8410  CTACGTCTTGCTGGCGTTCG  8391


>emb|AM055747.1| Acetobacter pasteurianus pAP2 plasmid, strain CCM 2374
Length=4484

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1857  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1916

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1917  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1976

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1977  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2036

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2037  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2096

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2097  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2156

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2157  GGGCTACGTCTTGCTGGCGTTCG  2179


>gb|AF020539.1| Shuttle vector pCRR1, complete sequence
Length=6433

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1052  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1111

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1112  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1171

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1172  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1231

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1232  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1291

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1292  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1351

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1352  GGGCTACGTCTTGCTGGCGTTCG  1374


>gb|M99569.1|SYNPWE15 sCos cloning vector SfiI containing bacteriophage promoters and 
flanking restriction sites in sCos vectors
Length=8164

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2458  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2517

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2518  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2577

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2578  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2637

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2638  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2697

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2698  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2757

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2758  GGGCTACGTCTTGCTGGCGTTCG  2780


>gb|J01749.1|SYNPBR322 Cloning vector pBR322, complete sequence
Length=4361

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  652   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  711

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  712   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  771

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  772   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  831

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  832   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  891

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  892   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  951

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  952   GGGCTACGTCTTGCTGGCGTTCG  974


>gb|DQ012948.1| Cloning vector pHR307a, complete sequence
Length=10725

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1944  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2003

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2004  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2063

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2064  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2123

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2124  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2183

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2184  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2243

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2244  GGGCTACGTCTTGCTGGCGTTCG  2266


>gb|AY739898.1| Cloning vector pRGK336, complete sequence
Length=11700

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7677  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  7736

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7737  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  7796

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7797  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  7856

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7857  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7916

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7917  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7976

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  7977  GGGCTACGTCTTGCTGGCGTTCG  7999


>gb|AY739897.1| Cloning vector pRGK335, complete sequence
Length=11051

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7028  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  7087

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7088  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  7147

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7148  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  7207

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7208  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7267

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7268  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7327

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  7328  GGGCTACGTCTTGCTGGCGTTCG  7350


>gb|AY785148.1| Suicide plasmid pEE3, complete sequence
Length=6393

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  652   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  711

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  712   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  771

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  772   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  831

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  832   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  891

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  892   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  951

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  952   GGGCTACGTCTTGCTGGCGTTCG  974


>emb|AJ639924.1| Plasmid pB3 complete genome
Length=56167

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  23771  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  23712

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  23711  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  23652

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  23651  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  23592

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  23591  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  23532

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  23531  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  23472

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  23471  GGGCTACGTCTTGCTGGCGTTCG  23449


>dbj|AB117035.1| Cloning vector pGETS109 DNA, complete sequence
Length=12485

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  652   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  711

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  712   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  771

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  772   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  831

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  832   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  891

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  892   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  951

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  952   GGGCTACGTCTTGCTGGCGTTCG  974


>dbj|AB089598.1| Gram-negative bacterium TA59 tetC gene, complete cds
Length=1191

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  567   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  626

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  627   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  686

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  687   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  746

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  806

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  807   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  866

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  867   GGGCTACGTCTTGCTGGCGTTCG  889


>dbj|AB089597.1| Gram-negative bacterium TA58 tetC gene, complete cds
Length=1191

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  567   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  626

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  627   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  686

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  687   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  746

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  806

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  807   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  866

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  867   GGGCTACGTCTTGCTGGCGTTCG  889


>dbj|AB089596.1| Gram-negative bacterium TA57 tetC gene, complete cds
Length=1191

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  567   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  626

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  627   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  686

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  687   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  746

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  806

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  807   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  866

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  867   GGGCTACGTCTTGCTGGCGTTCG  889


>gb|AY204705.1| RNA transcription vector pBRDI2, complete sequence
Length=13822

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13350  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  13291

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13290  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  13231

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13230  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  13171

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13170  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  13111

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13110  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  13051

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  13050  GGGCTACGTCTTGCTGGCGTTCG  13028


>gb|AY204704.1| RNA transcription vector pBRDI1, complete sequence
Length=14201

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13734  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  13675

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13674  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  13615

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13614  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  13555

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13554  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  13495

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13494  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  13435

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  13434  GGGCTACGTCTTGCTGGCGTTCG  13412


>gb|AF405698.1| Reporter vector pVA838, complete sequence
Length=9065

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  624   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  683

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  684   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  743

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  744   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  803

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  804   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  863

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  864   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  923

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  924   GGGCTACGTCTTGCTGGCGTTCG  946


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1752  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  1811

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  1812  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  1845


>gb|AF405697.1| Reporter vector pALH122, complete sequence
Length=12248

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 328/331 (99%), Gaps = 0/331 (0%)
 Strand=Plus/Plus

Query  6797  CGGACTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCG  6856
             ||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3799  CGGATCCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCG  3858

Query  6857  CGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGA  6916
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3859  CGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGA  3918

Query  6917  CAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACG  6976
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3919  CAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACG  3978

Query  6977  ATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTC  7036
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3979  ATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTC  4038

Query  7037  ACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCC  7096
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4039  ACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCC  4098

Query  7097  GACGCGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||||||
Sbjct  4099  GACGCGCTGGGCTACGTCTTGCTGGCGTTCG  4129


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4935  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  4994

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  4995  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  5028


>gb|AF405696.1| Reporter vector pALH109, complete sequence
Length=12168

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 328/331 (99%), Gaps = 0/331 (0%)
 Strand=Plus/Plus

Query  6797  CGGACTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCG  6856
             ||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3719  CGGATCCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCG  3778

Query  6857  CGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGA  6916
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3779  CGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGA  3838

Query  6917  CAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACG  6976
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3839  CAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACG  3898

Query  6977  ATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTC  7036
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3899  ATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTC  3958

Query  7037  ACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCC  7096
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3959  ACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCC  4018

Query  7097  GACGCGCTGGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||||||||||
Sbjct  4019  GACGCGCTGGGCTACGTCTTGCTGGCGTTCG  4049


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4855  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  4914

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  4915  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  4948


>emb|AJ297913.2| Plasmid pIPO2T, complete sequence
Length=45319

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42623  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  42682

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42683  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  42742

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42743  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  42802

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42803  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  42862

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42863  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  42922

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  42923  GGGCTACGTCTTGCTGGCGTTCG  42945


>gb|AY003885.1| Cloning vector pZR80, complete sequence
Length=6405

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3750  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3809

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3810  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3869

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3870  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3929

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3930  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3989

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3990  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4049

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4050  GGGCTACGTCTTGCTGGCGTTCG  4072


>gb|U73849.1|XXU73849 Synthetic transposon Tn5-OT182 carrier plasmid pOT182, complete 
sequence
Length=18658

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14836  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  14895

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14896  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  14955

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14956  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  15015

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15016  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  15075

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15076  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  15135

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  15136  GGGCTACGTCTTGCTGGCGTTCG  15158


 Score =  208 bits (230),  Expect = 4e-49
 Identities = 226/300 (76%), Gaps = 0/300 (0%)
 Strand=Plus/Plus

Query  6828   TCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGA  6887
              |||||||  ||   || ||||||||||| |||||||||||  |||||||||| || ||| 
Sbjct  11011  TCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCGCCCTGATGG  11070

Query  6888   CTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCG  6947
              | |||||||| ||||||||||| || |||||||||||||| ||||| |||||||||||||
Sbjct  11071  CGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCG  11130

Query  6948   GCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAA  7007
              ||||||| ||||||| ||||  |||||| | ||||||| | |||||||| | ||| || |
Sbjct  11131  GCGAGGATCGCTTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCA  11190

Query  7008   TCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGA  7067
              |  ||||  | ||||| || ||  |  |||| || || |   ||   ||  ||||||| |
Sbjct  11191  TTCTGCATTCACTCGCCCAGGCAATGATCACCGGCCCTGTAGCCGCCCGGCTCGGCGAAA  11250

Query  7068   AGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCG  7127
               || |||  | ||   ||| |||   |||||||     |||||| || |||| || ||||
Sbjct  11251  GGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGCTTGCCTTCG  11310


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839   AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15964  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  16023

Query  6899   ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
              ||||||||||||||||||||||||||||||||||
Sbjct  16024  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  16057


>emb|AJ006407.1| Bacillus intermedius plasmid pET3xa-barn36, gene encoding barnase
Length=4753

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4535  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4476

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4475  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4416

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4415  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4356

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4355  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4296

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4295  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4236

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4235  GGGCTACGTCTTGCTGGCGTTCG  4213


>gb|U00003.1|PIB8 pIB8 cosmid vector; complete sequence
Length=5406

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3012  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2953

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2952  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2893

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2892  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2833

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2832  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2773

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2772  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2713

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2712  GGGCTACGTCTTGCTGGCGTTCG  2690


>gb|DQ123820.1| Shuttle vector pDOJHR, complete sequence
Length=8596

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3498  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3439

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3438  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3379

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3378  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3319

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3318  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3259

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3258  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3199

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3198  GGGCTACGTCTTGCTGGCGTTCG  3176


>gb|AY781401.1| Synthetic construct transposon mini-Mu transposon TnCR4, complete 
sequence
Length=1524

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  734   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  793

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  794   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  853

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  854   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  913

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  914   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  973

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  974   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1033

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1034  GGGCTACGTCTTGCTGGCGTTCG  1056


>gb|AY781399.1| Synthetic construct transposon mini-Mu transposon TnCR2, complete 
sequence
Length=2413

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  707   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  766

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  767   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  826

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  827   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  886

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  887   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  946

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  947   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1006

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1007  GGGCTACGTCTTGCTGGCGTTCG  1029


>gb|AY656170.1| Dengue virus type 3 vector p3(delta30), complete sequence
Length=15145

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12111  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12170

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12171  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12230

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12231  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12290

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12291  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12350

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12351  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12410

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12411  GGGCTACGTCTTGCTGGCGTTCG  12433


>gb|AY656169.1| Dengue virus type 3 vector p3, complete sequence
Length=15176

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12142  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12201

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12202  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12261

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12262  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12321

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12322  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12381

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12382  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12441

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12442  GGGCTACGTCTTGCTGGCGTTCG  12464


>gb|AY656168.1| Chimeric dengue virus vector p4(delta30)-D3L-ME, complete sequence
Length=15256

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12047  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12106

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12107  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12166

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12167  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12226

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12227  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12286

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12287  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12346

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12347  GGGCTACGTCTTGCTGGCGTTCG  12369


>gb|AY656167.1| Chimeric dengue virus vector p4-D3L-ME, complete sequence
Length=15287

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12078  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12137

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12138  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12197

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12198  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12257

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12258  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12317

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12318  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12377

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12378  GGGCTACGTCTTGCTGGCGTTCG  12400


>gb|AY648301.1| Dengue virus type 4 vector p4, complete sequence
Length=15270

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12061  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  12120

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12121  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  12180

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12181  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  12240

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12241  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  12300

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12301  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  12360

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  12361  GGGCTACGTCTTGCTGGCGTTCG  12383


>gb|AY167049.1| Escherichia coli invasion plasmid pIS2, complete sequence
Length=6349

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4443  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4502

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4503  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4562

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4563  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4622

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4623  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4682

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4683  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4742

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4743  GGGCTACGTCTTGCTGGCGTTCG  4765


>dbj|AB057644.1| Shuttle vector pVA838 DNA, complete sequence
Length=9071

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Minus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3627  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3568

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3567  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3508

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3507  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3448

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3447  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3388

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3387  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3328

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3327  GGGCTACGTCTTGCTGGCGTTCG  3305


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Minus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2499  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  2440

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  2439  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  2406


>emb|Y19114.1| Escherichia coli partial plasmid tetC gene for tetracycline resistance 
protein
Length=1138

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  558   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  617

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  618   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  677

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  678   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  737

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  738   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  797

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  798   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  857

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  858   GGGCTACGTCTTGCTGGCGTTCG  880


>gb|AF134781.1|AF134781 Cloning vector YEP46 complete sequence
Length=7876

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1349  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1408

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1409  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1468

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1469  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1528

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1529  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1588

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1589  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1648

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1649  GGGCTACGTCTTGCTGGCGTTCG  1671


>gb|AF129432.2|AF129432 Cloning vector pJAH01, complete sequence
Length=4753

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2655  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2714

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2715  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2774

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2775  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2834

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2835  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2894

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2895  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2954

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2955  GGGCTACGTCTTGCTGGCGTTCG  2977


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3783  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  3842

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  3843  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  3876


>gb|AF179893.1|AF179893 Cloning vector pLM53, complete sequence
Length=7232

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1385  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1444

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1445  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1504

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1505  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1564

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1565  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1624

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1684

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1685  GGGCTACGTCTTGCTGGCGTTCG  1707


>gb|AF108217.1|AF108217 Cloning vector pLM10, complete sequence
Length=7144

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1385  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1444

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1445  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1504

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1505  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1564

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1565  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1624

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1625  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1684

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1685  GGGCTACGTCTTGCTGGCGTTCG  1707


>gb|AF075573.1|AF075573 Cloning vector pWEB, complete sequence
Length=8179

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2475  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2534

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2535  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2594

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2595  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2654

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2655  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2714

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2715  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2774

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2775  GGGCTACGTCTTGCTGGCGTTCG  2797


>gb|U89928.1|CVU89928 Cloning vector pHISi-1, complete sequence
Length=5429

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1723  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1782

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1783  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1842

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1843  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1902

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1903  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1962

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1963  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2022

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2023  GGGCTACGTCTTGCTGGCGTTCG  2045


>gb|U89927.1|CVU89927 Cloning vector pHISi, complete sequence
Length=6786

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1723  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1782

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1783  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1842

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1843  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1902

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1903  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1962

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1963  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2022

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2023  GGGCTACGTCTTGCTGGCGTTCG  2045


>emb|X99274.1| Artificial sequence DNA for expression vector pNGV1
Length=7218

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3387  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3446

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3447  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3506

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3507  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3566

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3567  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3626

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3627  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3686

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3687  GGGCTACGTCTTGCTGGCGTTCG  3709


>gb|U69267.1|IVU69267 Integration vector pSMB47 for Tn5251 and Tn916, complete sequence
Length=8774

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5988  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6047

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6048  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6107

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6108  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6167

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6168  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6227

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6228  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6287

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6288  GGGCTACGTCTTGCTGGCGTTCG  6310


 Score =  170 bits (188),  Expect = 1e-37
 Identities = 94/94 (100%), Gaps = 0/94 (0%)
 Strand=Plus/Plus

Query  6839  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  6898
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  7116  AGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTT  7175

Query  6899  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  6932
             ||||||||||||||||||||||||||||||||||
Sbjct  7176  ATCATGCAACTCGTAGGACAGGTGCCGGCAGCGC  7209


>gb|U59231.1|CVU59231 Cloning vector cLHYGpk, complete sequence
Length=10310

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1440  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1499

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1500  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1559

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1560  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1619

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1620  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1679

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1680  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1739

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1740  GGGCTACGTCTTGCTGGCGTTCG  1762


>emb|X98612.1| Artificial cloning vector pjb8
Length=5410

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2400  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  2459

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2460  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  2519

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2520  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  2579

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2580  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2639

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2640  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2699

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2700  GGGCTACGTCTTGCTGGCGTTCG  2722


>gb|U54830.1|SCU54830 Synthetic E. coli Tn3-derived transposon green fluorescent protein 
(GFP), OMP decarboxylase (URA3), and tetracycline efflux 
protein (tet) genes, complete cds
Length=4342

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3250  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  3309

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3310  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  3369

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3370  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  3429

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3430  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  3489

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  3490  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  3549

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  3550  GGGCTACGTCTTGCTGGCGTTCG  3572


>gb|U54829.1|SCU54829 Synthetic E. coli Tn3-derived transposon OMP decarboxylase (URA3), 
and tetracycline efflux protein (tet) genes, complete 
cds, and beta-galactosidase (lacZ) gene, partial cds
Length=6107

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5015  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5074

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5075  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5134

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5135  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5194

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5195  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5254

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5255  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5314

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5315  GGGCTACGTCTTGCTGGCGTTCG  5337


>gb|U54828.1|SCU54828 Synthetic E. coli Tn3-derived transposon OMP decarboxylase (URA3) 
and tetracycline efflux protein (tet) genes, complete cds, 
and beta-galactosidase gene (lacZ), partial cds
Length=6119

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5027  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  5086

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5087  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  5146

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5147  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  5206

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5207  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  5266

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5267  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  5326

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  5327  GGGCTACGTCTTGCTGGCGTTCG  5349


>gb|U46855.1|CVU46855 Cloning vector pAS1-tet tetracycline resistance gene, partial 
cds, TRP1 gene, complete cds, GAL4 (ADH1) gene, complete cds
Length=7190

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  652   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  711

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  712   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  771

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  772   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  831

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  832   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  891

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  892   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  951

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  952   GGGCTACGTCTTGCTGGCGTTCG  974


>dbj|D45834.1|SYNPKF339 Size marker plasmid pKF339 DNA, complete sequence
Length=11943

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1779  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  1838

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1839  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1898

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1899  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1958

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1959  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  2018

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2019  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  2078

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  2079  GGGCTACGTCTTGCTGGCGTTCG  2101


>gb|U46780.1|SCU46780 Synthetic construct trap vector for isolation of bacterial IS 
elements, aminoglycoside-3:adenyltransferase (aadA), neomycin 
phosphotransferase (neo), chloramphenicol acetyl transferase 
(cat), beta-lactamase (bla) genes, complete cds
Length=8097

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4353  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  4412

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4413  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  4472

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4473  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  4532

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4533  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  4592

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4593  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  4652

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  4653  GGGCTACGTCTTGCTGGCGTTCG  4675


>gb|L76273.1|SYNHPH Cloning vector pMLF2 hygromycin B phosphotransferase (HPH) gene, 
complete cds
Length=9184

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6184  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6243

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6244  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6303

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6304  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6363

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6364  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  6423

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6424  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  6483

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  6484  GGGCTACGTCTTGCTGGCGTTCG  6506


>emb|X95387.1| Expression vector pKK233-3 containing origin of replication from 
phage M13
Length=4991

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  918   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  977

Query  6865  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  978   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  1037

Query  6925  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1038  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  1097

Query  6985  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1098  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  1157

Query  7045  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1158  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  1217

Query  7105  GGGCTACGTCTTGCTGGCGTTCG  7127
             |||||||||||||||||||||||
Sbjct  1218  GGGCTACGTCTTGCTGGCGTTCG  1240


>gb|U39286.1|CVU39286 Cloning vector TLF97-3, phage lambda lacZ translational fusion 
vector, complete sequence
Length=42531

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25043  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  25102

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25103  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  25162

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25163  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  25222

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25223  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  25282

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25283  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  25342

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  25343  GGGCTACGTCTTGCTGGCGTTCG  25365


>gb|U39285.1|CVU39285 Cloning vector TLF97-2, phage lambda lacZ translational fusion 
vector, complete sequence
Length=42530

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25042  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  25101

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25102  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  25161

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25162  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  25221

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25222  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  25281

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25282  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  25341

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  25342  GGGCTACGTCTTGCTGGCGTTCG  25364


>gb|U39284.1|CVU39284 Cloning vector TLF97-1, lambda phage lacZ translational fusion 
vector, complete sequence
Length=42529

 Score =  583 bits (646),  Expect = 5e-162
 Identities = 323/323 (100%), Gaps = 0/323 (0%)
 Strand=Plus/Plus

Query  6805   TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  6864
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25041  TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCAT  25100

Query  6865   GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  6924
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25101  GACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCC  25160

Query  6925   GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  6984
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25161  GGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG  25220

Query  6985   CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  7044
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25221  CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCC  25280

Query  7045   CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  7104
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  25281  CGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT  25340

Query  7105   GGGCTACGTCTTGCTGGCGTTCG  7127
              |||||||||||||||||||||||
Sbjct  25341  GGGCTACGTCTTGCTGGCGTTCG  25363



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 273360885226544


  Database: Kluyveromyces dobzhanskii (Sep 2011)
    Posted date:  Sep 16, 2011  10:25 AM
  Number of letters in database: 10,741,898
  Number of sequences in database:  1

  Database: Kluyveromyces dobzhanskii genes (Sep 2011)
    Posted date:  Sep 16, 2011  10:26 AM
  Number of letters in database: 7,360,030
  Number of sequences in database:  4,995

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1
    Posted date:  Aug 29, 2011  1:00 PM
  Number of letters in database: 9,910,115
  Number of sequences in database:  336

  Database: Kluyveromyces aestuarii ATCC 18862 AEAS00000000_1 genes
    Posted date:  Aug 29, 2011  5:32 PM
  Number of letters in database: 7,032,861
  Number of sequences in database:  4,706

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1
    Posted date:  Aug 29, 2011  1:01 PM
  Number of letters in database: 9,807,744
  Number of sequences in database:  510

  Database: Kluyveromyces wickerhamii UCD 54 210 AEAV00000000_1 genes
    Posted date:  Aug 30, 2011  10:10 AM
  Number of letters in database: 7,134,491
  Number of sequences in database:  4,869

  Database: Kluyveromyces lactis
    Posted date:  Aug 15, 2011  4:06 PM
  Number of letters in database: 7,394,976
  Number of sequences in database:  5,076

  Database: Kluyveromyces lactis NRRL Y-1140
    Posted date:  Aug 15, 2011  4:00 PM
  Number of letters in database: 10,729,447
  Number of sequences in database:  7

  Database: Saccharomyces cerevisiae
    Posted date:  Jul 14, 2011  9:42 PM
  Number of letters in database: 12,155,026
  Number of sequences in database:  17

  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Nov 30, 2011  4:13 AM
  Number of letters in database: 39,074,138,929
  Number of sequences in database:  15,099,719



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>gi|2856|emb|X06997.1| Kluyveromyces lactis LAC12 gene for lactose permease
GCGACTTGGAAGGCCAAAGGACTATCGCATGATTATTCGCCGGGAACCCGCGAGTTCCCTGCTCTTTTCT
TTCAAACCAGGCAGCAAACCAGGTGAACACACTCTGATGTAGTGCAGTCCCTAAGTCCTTTGAAGATTCG
GGGAGCTAGCTACCCACGCGAATGTAACAAAAGAACATTTACTTTTGTGGGGGGTGGAAAAGTCGATTAG
GATCTTGCAGCACAGAAACTGCGCAGGGGTTTTTTTCATCTTGGAGAAGCAACTGGCTAAATTCGACACA
AACAAAAACTGAAAAATGGAAAATAAAAAATGAAAAAGCAAGCTGAATTCGAAGAAGGGAGAATTCCGCC
TTCTGCAACCACACTAATGGTTGGTAGTCAATAGATACGCATTAGAAGGTTACTATTTTATGAGTCGATC
CCCGCGGAAATTTAGGAATTTTAAACTTGGGCTTGATATACGTCGGTATAGTGTATCTGGTATTTTTGCC
AATGGTTCCTGTGCCCGTGCCCGTGCCCGTGTGCTCATGCGATGCATTGTGACTACTGCTTGGCAAGGCA
AATCAGCGGTCTGCGGCCGTACTCTAAAGCCGGACAGACATGGTGGGGTGCCTTTTCGGTCCATAAGTGT
AACTAGCTAGCTACAAGTATGTTCTGTGCAAAGATGGTAAAGGTTGCATACAGTCAAGTTGCTGTCCTTG
GACCTGGTCTGACCTGACCTAGCTTAACATTGCATAGCGCATACCCACTTGGATGGATGCAGGAGTGTTA
CAAATCGGCGAACAGTTCTCCTTGTTTGTTTTTGGTCATAGTCACGTCCGGCTACACACAAGATATGGCA
CAGTATGTGTAGATGCGAGCGAAGATACGGCTGGAAAACAGGTGGGTTTTGAAGGATAGACAGAAGGCAA
GAGGGTGGGCAAAAAGTCGGGCACTCAGGCAAGTATTGGCATGATCAAACCAGATTAAGTTCTAGGCCAA
GAACATATTTCGGCCCACTGACTCCCGCCAAAAAAAAAGAAAAAAACCTAATTTGACAGTCTCGGAATTT
TATCTATCTGTTCCTTTCCTTTGGTTACTAGTATCGTCATTTAATTTTTTTTGGAATTGGCAAGTTACCT
GCGTGGCTCTATACCGAATGAACCCCGACCCTGGCCGTTCGGTGCACCGAGCGCGTTTACGTGTGTACAC
GCTTTTGTAAGAAAGAAACTCGGGTCTGCGTGGGCCTGCAACGTGACTTAGCAATACCCGCGCGTCAGAT
TTAACATATTCGGGATTCTTCCCTCCGTACTAGAAAGTTGACAATAAGATGTCCATACTGTTGTTGATAC
CTTGCTACTCTAGCTCATTATGACAAGGACAATCGGTTAATTGGAGGTCTAAATGGTGTATCAAGGTATA
TAAAGGCAGTAACTTTCAATGTTGAGTTGGGCTGTAGTTCAAGGTGGTTGTAGCTTCTGGAACATATATA
TGCTATTCAATATAGCTGGAAAGTGTAAGCTAAACAGCAAACAAAAGTCTCTGTGTGTTGTCTTATAATT
ATATCCTTCAGTCAGTGTTAATGATTAAAGACAGAATTACGAAAAAATAAAACAAGACGATAATCAGTTT
TCAAAATGGCAGATCATTCGAGCAGCTCATCTTCGCTGCAGAAGAAGCCAATTAATACTATCGAGCATAA
AGACACTTTGGGCAATGATCGGGATCACAAGGAAGCCTTGAACAGTGATAATGATAATACTTCTGGATTG
AAAATCAATGGTGTCCCCATCGAGGACGCTAGAGAGGAAGTGCTCTTACCAGGTTACTTGTCGAAGCAAT
ATTACAAATTGTACGGTTTATGTTTTATAACATATCTGTGTGCTACTATGCAAGGTTATGATGGGGCTTT
AATGGGTTCTATCTATACCGAAGATGCATATTTGAAATACTACCATTTGGATATTAACTCATCCTCTGGT
ACTGGTCTAGTGTTCTCTATTTTCAACGTTGGTCAAATTTGCGGTGCATTCTTTGTTCCTCTTATGGATT
GGAAAGGTAGAAAACCTGCTATTTTAATTGGGTGTCTGGGTGTTGTTATTGGTGCTATTATTTCGTCTTT
AACAACAACAAAGAGTGCATTAATTGGTGGTAGATGGTTCGTGGCCTTTTTCGCTACAATCGCTAATGCA
GCAGCTCCAACATACTGTGCAGAAGTGGCTCCAGCTCACTTAAGAGGTAAGGTTGCAGGTCTTTATAACA
CCCTTTGGTCTGTCGGTTCCATTGTTGCTGCCTTTAGCACTTACGGTACCAACAAAAACTTCCCTAACTC
CTCCAAGGCTTTTAAGATTCCATTATACTTACAAATGATGTTCCCAGGTCTTGTGTGTATATTTGGTTGG
TTAATCCCAGAATCTCCAAGATGGTTGGTTGGTGTTGGCCGTGAGGAAGAAGCTCGTGAATTCATTATCA
AATACCACTTAAATGGCGATAGAACTCATCCATTATTGGATATGGAGATGGCAGAAATAATAGAATCTTT
CCATGGTACAGATTTATCAAACCCTCTAGAAATGTTAGATGTAAGGAGCTTATTCAGAACGAGATCGGAT
AGGTACAGAGCAATGTTGGTTATACTTATGGCTTGGTTCGGTCAATTTTCCGGTAACAATGTGTGTTCGT
ACTATTTGCCTACCATGTTGAGAAATGTTGGTATGAAGAGTGTCTCATTGAATGTGTTAATGAATGGTGT
TTATTCCATCGTCACTTGGATTTCTTCAATTTGCGGTGCATTCTTTATTGATAAGATTGGTAGAAGGGAA
GGTTTCCTTGGTTCTATCTCAGGTGCTGCATTAGCATTGACAGGTCTATCTATCTGTACTGCTCGTTATG
AGAAGACTAAGAAGAAGAGTGCTTCCAATGGTGCATTGGTGTTCATTTATCTCTTTGGTGGTATCTTTTC
TTTTGCTTTCACTCCAATGCAATCCATGTACTCAACAGAAGTGTCTACAAACTTGACGAGATCTAAGGCC
CAACTCCTCAACTTTGTGGTTTCTGGTGTTGCCCAATTTGTTAATCAATTTGCTACTCCAAAGGCAATGA
AGAATATCAAATATTGGTTCTATGTGTTCTACGTTTTCTTCGATATTTTCGAATTTATTGTTATCTACTT
CTTCTTCGTTGAAACTAAGGGTAGAAGCTTAGAAGAATTAGAAGTTGTCTTTGAAGCTCCAAACCCAAGA
AAGGCATCCGTTGATCAAGCATTCTTGGCTCAAGTCAGGGCAACTTTGGTCCAACGAAATGACGTTAGAG
TTGCAAATGCTCAAAATTTGAAAGAGCAAGAGCCTCTAAAGAGCGATGCTGATCATGTCGAAAAGCTTTC
AGAGGCAGAATCTGTTTAAAGCCATCTTTTCAATATATTTTGTTAGGTGCAAGAAGTTTCCGTACTTCAT
AATTTGTTTTTTATTCTGCTTGATCTTCTCCTAATTGCAGCAAAAAGTCTTGTGGAATTCATCAATTAAA
AAGCCACAGGCTTTAGACTCTTAATGGATTATTCTAACAGTTACTGTTAGACGTTAGCACATGGGCCGGT
ATGTCATTGAAGTACGTTTAAATTGCCTGAATTGGGAAAAGTATTGACCTTTGAGCCGGTTGCATACCGC
CTTGCGGTATGCAGTTTGGCTCGGTTTTCCCAGCACGCATGTGGGCATCATTTCCACACGTGTGAACCCT
CGGCAGTTAAATGTGTGCATTTAGGATCGGCTAATAGTTGTTTTTAGCTTCAGCTTCAGCTCATCGGATT
TTGTGAAACATATAAATCTGGCGTCAATTGAGTCTCTCGAATGGTTGAAAGGTCAATTCAGGTTGGAATT
TTGTATTATGTTAGCTATATGGGATTGATCAAAAAAACCAGCCAAGGATTCAGAGAATTACAGCGCAAGC
TCAGGTAGCACTCCAGTTTTAAACATAAAAAATGAAATTCTCCGATTTTAGTGTTCTCGGATTAGGTGCT
CTTGCCTTAAATGCCGTTACCGTCAGTGCTAACACTGCTGACACCGCTTTGTTGAGAACTTACTCTACTA
TCTCTCCAAGTTTGAGTGAAATTGAATCCGCCGCTTCTGCTACTGAGGTTGCTGAGGTGGTTTCAGATGT
CGAAGGTGCCGCTTTCAAGAGATTCTTCATTATCTTCTTGGAAAACACCGATTACGACAAGGCTGCTGGT
GATGAATCCCTTTCATGGCTGGCTGAACAAGGTATTACCTTGACCAACTACTGGGCTTTGACTCACCCTT
CAGAACCAAACTATTTGGCTTCTGTCGGTGGTGATTACTTCGCCTTGGATGATGACAGATTTATTTCTAT
GCCATCCAATGTGTCTAACATCGTTGATTTGTTGGACACTAAGGGTATCTCTTGGGCTGAATACCAAGAA
CACTCTCCATATGCTGGTTTCCAAGGTATGAACTTCTCTAACCAAGAGACATACGCCAGTGATTATGTCA
GAAAACATAACCCATTGATTTTGTTCGATAACGTTGTCAACAACGATACTCGTTTGGCTAACATTAAGAA
CTTTGAAGATTTCAACAATGACGTAGAAAACGAAAAGTTACCTCAATACGCTTTCATTACTCCAAATATG
ACTAACGATGGTCATGACACCACTATCCAATTTGCTGGTAAATGGTCAAAGGACTTCTTGGCTCCATTAT
TAGAAAACGATTACTTCATGGAGGACACTTTGGTCTTGTTGACCTTCGATGAAAATGAAACCTATGGTAT
CAAGAACAAGGTCTTCTCCATCTTGTTGGGTGGCGTTATCCCAGATGAATTGAAGGGTACCAAGGATGAT
ACTTTCTATGACCATTACTCTCAATTGGCTAGTGTTGAAGCCAACTGGGATTTGCCTCATTTAGGTAGAC
ACGATGGTGACGCCAATGTTTTGGAAATTGTTGCTAACGCTACCAACATCACCAACGTTGAAGTTGACAC
CACTTACATGATCAACGAAACCTATATTGGTTACTTGAACGATTACAACATTGAATTGCCAGCTCCAAAT
GTTACTGCTATTAACAGAAACGGTCAACCAATCTTGGACTCCATCAAGGAAACTTGGGAAGATGAATATT
CTAAGCAAGTCTCTGAATCCTACTATACTTCCACCACTACTACCGTTTCTGCAGATGTTACTGATGCTGA
AACCTTCTCCAATTTCTACCGCTACCGACAGTGCTGATGAAACTAGTGCTACCGCTACATCTTCTTCCAA
CAGCACTTCTGCTGAAACTTTAAGCTCTTCCGCCGGTGCTCCATCAATGAGCACTTCTCCGGTAACGTCT
TGTTGGGTGTCATTGCTGCCTTTTTCTTATGAAAAGATATCGACTCAAAGGAGTAGCAGCACACTCCTAT
AGAGAAACTAGAGTGAAAACGGCAGTTCACTCTTAGTTAATATTATTTATTCCGTACAAATAGAACAGTT
GAAAAGTGACGCTTTTATAAAATAAGAACTTGATTTTGATTTGACCTTTTAATTATTAACCTTATCATTG
AATAATAAGTATTATTTCCTTTTACTTGATATCTTCTTAGTCTTGACAACTGAAATATTGTACGTCTGTC
TTGAAATTTAGCTAGTGGTTCAAGAACCGTCATAGGAAAAAATACCTATTTTTTGTGGTATGCTGTTAGT
AATGAATATATGTTTTGATTGTATATCTAATCGAGAAAAAGAAATGCAGAATGACAGAGACTCCTGTCTG
GTTTCAATGTCATGAAAAGTTGTGCATAAGCAAACTTAACAATTAGATAAGATGGAAAAGTTCAAGTACT
CCCCTCCCCATTGTTGATTCTGAATTGTAATACCTTGTCCTAATCGGAATTTTCATGACAAGAGGGTCAA
GCCCAACTTTCTTTTAATGCCCTAGTCACTAATATCTCATTTTCATTTTCCGCAGTTAGATTGGTTAGAT
GTGGCAGAATTTTTGGAACGAACCTCCCGTGGGTTGTCTAATATTAAATACAGACACTTTATAACCAGTA
TTCTTTTTTTTTCCTTATTATTCTCATTTATTTCTCTCATTACTTTTGTCCAGGAATATCTTAACTCTGG
CATCAATCACTGAAGCAAAGTTCCACGTCGGGGTTCGGCAGTAAACCCATACTGTCTTTCGTGCCCTCCT
TATAAACTTTTCACCTAAGTAAACATTAGTTCTTAGTATTCCAAATTTCGTACACCAGCTATCATTATAA
CGATCAGTATACTGCAAAGCTTCAAAAGTTGAGAGTTGACGTGCCTTCCCTAACAAAACCCATCCCATAT
CCTTTTTGTCCAACATCTCAAACTTTATTTCAGTTTTGTCTAGTTTCTGTGTTATGCAGATAAGCTGTGC
ATATAAATGTTGGAAATAAGCTAAGCTGTTACGTTTTGTTCTCAGTTGTTAGCAAGAGCAGTAAATCAAA
AATGATTGTTCTTTTGGAACCACCCAAGTAAAAAACATATCCACATCTGTAAGTGTCCGCGATAAAACCG
AACCCGAAAGTGAGATTCCTCCCATTATTACGCACGAAGGAGTTATTCTCATCTTGTCAGTAGCCTTATC
CGTATCCGCTTTTTTATTATTACCGTGACATTCACTAAGCTATTTTGCTAGCCCACTCCTAACACATAGC
GTTTTGAGCGTCTTGGGTACTTACTATGAAAATGACAGTTAACTACTTTTGACTAGTCACAGGTTTTAGA
TCAAAGAATCTTGGGAAAAAGATCGTATTTTATAGTTAATTTTATTGTTTCATATCTATTATTTTGAGGT
GCTTTACGGACTCCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGG
GCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGC
GCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTA
TTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGC
AGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCG
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)