blastn task: [no title]

Status
finished finished
Modified 2015-09-21T14:54:19Z
CPU time (s) 37.1
Size (bytes) 588767
Command blastn -num_descriptions 500 -outfmt 0 -dust no -db nt -num_alignments 250 -evalue 10.0 -task blastn
Error [none]
Output
BLASTN 2.2.25+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
           15,099,719 sequences; 39,074,138,929 total letters



Query= query

Length=484
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

gb|FJ633349.1|  Synthetic construct Drosophila melanogaster clone...   874    0.0   
gb|AE013599.4|  Drosophila melanogaster chromosome 2R, complete s...   874    0.0   
ref|NM_166356.1|  Drosophila melanogaster beta-Tubulin at 56D (be...   874    0.0   
ref|NM_079071.2|  Drosophila melanogaster beta-Tubulin at 56D (be...   874    0.0   
gb|AC099013.1|  Drosophila melanogaster, chromosome 2R, region 56...   874    0.0   
gb|BT003242.1|  Drosophila melanogaster LD43681 full insert cDNA       874    0.0   
gb|AC004299.1|AC004299  Drosophila melanogaster DNA sequence (P1 ...   874    0.0   
gb|BT125650.1|  Drosophila melanogaster GH12877 full insert cDNA       868    0.0   
ref|XM_002082197.1|  Drosophila simulans GD25319 (Dsim\GD25319), ...   868    0.0   
ref|XM_002034556.1|  Drosophila sechellia GM19828 (Dsec\GM19828),...   865    0.0   
ref|XM_002091745.1|  Drosophila yakuba betaTub56D (Dyak\betaTub56...   850    0.0   
ref|XM_001974777.1|  Drosophila erecta GG20906 (Dere\GG20906), mRNA    847    0.0   
gb|M20419.1|DROTUBB1A  D.melanogaster beta-1 tubulin mRNA, comple...   841    0.0   
ref|NM_166355.2|  Drosophila melanogaster beta-Tubulin at 56D (be...   830    0.0   
ref|XM_002136590.1|  Drosophila pseudoobscura pseudoobscura GA276...   706    0.0   
ref|XM_002018475.1|  Drosophila persimilis GL16725 (Dper\GL16725)...   706    0.0   
ref|NM_166357.1|  Drosophila melanogaster beta-Tubulin at 56D (be...   691    0.0   
ref|XM_001958843.1|  Drosophila ananassae GF12605 (Dana\GF12605),...   688    0.0   
ref|XM_001986980.1|  Drosophila grimshawi GH20203 (Dgri\GH20203),...   661    0.0   
gb|EU673725.1|  Drosophila silvestris beta-tubulin (betaTub56D) m...   652    0.0   
ref|XM_002063777.1|  Drosophila willistoni GK15706 (Dwil\GK15706)...   616    5e-173
ref|XM_002005862.1|  Drosophila mojavensis GI20729 (Dmoj\GI20729)...   603    3e-169
ref|XM_001844579.1|  Culex quinquefasciatus tubulin beta chain, mRNA   594    2e-166
gb|DQ401465.1|  Culex pipiens pipiens clone CpiED-B06 beta tubuli...   589    8e-165
ref|XM_002049908.1|  Drosophila virilis GJ20466 (Dvir\GJ20466), mRNA   585    9e-164
emb|BX032959.1|  Single read from an extremity of a full-length c...   569    7e-159
ref|XM_309765.4|  Anopheles gambiae str. PEST AGAP010929-PA (AgaP...   567    2e-158
ref|XM_001743918.1|  Monosiga brevicollis MX1 beta tubulin MONBRD...   558    1e-155
emb|BX056514.1|  Single read from an extremity of a full-length c...   558    1e-155
emb|BX060680.1|  Single read from an extremity of a full-length c...   556    4e-155
dbj|AK383913.1|  Bombyx mori mRNA, clone: MFB-26O24                    554    2e-154
emb|BX043950.1|  Single read from an extremity of a full-length c...   554    2e-154
gb|AY026071.1|  Monosiga brevicollis beta-tubulin mRNA, complete cds   554    2e-154
dbj|AP009001.1|  Bombyx mori genomic DNA, chromosome 20, BAC clon...   549    7e-153
ref|XM_001743385.1|  Monosiga brevicollis MX1 beta tubulin MONBRD...   549    7e-153
ref|NM_001043422.1|  Bombyx mori beta-tubulin (Tub1), mRNA >dbj|A...   549    7e-153
dbj|AB003287.1|  Bombyx mori mRNA for beta-tubulin, complete cds       549    7e-153
emb|BX033714.1|  Single read from an extremity of a full-length c...   542    1e-150
dbj|AK384111.1|  Bombyx mori mRNA, clone: fcaL08B15_K01268             540    3e-150
gb|JN029962.1|  Agrotis ipsilon beta-tubulin mRNA, complete cds        540    3e-150
gb|JF767013.1|  Helicoverpa armigera beta-tubulin mRNA, complete cds   540    3e-150
gb|BT026927.1|  Gasterosteus aculeatus clone CFW104-D01 mRNA sequ...   535    1e-148
ref|XM_002609454.1|  Branchiostoma floridae hypothetical protein,...   531    2e-147
gb|EU234504.1|  Mythimna separata beta-tubulin mRNA, complete cds      531    2e-147
ref|XM_001600804.1|  PREDICTED: Nasonia vitripennis tubulin beta-...   524    3e-145
gb|DQ833528.1|  Aedes aegypti beta-4 tubulin (B4t) gene, complete...   518    1e-143
gb|EF207965.1|  Heliconius erato beta-tubulin-like (Btub) mRNA, c...   517    4e-143
dbj|AK377493.1|  Bombyx mori mRNA, clone: fwd-31A24                    515    1e-142
ref|XM_003461107.1|  PREDICTED: Cavia porcellus tubulin, beta 4 (...   513    5e-142
dbj|AK378049.1|  Bombyx mori mRNA, clone: ffbm37A20                    513    5e-142
dbj|AK377518.1|  Bombyx mori mRNA, clone: fwd-33B15                    513    5e-142
ref|NM_001194791.1|  Macaca mulatta tubulin, beta 4B class IVb (T...   513    5e-142
ref|XM_002799911.1|  PREDICTED: Macaca mulatta tubulin beta-2C ch...   513    5e-142
ref|XM_002799910.1|  PREDICTED: Macaca mulatta tubulin beta-2C ch...   513    5e-142
ref|XM_002799908.1|  PREDICTED: Macaca mulatta tubulin beta-2C ch...   513    5e-142
gb|EF432510.1|  Chlorophyte sp. W-c clone B6 beta tubulin (btub) ...   513    5e-142
ref|XM_002096902.1|  Drosophila yakuba GE24779 (Dyak\GE24779), mRNA    513    5e-142
ref|XM_001694020.1|  Chlamydomonas reinhardtii beta tubulin 1 (TU...   513    5e-142
ref|XM_001693945.1|  Chlamydomonas reinhardtii beta tubulin 2 (TU...   513    5e-142
ref|XM_001655975.1|  Aedes aegypti tubulin beta chain partial mRNA     513    5e-142
dbj|AB170261.1|  Macaca fascicularis brain cDNA clone: QbsB-11061...   513    5e-142
gb|EF064248.1|  Blastocladiella emersonii beta-tubulin mRNA, comp...   513    5e-142
gb|DQ833529.1|  Aedes aegypti beta-1 tubulin (B1t) gene, partial cds   513    5e-142
gb|AY770744.1|  Drosophila teissieri beta 2 tubulin mRNA, complet...   513    5e-142
ref|NM_001043499.1|  Bombyx mori beta-tubulin (Tub2), mRNA >dbj|A...   513    5e-142
dbj|AB011069.1|  Bombyx mori mRNA for beta-tubulin, complete cds       513    5e-142
dbj|AK377475.1|  Bombyx mori mRNA, clone: fwd-29C23                    509    6e-141
dbj|AK377309.1|  Bombyx mori mRNA, clone: fwd-11J16                    509    6e-141
gb|AF030547.1|AF030547  Manduca sexta beta-1 tubulin mRNA, comple...   509    6e-141
ref|XM_002092765.1|  Drosophila yakuba GE14397 (Dyak\GE14397), mRNA    508    2e-140
gb|AY226059.1|  Proterospongia sp. ATCC 50818 beta-tubulin mRNA, ...   508    2e-140
emb|AL832497.1|  Homo sapiens mRNA; cDNA DKFZp686J1451 (from clon...   508    2e-140
dbj|AK380732.1|  Bombyx mori mRNA, clone: fufe12I11                    504    2e-139
dbj|AK377513.1|  Bombyx mori mRNA, clone: fwd-32M22                    504    2e-139
dbj|AK377476.1|  Bombyx mori mRNA, clone: fwd-29D19                    504    2e-139
dbj|AK377425.1|  Bombyx mori mRNA, clone: fwd-23C23                    504    2e-139
ref|NM_001246378.1|  Pan troglodytes tubulin, beta 2C (TUBB2C), m...   504    2e-139
gb|HQ447292.1|  Synthetic construct Homo sapiens clone IMAGE:1000...   504    2e-139
dbj|AB491615.1|  Oltmannsiellopsis viridis Btub mRNA for beta-tub...   504    2e-139
dbj|AB590760.1|  Synthetic construct DNA, clone: pFN21AE1911, Hom...   504    2e-139
ref|XM_001980792.1|  Drosophila erecta betaTub85D (Dere\betaTub85...   504    2e-139
gb|BC071888.1|  Homo sapiens cDNA clone IMAGE:3958193, **** WARNI...   504    2e-139
gb|AY167990.1|  Homo sapiens class IVb beta tubulin mRNA, complet...   504    2e-139
dbj|AK026594.1|  Homo sapiens cDNA: FLJ22941 fis, clone KAT08078,...   504    2e-139
dbj|AK026167.1|  Homo sapiens cDNA: FLJ22514 fis, clone HRC12119,...   504    2e-139
dbj|AK000560.1|  Homo sapiens cDNA FLJ20553 fis, clone KAT11806, ...   504    2e-139
ref|NM_006088.5|  Homo sapiens tubulin, beta 4B class IVb (TUBB4B...   504    2e-139
gb|BC071889.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC002885.2|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC007889.2|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC012835.2|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC004188.2|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC039175.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC024038.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC029529.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC019829.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC019359.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC001911.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|BC002783.1|  Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M...   504    2e-139
gb|AF102890.1|AF102890  Gadus morhua beta-1 tubulin mRNA, complet...   504    2e-139
dbj|AK377284.1|  Bombyx mori mRNA, clone: fwd-07N19                    502    9e-139
dbj|AB491666.1|  Prasinoderma coloniale Btub gene for beta-tubuli...   500    3e-138
ref|XM_843368.2|  PREDICTED: Canis lupus familiaris tubulin, beta...   499    1e-137
ref|XM_002926120.1|  PREDICTED: Ailuropoda melanoleuca tubulin be...   499    1e-137
ref|XM_002608871.1|  Branchiostoma floridae hypothetical protein,...   499    1e-137
dbj|AK026609.1|  Homo sapiens cDNA: FLJ22956 fis, clone KAT09938,...   499    1e-137
dbj|AB642157.1|  Haemaphysalis longicornis Hltub mRNA for beta-tu...   495    1e-136
ref|XM_003122352.2|  PREDICTED: Sus scrofa tubulin beta-2C chain-...   495    1e-136
ref|XM_001154870.2|  PREDICTED: Pan troglodytes tubulin beta-8 ch...   495    1e-136
ref|NM_079566.4|  Drosophila melanogaster beta-Tubulin at 85D (be...   495    1e-136
dbj|AK349426.1|  Sus scrofa mRNA, clone:PTG010068E12, expressed i...   495    1e-136
gb|FJ637829.1|  Synthetic construct Drosophila melanogaster clone...   495    1e-136
gb|FJ633272.1|  Synthetic construct Drosophila melanogaster clone...   495    1e-136
gb|EU429675.1|  Chilo suppressalis beta-tubulin mRNA, complete cds     495    1e-136
dbj|AK235338.1|  Sus scrofa mRNA, clone:OVRM10070A11, expressed i...   495    1e-136
dbj|AK234279.1|  Sus scrofa mRNA, clone:OVR010036H08, expressed i...   495    1e-136
gb|AY118725.1|  Drosophila melanogaster GH02051 full insert cDNA       495    1e-136
ref|NM_001004400.2|  Gallus gallus tubulin, beta 2B class IIb (TU...   495    1e-136
gb|M11443.1|CHKTUBB2  Chicken beta-2 tubulin gene, complete cds        495    1e-136
gb|AY705361.1|  Drosophila yakuba testis beta tubulin mRNA, parti...   493    4e-136
gb|BT082806.1|  Anoplopoma fimbria clone afim-evh-504-080 Tubulin...   491    2e-135
gb|AF267186.1|AF267186  Malawimonas jakobiformis clone 7 beta-tub...   491    2e-135
ref|XM_003281893.1|  PREDICTED: Nomascus leucogenys tubulin beta-...   489    5e-135
ref|XM_003279817.1|  PREDICTED: Nomascus leucogenys tubulin beta-...   489    5e-135
ref|XM_003279816.1|  PREDICTED: Nomascus leucogenys tubulin beta-...   489    5e-135
ref|XM_003279810.1|  PREDICTED: Nomascus leucogenys tubulin, beta...   489    5e-135
tpg|BK007274.1|  TPA: TPA_exp: Amblyomma variegatum beta-tubulin ...   489    5e-135
ref|NM_177987.2|  Homo sapiens tubulin, beta 8 class VIII (TUBB8)...   489    5e-135
ref|XM_001231209.1|  PREDICTED: Gallus gallus similar to tubulin,...   489    5e-135
dbj|AK235126.1|  Sus scrofa mRNA, clone:OVRM10051G07, expressed i...   489    5e-135
ref|XM_962174.1|  PREDICTED: Tribolium castaneum similar to beta1...   489    5e-135
ref|XM_003356513.2|  PREDICTED: Sus scrofa tubulin beta-2A chain-...   486    7e-134
ref|XM_533934.3|  PREDICTED: Canis lupus familiaris tubulin, beta...   486    7e-134
ref|XM_001496273.3|  PREDICTED: Equus caballus tubulin beta-4 cha...   486    7e-134
ref|XM_003281493.1|  PREDICTED: Nomascus leucogenys tubulin beta-...   486    7e-134
dbj|AB491630.1|  Pseudoscourfieldia marina Btub gene for beta-tub...   486    7e-134
ref|XM_002820461.1|  PREDICTED: Pongo abelii tubulin beta-8 chain...   486    7e-134
ref|XM_001998470.1|  Drosophila mojavensis GI23599 (Dmoj\GI23599)...   486    7e-134
gb|DQ113487.1|  Pterosperma cristatum pctub1 beta-tubulin gene, p...   486    7e-134
ref|NM_001034663.1|  Bos taurus tubulin, beta 2C (TUBB2C), mRNA >...   486    7e-134
gb|AF267189.1|AF267189  Reclinomonas americana clone 18 beta-tubu...   486    7e-134
gb|AF267187.1|  Reclinomonas americana clone 12 beta-tubulin gene...   486    7e-134
gb|AY729818.1|  Isochrysis galbana beta-tubulin gene, partial cds      486    7e-134
gb|M11442.1|CHKTUBB1  Chicken beta-1 tubulin gene, complete cds        486    7e-134
gb|M20420.1|DROTUBB2A  D.melanogaster beta-2 tubulin mRNA, comple...   486    7e-134
dbj|AK240294.1|  Sus scrofa mRNA, clone:UTR010051F07, expressed i...   482    8e-133
dbj|AK236779.1|  Sus scrofa mRNA, clone:PBL010003G07, expressed i...   482    8e-133
gb|DQ113488.1|  Pterosperma cristatum pctub2 beta-tubulin gene, p...   482    8e-133
ref|XM_003280241.1|  PREDICTED: Nomascus leucogenys tubulin beta-...   480    3e-132
ref|XM_002714359.1|  PREDICTED: Oryctolagus cuniculus tubulin, be...   480    3e-132
ref|XM_002104092.1|  Drosophila simulans GD20798 (Dsim\GD20798), ...   480    3e-132
ref|XM_002031868.1|  Drosophila sechellia GM26260 (Dsec\GM26260),...   480    3e-132
gb|BC157066.1|  Synthetic construct Homo sapiens clone IMAGE:1000...   480    3e-132
gb|BC156319.1|  Synthetic construct Homo sapiens clone IMAGE:1000...   480    3e-132
gb|BC101271.1|  Homo sapiens tubulin, beta 8, mRNA (cDNA clone IM...   480    3e-132
gb|BC101270.2|  Homo sapiens tubulin, beta 8, mRNA (cDNA clone IM...   480    3e-132
gb|AY582851.1|  Ministeria vibrans strain ATCC 50519 beta-tubulin...   480    3e-132
gb|U22050.1|PCU22050  Phytophthora cinnamomi beta-tubulin gene, c...   480    3e-132
emb|Z67992.1|  Oomycete-like MacKay2000 TubB2 mRNA for beta-tubulin    479    1e-131
ref|XM_003204777.1|  PREDICTED: Meleagris gallopavo tubulin beta-...   477    3e-131
ref|XM_002720954.1|  PREDICTED: Oryctolagus cuniculus tubulin, be...   477    3e-131
ref|XM_002602687.1|  Branchiostoma floridae hypothetical protein,...   477    3e-131
gb|BT060171.1|  Salmo salar clone ssal-rgh-507-117 Tubulin beta-1...   477    3e-131
gb|BT058464.1|  Salmo salar clone Contig1066 Tubulin beta-1 chain...   477    3e-131
ref|XM_001357805.2|  Drosophila pseudoobscura pseudoobscura GA217...   477    3e-131
gb|EF577191.1|  Spumella-like flagellate JBNA45 beta-tubulin gene...   477    3e-131
gb|AF267190.1|AF267190  Reclinomonas americana clone 22 beta-tubu...   477    3e-131
ref|NM_205315.1|  Gallus gallus tubulin, beta 2A (TUBB2A), mRNA >...   477    3e-131
ref|NM_001244101.1|  Cricetulus griseus tubulin, beta 5 class I (...   477    3e-131
dbj|AB576857.1|  Tsukubamonas globosa mRNA for beta tubulin, part...   473    4e-130
gb|EF432477.1|  Prasinophyte sp. SL-175 clone H1 beta tubulin (bt...   473    4e-130
dbj|AK283039.1|  Gryllus bimaculatus mRNA, GBcontig29900               473    4e-130
emb|AM237834.1|  Imantonia rotunda partial tubb gene for beta-tub...   473    4e-130
gb|AF267188.1|AF267188  Reclinomonas americana clone 14 beta-tubu...   473    4e-130
gb|AF267185.1|AF267185  Malawimonas jakobiformis clone 1 beta-tub...   473    4e-130
ref|XM_001135050.2|  PREDICTED: Pan troglodytes tubulin beta-8 ch...   471    1e-129
ref|XM_003229741.1|  PREDICTED: Anolis carolinensis tubulin beta-...   471    1e-129
ref|XM_002834671.1|  PREDICTED: Pongo abelii tubulin beta-8 chain...   471    1e-129
gb|EU079659.1|  Phytophthora captiosa isolate PD_00107(P10719) be...   471    1e-129
gb|EF495258.1|  Phytophthora capsici beta tubulin mRNA, complete cds   471    1e-129
dbj|AB491651.1|  Dolichomastix tenuilepis Btub gene for beta-tubu...   470    5e-129
emb|FN392564.1|  Imantonia rotunda partial mRNA for tubulin beta,...   470    5e-129
ref|XM_535868.3|  PREDICTED: Canis lupus familiaris tubulin, beta...   468    2e-128
ref|XM_003429369.1|  PREDICTED: Ornithorhynchus anatinus tubulin ...   468    2e-128
ref|NM_001243434.1|  Sus scrofa tubulin, beta 2B class IIb (TUBB2...   468    2e-128
ref|XM_001170953.2|  PREDICTED: Pan troglodytes tubulin beta-8 ch...   468    2e-128
ref|XM_001170922.2|  PREDICTED: Pan troglodytes tubulin beta-8 ch...   468    2e-128
dbj|AK352151.1|  Sus scrofa mRNA, clone:UTR010013F04, expressed i...   468    2e-128
gb|EU980443.1|  Anastrepha suspensa beta-1 tubulin gene, complete...   468    2e-128
gb|BT057955.1|  Salmo salar clone ssal-rgf-511-369 Tubulin beta-2...   468    2e-128
gb|BT057055.1|  Salmo salar clone ssal-evd-510-244 Tubulin beta-2...   468    2e-128
ref|NM_001139793.1|  Salmo salar Tubulin beta chain (tbb5), mRNA ...   468    2e-128
gb|EU080684.1|  Phytophthora ramorum isolate PD_00058(P10301) bet...   466    6e-128
emb|FQ225007.1|  Rattus norvegicus TL0AEA55YH02 mRNA sequence          464    2e-127
emb|FQ218503.1|  Rattus norvegicus TL0ABA51YL12 mRNA sequence          464    2e-127
emb|CT837951.1|  Oryza sativa (indica cultivar-group) cDNA clone:...   464    2e-127
ref|XM_001176315.1|  PREDICTED: Strongylocentrotus purpuratus hyp...   464    2e-127
ref|XM_786697.2|  PREDICTED: Strongylocentrotus purpuratus hypoth...   464    2e-127
gb|BC090334.1|  Rattus norvegicus tubulin, beta 2c, mRNA (cDNA cl...   464    2e-127
ref|NM_199094.1|  Rattus norvegicus tubulin, beta 4B class IVb (T...   464    2e-127
gb|AY729820.1|  Pavlova lutheri beta-tubulin gene, partial cds         464    2e-127
gb|AF092952.1|AF092952  Cyanophora paradoxa beta 1 tubulin (tubB1...   464    2e-127
ref|XR_020296.2|  PREDICTED: Pan troglodytes tubulin beta-8 chain...   462    8e-127
emb|FQ227178.1|  Rattus norvegicus TL0AEA14YK04 mRNA sequence          462    8e-127
ref|XM_002412028.1|  Ixodes scapularis beta-tubulin, putative, mRNA    462    8e-127
ref|XM_002020094.1|  Drosophila persimilis GL13671 (Dper\GL13671)...   462    8e-127
gb|EU080882.1|  Phytophthora sp. PDA576 beta-tubulin gene, partia...   462    8e-127
gb|BC118413.1|  Bos taurus tubulin, beta 2A, mRNA (cDNA clone MGC...   462    8e-127
emb|BX052775.1|  Single read from an extremity of a full-length c...   462    8e-127
emb|FQ228801.1|  Rattus norvegicus TL0ADA51YK12 mRNA sequence          461    3e-126
gb|EU080659.1|  Phytophthora macrochlamydospora isolate PD_00006(...   461    3e-126
gb|DQ980513.1|  Chrysochromulina sp. NIES-1333 beta tubulin mRNA,...   461    3e-126
ref|XM_003480812.1|  PREDICTED: Sus scrofa tubulin beta-4 chain-l...   459    9e-126
ref|XM_003455030.1|  PREDICTED: Oreochromis niloticus tubulin bet...   459    9e-126
ref|XM_851058.2|  PREDICTED: Canis lupus familiaris tubulin, beta...   459    9e-126
dbj|AB512849.1|  Pythium senticosum gene for beta-tubulin, partia...   459    9e-126
emb|FQ212956.1|  Rattus norvegicus TL0AAA50YI04 mRNA sequence          459    9e-126
emb|FQ213825.1|  Rattus norvegicus TL0AAA45YH10 mRNA sequence          459    9e-126
emb|FQ215022.1|  Rattus norvegicus TL0ACA50YB23 mRNA sequence          459    9e-126
ref|XR_096940.1|  PREDICTED: Pongo abelii tubulin beta-8 chain-li...   459    9e-126
ref|XM_001104203.2|  PREDICTED: Macaca mulatta tubulin beta-8 cha...   459    9e-126
ref|XM_002720955.1|  PREDICTED: Oryctolagus cuniculus tubulin, be...   459    9e-126
dbj|AK347939.1|  Sus scrofa mRNA, clone:OVRM10021H10, expressed i...   459    9e-126
gb|FJ168554.1|  Bodo saltans clone fosmid 5M18, complete sequence      459    9e-126
ref|XM_002070539.1|  Drosophila willistoni GK12133 (Dwil\GK12133)...   459    9e-126
gb|EU080633.1|  Phytophthora sp. P3007 beta-tubulin gene, partial...   459    9e-126
gb|EU080545.1|  Phytophthora sp. P6875 beta-tubulin gene, partial...   459    9e-126
gb|EU080511.1|  Phytophthora sp. P1087 beta-tubulin gene, partial...   459    9e-126
gb|EU080005.1|  Phytophthora macrochlamydospora isolate PD_00156(...   459    9e-126
gb|EU079999.1|  Phytophthora macrochlamydospora isolate PD_00155(...   459    9e-126
gb|EU079907.1|  Phytophthora colocasiae isolate PD_00139(P6317) b...   459    9e-126
ref|XM_001627986.1|  Nematostella vectensis predicted protein (NE...   459    9e-126
gb|DQ450531.1|  Bodo saltans alpha tubulin and beta tubulin genes...   459    9e-126
gb|AF064849.1|  Homo sapiens map 4q35 repeat region, complete seq...   459    9e-126
ref|NM_001003900.1|  Bos taurus tubulin, beta 2A class IIa (TUBB2...   459    9e-126
emb|X15389.1|  Paracentrotus lividus mRNA for beta-tubulin             459    9e-126
gb|JF410995.1|  Pristigloma alba beta tubulin (BTUB) gene, partia...   455    1e-124
ref|XM_003224397.1|  PREDICTED: Anolis carolinensis tubulin beta-...   455    1e-124
gb|HM245045.1|  Alveolata sp. CCMP3155 tubulin beta chain mRNA, p...   455    1e-124
gb|FJ973416.1|  Ankylochrysis lutea strain RCC 286 beta-tubulin (...   455    1e-124
gb|EF432455.1|  Rhodomonas salina clone D1 beta tubulin (btub) mR...   455    1e-124
gb|EU080326.1|  Phytophthora pistaciae isolate PD_01119(P6197) be...   455    1e-124
gb|EU079521.1|  Phytophthora sp. P10335 beta-tubulin gene, partia...   455    1e-124
dbj|AB194979.1|  Chrysochromulina sp. TKB79 btub gene for putativ...   455    1e-124
dbj|AK109162.1|  Oryza sativa Japonica Group cDNA clone:002-155-G...   455    1e-124
gb|AF255554.1|AF255554  Notothenia coriiceps isolate ncb3 beta tu...   455    1e-124
ref|XM_003583930.1|  PREDICTED: Bos taurus tubulin, beta 2A class...   453    4e-124
ref|XM_002702957.2|  PREDICTED: Bos taurus tubulin, beta 2A class...   453    4e-124
ref|XM_002697606.1|  PREDICTED: Bos taurus tubulin, beta 2-like (...   453    4e-124
gb|FJ168548.1|  Bodo saltans clone fosmid 14L17, complete sequence     453    4e-124
gb|EU080108.1|  Phytophthora quininea isolate PD_00172(P3608) bet...   453    4e-124
gb|EU079803.1|  Phytophthora quininea isolate PD_00126(P3247) bet...   453    4e-124
gb|U83110.1|HUMTUB4Q02  Human beta-tubulin (TUB4q) mRNA, complete...   453    4e-124
gb|JF410962.1|  Malletia johnsoni beta tubulin (BTUB) gene, parti...   452    1e-123
ref|XM_003281396.1|  PREDICTED: Nomascus leucogenys tubulin beta-...   452    1e-123
dbj|AB491657.1|  Monomastix minuta Btub gene for beta-tubulin, pa...   452    1e-123
gb|GQ377698.1|  Bodo saltans beta-tubulin (Btub) mRNA, partial cds     452    1e-123
gb|EU080565.1|  Phytophthora sp. P10690 beta-tubulin gene, partia...   452    1e-123
gb|DQ980520.1|  Chrysochromulina sp. NIES-1333 beta tubulin gene,...   452    1e-123
ref|XM_003468811.1|  PREDICTED: Cavia porcellus tubulin beta-2B c...   450    5e-123
ref|XM_003460999.1|  PREDICTED: Cavia porcellus tubulin beta-5 ch...   450    5e-123
dbj|AB491622.1|  Nephroselmis olivacea Btub gene for beta-tubulin...   450    5e-123
ref|XR_013991.2|  PREDICTED: Macaca mulatta tubulin beta-8 chain-...   450    5e-123
ref|NM_146116.2|  Mus musculus tubulin, beta 4B class IVB (Tubb4b...   450    5e-123
ref|XM_002468643.1|  Sorghum bicolor hypothetical protein, mRNA        450    5e-123
gb|BT074608.1|  Osmerus mordax clone omor-rgc-519-157 Tubulin bet...   450    5e-123
gb|EU962712.1|  Zea mays clone 244919 mRNA sequence                    450    5e-123
ref|XM_001953398.1|  Drosophila ananassae GF17765 (Dana\GF17765),...   450    5e-123
ref|XM_001906036.1|  Podospora anserina S mat+ hypothetical prote...   450    5e-123
gb|EU199088.1|  Phytophthora sp. Asparagus 117 beta-tubulin gene,...   450    5e-123
gb|EU080645.1|  Phytophthora sp. P10705 beta-tubulin gene, partia...   450    5e-123
gb|EU079860.1|  Phytophthora ilicis isolate PD_00133(P3939) beta-...   450    5e-123
gb|EU079797.1|  Phytophthora cinnamomi isolate PD_00125(P3232) be...   450    5e-123
gb|DQ980512.1|  Apusomonas proboscidea clone aptub2 beta tubulin ...   450    5e-123
ref|XR_026162.1|  PREDICTED: Strongylocentrotus purpuratus hypoth...   450    5e-123
gb|AY705362.1|  Drosophila willistoni testis beta tubulin mRNA, p...   450    5e-123
gb|AY705350.1|  Drosophila bifurca testis beta tubulin mRNA, part...   450    5e-123
dbj|AK167022.1|  Mus musculus blastocyst blastocyst cDNA, RIKEN f...   450    5e-123
dbj|AK146587.1|  Mus musculus cDNA, RIKEN full-length enriched li...   450    5e-123
emb|CR697998.2|  Tetraodon nigroviridis full-length cDNA               450    5e-123
dbj|AK076895.1|  Mus musculus adult male testis cDNA, RIKEN full-...   450    5e-123
gb|BC083319.1|  Mus musculus tubulin, beta 2C, mRNA (cDNA clone M...   450    5e-123
gb|BC022919.1|  Mus musculus tubulin, beta 2C, mRNA (cDNA clone M...   450    5e-123
gb|BC005547.1|  Mus musculus tubulin, beta 2C, mRNA (cDNA clone M...   450    5e-123
gb|AF184596.1|AF184596  Gadus morhua beta-2 tubulin mRNA, complet...   450    5e-123
gb|GU370174.1|  Grosmannia aurea voucher M002-06-01-08-UL05DL39 b...   448    2e-122
gb|EU080137.1|  Phytophthora ilicis isolate PD_00178(P6860) beta-...   448    2e-122
gb|EU079570.1|  Phytophthora sp. P10456 beta-tubulin gene, partia...   448    2e-122
gb|AY263190.1|  Ophiostoma robustum strain CMW668 beta-tubulin ge...   448    2e-122
gb|AY263187.1|  Ophiostoma aureum strain ATCC 16936 beta-tubulin ...   448    2e-122
gb|AY263186.1|  Ophiostoma aureum strain AU98Pr2-141 beta-tubulin...   448    2e-122
ref|XM_003488536.1|  PREDICTED: Bombus impatiens tubulin beta-1 c...   446    6e-122
ref|XM_532060.3|  PREDICTED: Canis lupus familiaris tubulin, beta...   446    6e-122
ref|XM_001914774.2|  PREDICTED: Equus caballus tubulin beta-2B ch...   446    6e-122
ref|XR_131544.1|  PREDICTED: Equus caballus tubulin beta-2A chain...   446    6e-122
gb|GU191332.1|  Phytophthora mengei strain P0513 beta tubulin-lik...   446    6e-122
gb|EU977464.1|  Ambrosiella ips strain CBS435.34 beta-tubulin gen...   446    6e-122
ref|XM_001842025.1|  Culex quinquefasciatus tubulin beta-4 chain,...   446    6e-122
gb|BC153756.1|  Xenopus laevis hypothetical protein LOC100037222,...   446    6e-122
gb|EU080427.1|  Phytophthora pseudotsugae isolate PD_00029(P10339...   446    6e-122
gb|EU080292.1|  Phytophthora cactorum isolate PD_00944(P11184) be...   446    6e-122
gb|EU080095.1|  Phytophthora sp. P1825 beta-tubulin gene, partial...   446    6e-122
gb|EU079989.1|  Phytophthora pseudotsugae isolate PD_00151(P10218...   446    6e-122
gb|EU079894.1|  Phytophthora cinnamomi isolate PD_00138(P6305) be...   446    6e-122
gb|EU079770.1|  Phytophthora cinnamomi isolate PD_00121(P2428) be...   446    6e-122
gb|EU079757.1|  Phytophthora cinnamomi isolate PD_00120(P2159) be...   446    6e-122
gb|BC129762.1|  Xenopus laevis hypothetical protein LOC100037222,...   446    6e-122
gb|DQ980514.1|  Chrysochromulina sp. NIES-1333 beta tubulin mRNA,...   446    6e-122
dbj|AK015901.1|  Mus musculus adult male testis cDNA, RIKEN full-...   446    6e-122
ref|XM_003468795.1|  PREDICTED: Cavia porcellus tubulin beta-2A c...   444    2e-121
ref|XR_096334.1|  PREDICTED: Pongo abelii tubulin beta-8 chain-li...   444    2e-121
ref|XR_014035.2|  PREDICTED: Macaca mulatta tubulin beta-8 chain-...   444    2e-121
gb|EU080877.1|  Phytophthora hedraiandra isolate PD_01303(PDA331)...   444    2e-121
gb|EU080460.1|  Phytophthora cambivora isolate PD_00003(P1431) be...   444    2e-121
gb|EU080285.1|  Phytophthora cactorum isolate PD_00930(P0715) bet...   444    2e-121
gb|EU080023.1|  Phytophthora pseudosyringae isolate PD_00159(P104...   444    2e-121
gb|AY544621.1|  Leptographium pyrinum strain CMW3889 beta-tubulin...   444    2e-121
gb|AY263189.1|  Ophiostoma robustum strain CMW2805 beta-tubulin g...   444    2e-121
gb|AY263188.1|  Ophiostoma aureum strain AU98Pr2-169 beta-tubulin...   444    2e-121
gb|AY263185.1|  Leptographium pyrinum strain AUPr2-141 beta-tubul...   444    2e-121
ref|NM_001034697.1|  Bos taurus tubulin, beta 4A class IVa (TUBB4...   444    2e-121
gb|AY816712.1|  Leptographium longiclavatum strain SL-Kp11 beta-t...   444    2e-121
gb|AY288939.1|  Leptographium longiclavatum strain SL-Ww407 beta-...   444    2e-121
gb|AY288938.1|  Leptographium longiclavatum strain SL-Ww405 beta-...   444    2e-121
gb|AY288937.1|  Leptographium longiclavatum strain SL-Wg403 beta-...   444    2e-121
gb|AY288936.1|  Leptographium longiclavatum strain SL-W001 beta-t...   444    2e-121
gb|AY288935.1|  Leptographium longiclavatum strain SL-Pw5 beta-tu...   444    2e-121
gb|AY288934.1|  Leptographium longiclavatum strain SL-Kw1436 beta...   444    2e-121
gb|AY288933.1|  Leptographium longiclavatum strain SL-Kw442 beta-...   444    2e-121
gb|AY288932.1|  Leptographium longiclavatum strain SL-Kw439 beta-...   444    2e-121
gb|AY288931.1|  Leptographium longiclavatum strain SL-K215 beta-t...   444    2e-121
gb|EU080558.1|  Phytophthora syringae isolate PD_00044(P10330) be...   443    7e-121
gb|EU080066.1|  Phytophthora multivesiculata isolate PD_00001(P10...   443    7e-121
gb|EU079925.1|  Phytophthora katsurae isolate PD_00142(P6704) bet...   443    7e-121
gb|EU079874.1|  Phytophthora meadii isolate PD_00135(P6128) beta-...   443    7e-121
gb|EU079582.1|  Phytophthora citricola isolate PD_00096(P10458) b...   443    7e-121
gb|EU079514.1|  Phytophthora hibernalis isolate PD_00010(P3822) b...   443    7e-121
gb|DQ980529.1|  Thaumatomonas sp. TMT002 beta tubulin gene, parti...   443    7e-121
gb|DQ980519.1|  Chrysochromulina sp. NIES-1333 beta tubulin gene,...   443    7e-121
ref|XM_003473087.1|  PREDICTED: Cavia porcellus tubulin, beta 2C ...   441    2e-120
ref|XM_003395132.1|  PREDICTED: Bombus terrestris tubulin beta-1 ...   441    2e-120
dbj|AB600301.1|  Ergobibamus cyprinoides gene for beta-tubulin, p...   441    2e-120
ref|XM_394471.2|  PREDICTED: Apis mellifera tubulin beta-1 chain-...   441    2e-120
gb|GU191331.1|  Phytophthora mengei strain P1165 beta tubulin (Bt...   441    2e-120
ref|XM_002956312.1|  Volvox carteri f. nagariensis beta tubulin (...   441    2e-120
ref|XM_001101550.2|  PREDICTED: Macaca mulatta tubulin beta-8 cha...   441    2e-120
ref|XR_014813.2|  PREDICTED: Macaca mulatta tubulin beta-8 chain-...   441    2e-120
ref|XM_002405202.1|  Ixodes scapularis beta tubulin, putative, mRNA    441    2e-120
gb|EF432449.1|  Heterocapsa illdefina clone A2 beta tubulin (btub...   441    2e-120
ref|XM_002098686.1|  Drosophila yakuba GE10520 (Dyak\GE10520), mRNA    441    2e-120
gb|EU080803.1|  Phytophthora katsurae isolate PD_00074(P10187) be...   441    2e-120
gb|EU080710.1|  Phytophthora hibernalis isolate PD_00062(P0647) b...   441    2e-120
gb|EU080517.1|  Phytophthora psychrophila isolate PD_00039(P10433...   441    2e-120
gb|EU080278.1|  Phytophthora cactorum isolate PD_00929(P0714) bet...   441    2e-120
gb|EU080130.1|  Phytophthora idaei isolate PD_00177(P6767) beta-t...   441    2e-120
gb|EU080073.1|  Phytophthora hedraiandra isolate PD_00166(P11056)...   441    2e-120
gb|EU079929.1|  Phytophthora hibernalis isolate PD_00143(P6871) b...   441    2e-120
gb|EU079764.1|  Phytophthora syringae isolate PD_00013(P10332) be...   441    2e-120
gb|EU079706.1|  Phytophthora foliorum isolate PD_00113(P10972) be...   441    2e-120
gb|EU079700.1|  Phytophthora foliorum isolate PD_00112(P10971) be...   441    2e-120
gb|EU079687.1|  Phytophthora foliorum isolate PD_00111(P10970) be...   441    2e-120
gb|EU079680.1|  Phytophthora foliorum isolate PD_00110(P10969) be...   441    2e-120
gb|EU079666.1|  Phytophthora captiosa isolate PD_00108(P10721) be...   441    2e-120
gb|EU079588.1|  Phytophthora multivesiculata isolate PD_00097(P10...   441    2e-120
gb|EU079551.1|  Phytophthora psychrophila isolate PD_00092(P10434...   441    2e-120
gb|EU079500.1|  Phytophthora multivesiculata isolate PD_00085(P10...   441    2e-120
emb|AM237831.1|  Telonema antarcticum partial tubb gene for beta-...   441    2e-120
gb|DQ323161.1|  Thraustochytriidae sp. #32 beta tubulin gene, par...   441    2e-120
gb|DQ323159.1|  Schizochytrium aggregatum beta tubulin gene, part...   441    2e-120
ref|NM_001099690.1|  Taeniopygia guttata tubulin, beta 4B class I...   441    2e-120
ref|NM_001245310.1|  Taeniopygia guttata tubulin beta 2-like (LOC...   441    2e-120
emb|AJ249551.1|  Meriones unguiculatus partial mRNA for beta-tubu...   441    2e-120
gb|AY729822.1|  Phytophthora palmivora beta-tubulin gene, partial...   441    2e-120
dbj|AB011679.1|  Rattus norvegicus mRNA for class I beta-tubulin,...   441    2e-120
gb|HQ389122.1|  Phytophthora capsici haplotype 15 beta-tubulin (B...   439    9e-120
gb|HQ725303.1|  Phytophthora capsici isolate Pc6-2 beta-tubulin g...   439    9e-120
gb|HQ725302.1|  Phytophthora capsici isolate Pc6-1 beta-tubulin g...   439    9e-120
gb|HQ725301.1|  Phytophthora capsici isolate Pc5-2 beta-tubulin g...   439    9e-120
gb|HQ725300.1|  Phytophthora capsici isolate Pc5-1 beta-tubulin g...   439    9e-120
gb|GU370178.1|  Grosmannia clavigera voucher M001-01-03-03-UC14G1...   439    9e-120
gb|GU370175.1|  Grosmannia clavigera voucher M002-16-01-04-UC27G2...   439    9e-120
gb|GU370173.1|  Grosmannia clavigera voucher M002-09-04-07-UC30DL...   439    9e-120
gb|EU977470.1|  Dryadomyces amasae strain CBS116694 beta-tubulin ...   439    9e-120
gb|EU080895.1|  Phytophthora sp. SY1982 beta-tubulin gene, partia...   439    9e-120
gb|EU080697.1|  Phytophthora heveae isolate PD_00060(P0578) beta-...   439    9e-120
gb|EU080586.1|  Phytophthora ramorum isolate PD_00048(P10467) bet...   439    9e-120
gb|AY544624.1|  Ophiostoma clavigerum strain AUPr3-18 beta-tubuli...   439    9e-120
gb|AY267828.1|  Ophiostoma clavigerum strain LPKRGC-1 beta tubuli...   439    9e-120
gb|AY263210.1|  Ophiostoma clavigerum strain SL-K1 beta-tubulin g...   439    9e-120
gb|AY263209.1|  Ophiostoma clavigerum strain SL-Kw1414 beta-tubul...   439    9e-120
gb|AY263208.1|  Ophiostoma clavigerum strain SL-H400 beta-tubulin...   439    9e-120
gb|AY263207.1|  Ophiostoma clavigerum strain UAMH 4818 beta-tubul...   439    9e-120
gb|AY263206.1|  Ophiostoma clavigerum strain UAMH 4585 beta-tubul...   439    9e-120
gb|AY263205.1|  Ophiostoma clavigerum strain SL-Wg602 beta-tubuli...   439    9e-120
gb|AY263204.1|  Ophiostoma clavigerum strain SL-Wg004 beta-tubuli...   439    9e-120
gb|AY263203.1|  Ophiostoma clavigerum strain SL-St.J1 beta-tubuli...   439    9e-120
gb|AY263202.1|  Ophiostoma clavigerum strain SL-Kg4 beta-tubulin ...   439    9e-120
gb|AY263200.1|  Ophiostoma clavigerum strain SL-Kg602 beta-tubuli...   439    9e-120
gb|AY263199.1|  Ophiostoma clavigerum strain SL-K58 beta-tubulin ...   439    9e-120
gb|AY263198.1|  Ophiostoma clavigerum strain SL-K402 beta-tubulin...   439    9e-120
gb|AY263197.1|  Ophiostoma clavigerum strain SL-Hg100 beta-tubuli...   439    9e-120
gb|AY263195.1|  Ophiostoma clavigerum strain SL-Kw1407 beta-tubul...   439    9e-120
gb|AY263194.1|  Ophiostoma clavigerum strain ATCC 18086 beta-tubu...   439    9e-120
gb|AY263193.1|  Ophiostoma clavigerum strain SL-Kp54 beta-tubulin...   439    9e-120
gb|AY944841.1|  Blastocladiella britannica strain FSU2500 clone 1...   439    9e-120
gb|AY672912.1|  Ophiostoma clavigerum strain S4GAW1 beta-tubulin ...   439    9e-120
gb|DQ206490.1|  Platynereis dumerilii isolate TOA65 beta-tubulin ...   439    9e-120
gb|AY816713.1|  Leptographium longiclavatum strain C187 beta-tubu...   439    9e-120
ref|XM_003513195.1|  PREDICTED: Cricetulus griseus tubulin beta-2...   437    3e-119
ref|XM_003450595.1|  PREDICTED: Oreochromis niloticus tubulin bet...   437    3e-119
ref|XM_003298541.1|  Pyrenophora teres f. teres 0-1 hypothetical ...   437    3e-119
gb|EU977488.1|  Ophiostoma stenoceras strain C80 beta-tubulin gen...   437    3e-119
emb|FP097015.1|  Phyllostachys edulis cDNA clone: bphylf031a05, f...   437    3e-119
ref|XM_001931145.1|  Pyrenophora tritici-repentis Pt-1C-BFP tubul...   437    3e-119
gb|EU373305.1|  Monochamus alternatus beta1-tubulin (TubB) mRNA, ...   437    3e-119
gb|EU080730.1|  Phytophthora ramorum isolate PD_00064(P10102) bet...   437    3e-119
gb|EU080724.1|  Phytophthora sp. P10080 beta-tubulin gene, partia...   437    3e-119
gb|EU080479.1|  Phytophthora alni isolate PD_00034(P10566) beta-t...   437    3e-119
gb|EU080454.1|  Phytophthora cinnamomi isolate PD_00394(P7154) be...   437    3e-119
gb|EU080385.1|  Phytophthora inflata isolate PD_00024(P10341) bet...   437    3e-119
gb|EU080236.1|  Phytophthora citricola isolate PD_00019(P7902) be...   437    3e-119
gb|EU080125.1|  Phytophthora colocasiae isolate PD_00176(P6290) b...   437    3e-119
gb|EU079949.1|  Phytophthora cinnamomi isolate PD_00188(P8495) be...   437    3e-119
gb|EU079815.1|  Phytophthora katsurae isolate PD_00128(P3389) bet...   437    3e-119
gb|EU079600.1|  Phytophthora nemorosa isolate PD_00099(P10612) be...   437    3e-119
gb|EU079576.1|  Phytophthora sp. P10457 beta-tubulin gene, partia...   437    3e-119
gb|EU079475.1|  Phytophthora nemorosa isolate PD_00081(P10288) be...   437    3e-119
ref|XM_001602310.1|  PREDICTED: Nasonia vitripennis tubulin beta-...   437    3e-119
gb|BC121707.1|  Xenopus tropicalis tubulin, beta 2C, mRNA (cDNA c...   437    3e-119
gb|AY744564.1|  Ophiostoma galeiforme strain CMW4447 beta-tubulin...   437    3e-119
gb|AY744563.1|  Ophiostoma galeiforme strain CMW5290 beta-tubulin...   437    3e-119
dbj|AK116810.1|  Ciona intestinalis cDNA, clone:cieg057m19, full ...   437    3e-119
dbj|AK115760.1|  Ciona intestinalis cDNA, clone:cixxx00007, full ...   437    3e-119
dbj|AK113170.1|  Ciona intestinalis cDNA, clone:ciad012c12, full ...   437    3e-119
dbj|AK112550.1|  Ciona intestinalis cDNA, clone:cicl048m06, full ...   437    3e-119
ref|XM_003563349.1|  PREDICTED: Brachypodium distachyon tubulin b...   435    1e-118
dbj|AB600311.1|  Kipferlia bialata gene for beta-tubulin, partial...   435    1e-118
gb|GU370186.1|  Leptographium terebrantis voucher M001-06-01-03-U...   435    1e-118
gb|GU370183.1|  Leptographium terebrantis voucher M001-03-03-05-U...   435    1e-118
gb|FJ665261.1|  Phytophthora multivora strain WAC13200 beta-tubul...   435    1e-118
gb|FJ665260.1|  Phytophthora multivora strain CBS 124094 beta-tub...   435    1e-118
gb|FJ665259.1|  Phytophthora multivora strain WAC13204 beta-tubul...   435    1e-118
gb|FJ665258.1|  Phytophthora multivora strain VHS16439 beta-tubul...   435    1e-118
gb|FJ665257.1|  Phytophthora multivora strain VHS16168 beta-tubul...   435    1e-118
ref|XM_001990044.1|  Drosophila grimshawi GH19142 (Dgri\GH19142),...   435    1e-118
ref|XM_964900.2|  PREDICTED: Tribolium castaneum similar to tubul...   435    1e-118
emb|CU691670.1|  Synthetic construct Homo sapiens gateway clone I...   435    1e-118
gb|EU080859.1|  Phytophthora tropicalis isolate PD_01307(PDA1075)...   435    1e-118
gb|EU079619.1|  Phytophthora capsici isolate PD_00011(P10735) bet...   435    1e-118
gb|EU079563.1|  Phytophthora pseudosyringae isolate PD_00093(P104...   435    1e-118
ref|NM_001062081.1|  Oryza sativa Japonica Group Os05g0413200 (Os...   435    1e-118
gb|DQ118421.1|  Leptographium terebrantis strain SL-A57 beta-tubu...   435    1e-118
gb|AY348310.1|  Leptographium abieticolens strain CMW 2865 beta t...   435    1e-118
gb|AY544625.1|  Ophiostoma huntii strain UAMH4825 beta-tubulin ge...   435    1e-118
gb|AY544623.1|  Leptographium terebrantis strain AU156-12-13 beta...   435    1e-118
gb|AY544622.1|  Leptographium terebrantis strain AU98Pr2-155 beta...   435    1e-118
gb|AY707191.1|  Leptographium wingfieldii CMW2096 beta-tubulin ge...   435    1e-118
gb|AY707190.1|  Leptographium wingfieldii CMW2095 beta-tubulin ge...   435    1e-118
gb|AY707188.1|  Ophiostoma serpens CMW60 beta-tubulin gene, parti...   435    1e-118
gb|AY707189.1|  Ophiostoma serpens CMW2844 beta-tubulin gene, par...   435    1e-118
gb|AY267826.1|  Leptographium terebrantis strain LPWYLT-1 beta tu...   435    1e-118
gb|AY263201.1|  Ophiostoma clavigerum strain SL-St.J11 beta-tubul...   435    1e-118
gb|AY263196.1|  Ophiostoma clavigerum strain C843 beta-tubulin ge...   435    1e-118
gb|AY263192.1|  Leptographium terebrantis strain UAMH 9722 beta-t...   435    1e-118
gb|AY263191.1|  Leptographium terebrantis strain C418 beta-tubuli...   435    1e-118
gb|AY672911.1|  Leptographium terebrantis strain MY23AW3 beta-tub...   435    1e-118
dbj|AK122099.1|  Oryza sativa Japonica Group cDNA clone:J033125G1...   435    1e-118
dbj|AB104732.1|  Oryza sativa Japonica Group OsTUB6 mRNA for beta...   435    1e-118
ref|NM_001244098.1|  Cricetulus griseus tubulin, beta 4B class IV...   435    1e-118
gb|AY131271.2|  Blastocladiella britannica strain FSU2500=CBS143....   435    1e-118
dbj|AB022888.1|  Cynops pyrrhogaster mRNA for beta-tubulin, parti...   435    1e-118
gb|HQ389125.1|  Phytophthora capsici haplotype 28 beta-tubulin (B...   434    4e-118
gb|HQ389123.1|  Phytophthora capsici haplotype 27 beta-tubulin (B...   434    4e-118
gb|HQ389121.1|  Phytophthora capsici haplotype 14 beta-tubulin (B...   434    4e-118
gb|HQ389116.1|  Phytophthora capsici haplotype 13 beta-tubulin (B...   434    4e-118
gb|HQ725180.1|  Phytophthora capsici isolate Pc50-1 beta-tubulin ...   434    4e-118
gb|HQ725119.1|  Phytophthora capsici isolate Pc19-2 beta-tubulin ...   434    4e-118
gb|EU080852.1|  Phytophthora capsici isolate PD_00009(P0253) beta...   434    4e-118
gb|EU080736.1|  Phytophthora ramorum isolate PD_00065(P10103) bet...   434    4e-118
gb|EU080551.1|  Phytophthora cambivora isolate PD_00043(P0592) be...   434    4e-118
gb|EU080196.1|  Phytophthora sp. P8618 beta-tubulin gene, partial...   434    4e-118
gb|EU079532.1|  Phytophthora ramorum isolate PD_00089(P10343) bet...   434    4e-118
gb|AY744560.1|  Ophiostoma radiaticola strain UAMH9691 beta-tubul...   434    4e-118
ref|XM_001491178.3|  PREDICTED: Equus caballus tubulin, beta 2A, ...   432    1e-117
ref|XM_002928866.1|  PREDICTED: Ailuropoda melanoleuca tubulin be...   432    1e-117
ref|XM_002927774.1|  PREDICTED: Ailuropoda melanoleuca tubulin be...   432    1e-117
emb|FQ213253.1|  Rattus norvegicus TL0AAA48YN19 mRNA sequence          432    1e-117
ref|XR_010378.2|  PREDICTED: Macaca mulatta tubulin beta-8 chain-...   432    1e-117
ref|NM_173102.2|  Rattus norvegicus tubulin, beta 5 class I (Tubb...   432    1e-117
gb|BT058720.1|  Salmo salar clone ssal-rgf-001-050 Tubulin beta-1...   432    1e-117
gb|BT057944.1|  Salmo salar clone ssal-rgf-509-140 Tubulin beta-2...   432    1e-117
gb|BT056899.1|  Salmo salar clone ssal-eve-507-163 Tubulin beta-2...   432    1e-117
dbj|AB464325.1|  Synthetic construct DNA, clone: pF1KB7231, Homo ...   432    1e-117
gb|BC168216.1|  Rattus norvegicus tubulin, beta 4, mRNA (cDNA clo...   432    1e-117
ref|NM_080882.1|  Rattus norvegicus tubulin, beta 4A class IVa (T...   432    1e-117
gb|EU080891.1|  Phytophthora sp. PDA984 beta-tubulin gene, partia...   432    1e-117
gb|EU080869.1|  Phytophthora cambivora isolate PD_01309(PDA2118) ...   432    1e-117
gb|EU080796.1|  Phytophthora heveae isolate PD_00073(P10167) beta...   432    1e-117
gb|EU080742.1|  Phytophthora bisheria isolate PD_00066(P10117) be...   432    1e-117
gb|EU080379.1|  Phytophthora megasperma isolate PD_00023(P10340) ...   432    1e-117


>gb|FJ633349.1| Synthetic construct Drosophila melanogaster clone BO15123 encodes 
betaTub56D-RB
Length=1375

 Score =  874 bits (968),  Expect = 0.0
 Identities = 484/484 (100%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  74   TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  133

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  134  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  193

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  194  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  253

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  254  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  313

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  373

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  374  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  433

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  493

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  494  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  553

Query  481  GTGG  484
            ||||
Sbjct  554  GTGG  557


>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence
Length=21146708

 Score =  874 bits (968),  Expect = 0.0
 Identities = 484/484 (100%), Gaps = 0/484 (0%)
 Strand=Plus/Minus

Query  1         TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15336251  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  15336192

Query  61        AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15336191  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  15336132

Query  121       GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15336131  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  15336072

Query  181       CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15336071  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  15336012

Query  241       AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15336011  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  15335952

Query  301       GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15335951  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  15335892

Query  361       GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15335891  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  15335832

Query  421       CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15335831  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  15335772

Query  481       GTGG  484
                 ||||
Sbjct  15335771  GTGG  15335768


 Score =  233 bits (258),  Expect = 7e-58
 Identities = 191/232 (83%), Gaps = 0/232 (0%)
 Strand=Plus/Plus

Query  104       CGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGG  163
                 |||| |||||||||||||||||| | ||  ||||  |||||||||||||||| |||||||
Sbjct  20198428  CGTCGGGTGGCAAGTACGTGCCCAGGGCCATCCTGCTCGATCTGGAGCCCGGAACCATGG  20198487

Query  164       ACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCC  223
                 | || ||||| || || || | ||| ||  ||||| |||| |||||||| |||| ||| |
Sbjct  20198488  AGTCGGTGCGTTCCGGTCCGTACGGACAACTCTTCCGGCCGGACAACTTCGTGTACGGAC  20198547

Query  224       AGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGG  283
                 ||||||| || ||||||||||||||||||||||| ||||| ||||| || ||||||||||
Sbjct  20198548  AGTCGGGAGCGGGCAACAACTGGGCCAAGGGTCACTACACCGAGGGCGCCGAGCTGGTGG  20198607

Query  284       ACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCA  335
                 ||   || || || || ||||||||||||  |||   |||||||||||||||
Sbjct  20198608  ACAATGTCCTGGACGTGGTCCGCAAGGAGTGCGAGAACTGCGACTGCCTGCA  20198659


 Score =  196 bits (216),  Expect = 2e-46
 Identities = 132/148 (90%), Gaps = 0/148 (0%)
 Strand=Plus/Plus

Query  337       GGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTG  396
                 ||||||||| | || ||||| || |||||||||||||| ||||| ||||| |||||||||
Sbjct  20198717  GGCTTCCAATTGACGCACTCGCTGGGCGGCGGCACTGGGTCCGGAATGGGCACCCTGCTG  20198776

Query  397       ATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCG  456
                 || || |||||||||||||||||||||||| | ||||||||||| |||||||| ||||| 
Sbjct  20198777  ATCTCGAAGATCCGCGAGGAGTACCCCGACCGCATCATGAACACCTACTCGGTGGTGCCA  20198836

Query  457       TCGCCCAAGGTGTCGGACACCGTTGTGG  484
                 ||||||||||||||||||||||| ||||
Sbjct  20198837  TCGCCCAAGGTGTCGGACACCGTGGTGG  20198864


 Score = 96.9 bits (106),  Expect = 1e-16
 Identities = 88/111 (80%), Gaps = 0/111 (0%)
 Strand=Plus/Plus

Query  1         TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
                 |||||||||||||| ||||| ||||| ||||||||   ||  |||  ||||   || |||
Sbjct  20198245  TTCTGGGAGATCATTTCCGAGGAGCACGGCATCGACAGCAATGGCATCTACGTGGGCGAC  20198304

Query  61        AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGT  111
                 || || ||||||||||||||| ||| ||| |||||||| || || || |||
Sbjct  20198305  AGTGATCTGCAGCTGGAGCGCGTCAGTGTCTACTACAACGAAGCATCGGGT  20198355


>ref|NM_166356.1| Drosophila melanogaster beta-Tubulin at 56D (betaTub56D), transcript 
variant A, mRNA
Length=1673

 Score =  874 bits (968),  Expect = 0.0
 Identities = 484/484 (100%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  246  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  305

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  306  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  365

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  366  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  425

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  485

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  486  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  545

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  546  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  605

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  606  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  665

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  666  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  725

Query  481  GTGG  484
            ||||
Sbjct  726  GTGG  729


>ref|NM_079071.2| Drosophila melanogaster beta-Tubulin at 56D (betaTub56D), transcript 
variant B, mRNA
Length=1613

 Score =  874 bits (968),  Expect = 0.0
 Identities = 484/484 (100%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  186  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  245

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  246  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  305

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  306  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  365

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  366  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  425

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  485

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  486  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  545

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  546  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  605

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  606  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  665

Query  481  GTGG  484
            ||||
Sbjct  666  GTGG  669


>gb|AC099013.1| Drosophila melanogaster, chromosome 2R, region 56D-56E, BAC clone 
BACR25K02, complete sequence
Length=173347

 Score =  874 bits (968),  Expect = 0.0
 Identities = 484/484 (100%), Gaps = 0/484 (0%)
 Strand=Plus/Minus

Query  1      TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73870  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  73811

Query  61     AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73810  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  73751

Query  121    GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73750  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  73691

Query  181    CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73690  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  73631

Query  241    AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73630  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  73571

Query  301    GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73570  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  73511

Query  361    GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73510  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  73451

Query  421    CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  73450  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  73391

Query  481    GTGG  484
              ||||
Sbjct  73390  GTGG  73387


>gb|BT003242.1| Drosophila melanogaster LD43681 full insert cDNA
Length=1632

 Score =  874 bits (968),  Expect = 0.0
 Identities = 484/484 (100%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  186  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  245

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  246  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  305

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  306  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  365

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  366  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  425

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  485

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  486  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  545

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  546  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  605

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  606  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  665

Query  481  GTGG  484
            ||||
Sbjct  666  GTGG  669


>gb|AC004299.1|AC004299 Drosophila melanogaster DNA sequence (P1 DS07982 (D185)), complete 
sequence
Length=87585

 Score =  874 bits (968),  Expect = 0.0
 Identities = 484/484 (100%), Gaps = 0/484 (0%)
 Strand=Plus/Minus

Query  1      TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64485  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  64426

Query  61     AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64425  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  64366

Query  121    GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64365  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  64306

Query  181    CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64305  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  64246

Query  241    AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64245  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  64186

Query  301    GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64185  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  64126

Query  361    GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64125  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  64066

Query  421    CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64065  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  64006

Query  481    GTGG  484
              ||||
Sbjct  64005  GTGG  64002


>gb|BT125650.1| Drosophila melanogaster GH12877 full insert cDNA
Length=1687

 Score =  868 bits (962),  Expect = 0.0
 Identities = 483/484 (99%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  246  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  305

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  306  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  365

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  366  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  425

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  485

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  486  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  545

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  546  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  605

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  606  GACGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  665

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  666  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  725

Query  481  GTGG  484
            ||||
Sbjct  726  GTGG  729


>ref|XM_002082197.1| Drosophila simulans GD25319 (Dsim\GD25319), mRNA
Length=1344

 Score =  868 bits (962),  Expect = 0.0
 Identities = 483/484 (99%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  58   TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  118  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct  178  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCCGTGCGATCGGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  238  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  358  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  418  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  478  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002034556.1| Drosophila sechellia GM19828 (Dsec\GM19828), mRNA
Length=1344

 Score =  865 bits (958),  Expect = 0.0
 Identities = 482/484 (99%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  58   TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  118  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct  178  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCCGTGCGATCGGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  238  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  358  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  418  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct  478  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTTTCGGACACCGTT  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002091745.1| Drosophila yakuba betaTub56D (Dyak\betaTub56D), mRNA
Length=1344

 Score =  850 bits (942),  Expect = 0.0
 Identities = 479/484 (99%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct  58   TTCTGGGAGATCATCTCCGATGAGCACGGCATCGATGCCACCGGCGCCTACCACGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  118  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct  178  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCCGTGCGATCGGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct  238  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGTCAGTCGGGTGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGCGCTGAGCTGGTGGACTCAGTGCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  358  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  418  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct  478  CCCGACAGGATCATGAACACATACTCGGTGGTGCCGTCGCCCAAGGTGTCGGACACCGTT  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_001974777.1| Drosophila erecta GG20906 (Dere\GG20906), mRNA
Length=1428

 Score =  847 bits (938),  Expect = 0.0
 Identities = 478/484 (99%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  142  TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  201

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  202  AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  261

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct  262  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCCGTGCGATCGGGA  321

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  322  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  381

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||| |||||  |||||||||||||||||||||||
Sbjct  382  AACTGGGCCAAGGGTCATTACACAGAGGGCGCTGAATTGGTGGACTCAGTGCTCGATGTT  441

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  442  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  501

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  502  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  561

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct  562  CCTGACAGGATCATGAACACATACTCGGTGGTGCCGTCGCCCAAGGTGTCGGACACCGTT  621

Query  481  GTGG  484
            ||||
Sbjct  622  GTGG  625


>gb|M20419.1|DROTUBB1A D.melanogaster beta-1 tubulin mRNA, complete cds
Length=1344

 Score =  841 bits (932),  Expect = 0.0
 Identities = 479/485 (99%), Gaps = 2/485 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||
Sbjct  58   TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGAACCTACCACGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct  118  AGCGACCTGCAGCTGGAGCGCATCAATGTCTACTACAATGAGGCGTCCGGTGGCAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  178  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  238  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  358  GTCCGCAAAGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  418  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATC-ATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGT  479
            ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  478  CCCGACA-GATCAATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGT  536

Query  480  TGTGG  484
            |||||
Sbjct  537  TGTGG  541


>ref|NM_166355.2| Drosophila melanogaster beta-Tubulin at 56D (betaTub56D), transcript 
variant D, mRNA
Length=1515

 Score =  830 bits (920),  Expect = 0.0
 Identities = 460/460 (100%), Gaps = 0/460 (0%)
 Strand=Plus/Plus

Query  25   CATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATC  84
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  112  CATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATC  171

Query  85   AATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGAT  144
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  172  AATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGAT  231

Query  145  CTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCC  204
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  232  CTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCC  291

Query  205  GACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACA  264
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  292  GACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACA  351

Query  265  GAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGC  324
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  352  GAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGC  411

Query  325  GACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATG  384
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  412  GACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATG  471

Query  385  GGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATAC  444
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  472  GGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATAC  531

Query  445  TCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGTGG  484
            ||||||||||||||||||||||||||||||||||||||||
Sbjct  532  TCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGTGG  571


>ref|XM_002136590.1| Drosophila pseudoobscura pseudoobscura GA27686 (Dpse\GA27686), 
mRNA
Length=1344

 Score =  706 bits (782),  Expect = 0.0
 Identities = 447/484 (93%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || |||||||| || |||||||| ||||||||||| ||||||||||| |||
Sbjct  58   TTCTGGGAAATTATCTCCGACGAACATGGCATTGATGCCACCGGTGCCTACCACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||| |||
Sbjct  118  AGCGACTTGCAGCTGGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGAGGCAAATAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| |||||||||||  ||||||||||||||||||||||||| || || || 
Sbjct  178  GTGCCCCGCGCCGTCCTTGTCGACTTGGAGCCCGGCACCATGGACTCTGTTCGGTCCGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || |||||||||||||||||||||||||||||||||||||| ||||| || |||||||| 
Sbjct  238  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGACAGTCCGGCGCCGGCAAT  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||| || |||||||| || || ||||||||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGCGCCGAGCTGGTCGATTCCGTGCTCGATGTC  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct  358  GTGCGCAAGGAGGCTGAATCCTGCGACTGCCTGCAAGGCTTCCAGCTCACACACTCCCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct  418  GGCGGCGGCACTGGCTCCGGCATGGGTACCCTGCTGATTTCCAAGATCCGCGAGGAATAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct  478  CCCGACAGAATCATGAACACATACTCGGTTGTGCCCTCGCCCAAGGTGTCGGACACCGTT  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002018475.1| Drosophila persimilis GL16725 (Dper\GL16725), mRNA
Length=1344

 Score =  706 bits (782),  Expect = 0.0
 Identities = 447/484 (93%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || |||||||| || |||||||| ||||||||||| ||||||||||| |||
Sbjct  58   TTCTGGGAAATTATCTCCGACGAACATGGCATTGATGCCACCGGTGCCTACCACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||| |||
Sbjct  118  AGCGACTTGCAGCTGGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGAGGCAAATAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| |||||||||||  ||||||||||||||||||||||||| || || || 
Sbjct  178  GTGCCCCGCGCCGTCCTTGTCGACTTGGAGCCCGGCACCATGGACTCTGTTCGGTCCGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || |||||||||||||||||||||||||||||||||||||| ||||| || |||||||| 
Sbjct  238  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGACAGTCCGGCGCCGGCAAT  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||| || |||||||| || || ||||||||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGCGCCGAGCTGGTCGATTCCGTGCTCGATGTC  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct  358  GTGCGCAAGGAGGCTGAATCCTGCGACTGCCTGCAAGGCTTCCAGCTCACACACTCCCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct  418  GGCGGCGGCACTGGCTCCGGCATGGGTACCCTGCTGATTTCCAAGATCCGCGAGGAATAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct  478  CCCGACAGAATCATGAACACATACTCGGTTGTGCCCTCGCCCAAGGTGTCGGACACCGTT  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|NM_166357.1| Drosophila melanogaster beta-Tubulin at 56D (betaTub56D), transcript 
variant C, mRNA
Length=1482

 Score =  691 bits (766),  Expect = 0.0
 Identities = 383/383 (100%), Gaps = 0/383 (0%)
 Strand=Plus/Plus

Query  102  GGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCAT  161
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  156  GGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCAT  215

Query  162  GGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGG  221
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  216  GGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGG  275

Query  222  CCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGT  281
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  276  CCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGT  335

Query  282  GGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTT  341
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  336  GGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTT  395

Query  342  CCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTC  401
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  396  CCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTC  455

Query  402  CAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCC  461
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  456  CAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCC  515

Query  462  CAAGGTGTCGGACACCGTTGTGG  484
            |||||||||||||||||||||||
Sbjct  516  CAAGGTGTCGGACACCGTTGTGG  538


>ref|XM_001958843.1| Drosophila ananassae GF12605 (Dana\GF12605), mRNA
Length=1344

 Score =  688 bits (762),  Expect = 0.0
 Identities = 443/484 (92%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct  58   TTCTGGGAAATCATCTCCGATGAGCACGGCATCGATGCCACCGGTGCCTACCACGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| 
Sbjct  118  AGCGATCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCCTCCGGTGGCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || ||||||||||||||||||||||||||||| || ||||| ||||| 
Sbjct  178  GTGCCCCGCGCCGTTCTTGTCGATCTGGAGCCCGGCACCATGGATTCGGTGCGTTCGGGT  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||||||||| |||||||| ||||| ||||| || ||||| |||
Sbjct  238  CCATTCGGACAGATCTTCAGGCCCGATAACTTTGTTTTCGGACAGTCTGGAGCCGGTAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || |||||||| |||||||| || |||||||||
Sbjct  298  AACTGGGCCAAGGGCCACTACACAGAAGGCGCTGAGCTTGTGGACTCCGTTCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||
Sbjct  358  GTTCGCAAGGAGGCCGAATCCTGCGATTGCCTGCAAGGCTTCCAGCTCACACACTCGCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||| ||||||||||||||||| |||||||||||||| |||||||| ||||| || 
Sbjct  418  GGCGGCGGTACTGGCTCCGGTATGGGTACCCTGCTGATTTCTAAGATCCGTGAGGAATAT  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||| 
Sbjct  478  CCCGACAGGATCATGAACACATACTCGGTGGTGCCGTCGCCAAAGGTATCGGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_001986980.1| Drosophila grimshawi GH20203 (Dgri\GH20203), mRNA
Length=1344

 Score =  661 bits (732),  Expect = 0.0
 Identities = 437/484 (91%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || || ||||||||||||||||||||||| || ||||| ||||| ||||||
Sbjct  58   TTCTGGGAAATAATTTCCGATGAGCATGGCATCGATGCGACTGGCGCTTACCATGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct  118  AGCGATCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAATAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| |||||| | || ||||||||||| |||||||||||||| || || ||||| 
Sbjct  178  GTGCCCCGTGCTGTCTTAGTTGATCTGGAGCCTGGCACCATGGACTCGGTTCGCTCGGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||| ||||| |||||||||||||||||||| ||||| ||||||
Sbjct  238  CCATTCGGCCAGATCTTCAGACCCGATAACTTTGTGTTCGGCCAGTCTGGTGCTGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||||||||| |||||||| || || || ||||||||||||
Sbjct  298  AACTGGGCCAAGGGCCATTACACAGAGGGCGCTGAGCTTGTTGATTCGGTGCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||| ||||| ||||| ||||| ||||||||||||||||| || ||||||||||| 
Sbjct  358  GTGCGCAAAGAGGCTGAATCGTGCGATTGCCTGCAAGGCTTCCAGCTAACACACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||||||||| ||||| ||||| |||||||| |||||||||||||| |||||||||
Sbjct  418  GGCGGCGGCACTGGTTCCGGCATGGGTACCCTGCTCATTTCCAAGATCCGTGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| |||||||||||||||||||||||||| ||||| ||||| ||||||||||||
Sbjct  478  CCCGACAGAATCATGAACACATACTCGGTTGTGCCCTCGCCAAAGGTATCGGACACCGTT  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|EU673725.1| Drosophila silvestris beta-tubulin (betaTub56D) mRNA, partial 
cds
Length=618

 Score =  652 bits (722),  Expect = 0.0
 Identities = 435/484 (90%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || || ||||||||||||||||||||||| |||||||| ||||| ||||||
Sbjct  109  TTCTGGGAAATAATTTCCGATGAGCATGGCATCGATGCGACCGGCGCTTACCATGGTGAC  168

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct  169  AGCGATCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAATAT  228

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| |||||| | || |||||||| || |||||||||||||| ||||| ||||| 
Sbjct  229  GTGCCCCGTGCTGTCTTAGTTGATCTGGAACCTGGCACCATGGACTCGGTGCGCTCGGGC  288

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| ||||| |||||||||||||| ||||| ||||| ||||||
Sbjct  289  CCATTCGGTCAGATCTTCAGACCCGATAACTTTGTGTTCGGTCAGTCTGGTGCTGGCAAC  348

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||||||||| |||||||| || || || ||||||||||||
Sbjct  349  AACTGGGCCAAGGGCCATTACACAGAGGGCGCTGAGCTCGTTGATTCGGTGCTCGATGTT  408

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||| ||||| ||||| ||||| ||||||||||||||||| || ||||||||||| 
Sbjct  409  GTGCGCAAAGAGGCTGAATCGTGCGATTGCCTGCAAGGCTTCCAGCTAACACACTCCCTG  468

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||||||||| ||||| ||||| |||||||| |||||||||||||| ||||| |||
Sbjct  469  GGCGGCGGCACTGGTTCCGGCATGGGTACCCTGCTCATTTCCAAGATCCGTGAGGAATAC  528

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| |||||||||||||||||||||||||| ||||| ||||| ||||||||||||
Sbjct  529  CCCGACAGAATCATGAACACATACTCGGTTGTGCCCTCGCCAAAGGTATCGGACACCGTT  588

Query  481  GTGG  484
            ||||
Sbjct  589  GTGG  592


>ref|XM_002063777.1| Drosophila willistoni GK15706 (Dwil\GK15706), mRNA
Length=1344

 Score =  616 bits (682),  Expect = 5e-173
 Identities = 427/484 (89%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||||||||| ||||||||||||||||| || |||||||| ||||||
Sbjct  58   TTCTGGGAGATCATCTCCGATGAACATGGCATCGATGCCACTGGAGCCTACCATGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| |||||  ||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct  118  AGCGATCTGCAATTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAATAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || ||||| ||  | |||||| |||| ||||||||||||||||| || || ||||||
Sbjct  178  GTACCACGCGCCGTTTTGGTCGATTTGGAACCCGGCACCATGGACTCAGTCCGTTCGGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||||||||| |||||||| ||||| ||||| ||||| || |||
Sbjct  238  CCATTCGGTCAGATCTTCAGGCCCGATAACTTTGTATTCGGACAGTCCGGTGCTGGTAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||||||||||||||| || || |||||||| || || ||||||||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAAGGCGCCGAGCTGGTCGATTCCGTGCTCGATGTC  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||| ||||| ||||||||||| ||| |||| |||||||| || |||||||| |||
Sbjct  358  GTTCGCAAAGAGGCTGAATCCTGCGATTGCTTGCAGGGCTTCCAGCTTACACACTCGCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||| ||||||||||| ||| |||||||||| |||||||| || || |||
Sbjct  418  GGTGGCGGCACTGGTTCCGGTATGGGTACCTTGCTGATTTCTAAGATCCGTGAAGAATAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| |||||||||||||||||||||||||| || ||||||||||| |||||||| 
Sbjct  478  CCCGACAGAATCATGAACACATACTCGGTTGTGCCTTCACCCAAGGTGTCCGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002005862.1| Drosophila mojavensis GI20729 (Dmoj\GI20729), mRNA
Length=1344

 Score =  603 bits (668),  Expect = 3e-169
 Identities = 423/482 (88%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| ||||| ||||||||||| ||||| ||||| |||||||| ||||| || |||
Sbjct  58   TTCTGGGAAATCATTTCCGATGAGCACGGCATTGATGCTACCGGCGCTTACCATGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||  | || || |||||||| |||||||||||||||||||| ||||| || 
Sbjct  118  AGCGACCTACAATTAGAACGTATCAATGTATACTACAATGAGGCGTCCGGAGGCAAATAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||||| || |||||| ||||||| |||||||||||||| ||||||||||| 
Sbjct  178  GTGCCTCGCGCTGTGCTCGTCGATTTGGAGCCTGGCACCATGGACTCCGTGCGATCGGGT  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||| |||||||||||||||||||| || || ||||||||||||
Sbjct  238  CCCTTCGGCCAGATCTTCAGACCCGACAACTTTGTGTTCGGTCAATCTGGTGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||||||||||||||| || |||||||| || || |||||||||||||||
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAAGGCGCTGAGCTCGTCGATTCAGTGCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || || ||||| ||||| ||||| |||||||||||||||||||| |||||||| |||
Sbjct  358  GTGCGTAAAGAGGCTGAATCGTGCGATTGCCTGCAAGGCTTCCAACTTACACACTCGCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || ||||| ||||| ||||||||||| ||||||||||| ||||| || 
Sbjct  418  GGAGGCGGCACCGGTTCCGGCATGGGTACCCTGCTGATCTCCAAGATCCGTGAGGAATAT  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||| || ||||||||||||||||| || ||||| ||||| ||||| ||||||||||||
Sbjct  478  CCCGATAGAATCATGAACACATACTCAGTGGTGCCCTCGCCAAAGGTATCGGACACCGTT  537

Query  481  GT  482
            ||
Sbjct  538  GT  539


>ref|XM_001844579.1| Culex quinquefasciatus tubulin beta chain, mRNA
Length=1752

 Score =  594 bits (658),  Expect = 2e-166
 Identities = 422/484 (88%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || ||||| |||||||| || |||||||||||||| || |||||||||||||||||||||
Sbjct  55   TTTTGGGAAATCATCTCGGACGAGCATGGCATCGACGCGACCGGCGCCTACCACGGTGAC  114

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct  115  TCAGACCTGCAGCTGGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGCGGCAAGTAC  174

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| ||||| ||||||||||||||||||||||||||||| || || ||||||
Sbjct  175  GTGCCCCGCGCCGTCCTGGTCGATCTGGAGCCCGGCACCATGGACTCGGTCCGCTCGGGA  234

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||||
Sbjct  235  CCCTTCGGACAGATCTTCCGGCCGGACAACTTTGTGTTCGGACAGTCGGGCGCCGGCAAC  294

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || || ||||| |||   |||||||| || 
Sbjct  295  AACTGGGCCAAGGGACACTACACCGAGGGCGCGGAACTGGTCGACAGCGTGCTCGACGTG  354

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||||||||| |||||||||||||| || ||||| || || ||||| || 
Sbjct  355  GTGCGCAAGGAGGCCGAATCGTGCGACTGCCTGCAGGGATTCCAGCTGACGCACTCGCTG  414

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || || ||||| |||||||| |||||||| || ||||| || || || |||
Sbjct  415  GGCGGTGGTACCGGTTCCGGCATGGGAACGCTGCTGATCTCAAAGATTCGTGAAGAATAC  474

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| || ||||| |||||||| ||||| |||||||| 
Sbjct  475  CCCGACAGAATCATGAACACATACTCAGTCGTGCCCTCGCCCAAAGTGTCAGACACCGTC  534

Query  481  GTGG  484
            ||||
Sbjct  535  GTGG  538


>gb|DQ401465.1| Culex pipiens pipiens clone CpiED-B06 beta tubulin mRNA, complete 
cds
Length=1395

 Score =  589 bits (652),  Expect = 8e-165
 Identities = 421/484 (87%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || ||||| |||||||| || |||||||||||||| || |||||||||||||||||||||
Sbjct  58   TTTTGGGAAATCATCTCGGACGAGCATGGCATCGACGCGACCGGCGCCTACCACGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct  118  TCAGACCTGCAGCTGGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGCGGCAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| ||||| ||||||||||||||||||||||||||||| || || ||||||
Sbjct  178  GTGCCCCGCGCCGTCCTGGTCGATCTGGAGCCCGGCACCATGGACTCGGTCCGCTCGGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||  |||| ||||||||||||||||| |||||||| |||||||||
Sbjct  238  CCCTTCGGACAGATCTTTCGGCCGGACAACTTTGTGTTCGGACAGTCGGGCGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || || ||||| |||   |||||||| || 
Sbjct  298  AACTGGGCCAAGGGACACTACACCGAGGGCGCGGAACTGGTCGACAGCGTGCTCGACGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||||||||| |||||||||||||| || ||||| || || ||||| || 
Sbjct  358  GTGCGCAAGGAGGCCGAATCGTGCGACTGCCTGCAGGGATTCCAGCTGACGCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || || ||||| |||||||| |||||||| || ||||| || || || |||
Sbjct  418  GGCGGTGGTACCGGTTCCGGCATGGGAACGCTGCTGATCTCAAAGATTCGTGAAGAATAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| || ||||| |||||||| ||||| |||||||| 
Sbjct  478  CCCGACAGAATCATGAACACATACTCAGTCGTGCCCTCGCCCAAAGTGTCAGACACCGTC  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002049908.1| Drosophila virilis GJ20466 (Dvir\GJ20466), mRNA
Length=1344

 Score =  585 bits (648),  Expect = 9e-164
 Identities = 419/482 (87%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || |||
Sbjct  58   TTCTGGGAAATCATATCCGATGAGCATGGCATTGATGCGACCGGCGCCTACCATGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||  |||||||||||||||| |||||||| |||||||| |||||||| || 
Sbjct  118  AGCGACCTGCAATTGGAGCGCATCAATGTCTACTACAACGAGGCGTCTGGTGGCAAATAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||||||||||| ||| ||||||| |||||||||||||| ||||||||||| 
Sbjct  178  GTGCCTCGGGCTGTCCTTGTTGATTTGGAGCCTGGCACCATGGACTCGGTGCGATCGGGT  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||| ||||| |||||||||||||||||||| || || || ||||| |||
Sbjct  238  CCCTTCGGTCAGATTTTCAGACCCGACAACTTTGTGTTCGGTCAATCTGGCGCCGGTAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| |||||||| ||||||||||| |||||||| || || |||||||| ||||||
Sbjct  298  AACTGGGCTAAGGGTCACTACACAGAGGGCGCTGAGCTCGTTGATTCAGTGCTTGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || || ||||| ||||| ||||| ||||||||||||||||| || |||||||| |||
Sbjct  358  GTTCGTAAAGAGGCTGAATCGTGCGATTGCCTGCAAGGCTTCCAGCTTACACACTCACTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| ||| |||| || ||||||||||| ||||| |||
Sbjct  418  GGAGGCGGCACCGGTTCTGGCATGGGTACCTTGCTAATCTCCAAGATCCGAGAGGAATAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||| || |||||||||||||||||||||||||| ||||| ||||| || || ||||||
Sbjct  478  CCCGATAGAATCATGAACACATACTCGGTTGTGCCCTCGCCGAAGGTATCAGATACCGTT  537

Query  481  GT  482
            ||
Sbjct  538  GT  539


>emb|BX032959.1| Single read from an extremity of a full-length cDNA clone made 
from Anopheles gambiae total adult females. 5-PRIME end of 
clone FK0AAA49AG02 of strain 6-9 of Anopheles gambiae (African 
malaria mosquito)
Length=948

 Score =  569 bits (630),  Expect = 7e-159
 Identities = 416/482 (87%), Gaps = 1/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || |||||||||||||| || |||||||| ||||| |  |||||||| |||
Sbjct  239  TTCTGGGAAATTATCTCCGATGAGCACGGTATCGATGCGACCGGTGGATACCACGGCGAC  298

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || |||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct  299  TCAGATCTGCAGCTAGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  358

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || || || || |||||||| |||||||| ||||||||||| || || || || 
Sbjct  359  GTGCCGCGTGCCGTGCTGGTCGATCTCGAGCCCGGTACCATGGACTCGGTCCGCTCCGGC  418

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| |||||||| |||||||| ||||| |||
Sbjct  419  CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTGTTCGGACAGTCGGGCGCCGGTAAC  478

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||||||||||||||| ||||| |||||||| || 
Sbjct  479  AACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTCGACTCCGTGCTCGACGTG  538

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||||||||||||||| ||||| |||||||| || || ||||| || 
Sbjct  539  GTGCGCAAGGAGGCCGAATCCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTC  598

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || |||||||| ||||| || |||||||| || || |||||||||||||||
Sbjct  599  GGTGGCGGTACCGGCTCCGGCATGGGCACGCTGCTGATCTCGAAAATCCGCGAGGAGTAC  658

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | |||||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct  659  CCGGACCGCATCATGAACACATACTCGGTTGTGCCGTCGCCGAA-GTGTCGGACACCGTG  717

Query  481  GT  482
            ||
Sbjct  718  GT  719


>ref|XM_309765.4| Anopheles gambiae str. PEST AGAP010929-PA (AgaP_AGAP010929) mRNA, 
complete cds
Length=1568

 Score =  567 bits (628),  Expect = 2e-158
 Identities = 415/482 (87%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || |||||||||||||| || |||||||| ||||| |  |||||||| |||
Sbjct  282  TTCTGGGAAATTATCTCCGATGAGCACGGTATCGATGCGACCGGTGGATACCACGGCGAC  341

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || |||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct  342  TCAGATCTGCAGCTAGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  401

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || || || || |||||||| |||||||| ||||||||||| || || || || 
Sbjct  402  GTGCCGCGTGCCGTGCTGGTCGATCTCGAGCCCGGTACCATGGACTCGGTCCGCTCCGGC  461

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| |||||||| |||||||| ||||| |||
Sbjct  462  CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTGTTCGGACAGTCGGGCGCCGGTAAC  521

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||| |||||||| ||||| |||||||| || 
Sbjct  522  AACTGGGCCAAGGGCCACTACACCGAGGGTGCCGAGCTGGTCGACTCCGTGCTCGACGTG  581

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||||||||||||||| ||||| |||||||| || || ||||| || 
Sbjct  582  GTGCGCAAGGAGGCCGAATCCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTC  641

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || |||||||| ||||| || |||||||| || || |||||||||||||||
Sbjct  642  GGTGGCGGTACCGGCTCCGGCATGGGCACGCTGCTGATCTCGAAAATCCGCGAGGAGTAC  701

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | |||||||||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct  702  CCGGACCGCATCATGAACACATACTCGGTCGTGCCGTCGCCGAAGGTGTCGGACACCGTG  761

Query  481  GT  482
            ||
Sbjct  762  GT  763


>ref|XM_001743918.1| Monosiga brevicollis MX1 beta tubulin MONBRDRAFT_44314 (TUB_2) 
mRNA, complete cds
Length=1660

 Score =  558 bits (618),  Expect = 1e-155
 Identities = 413/482 (86%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||||||||| ||||| ||  |||||||| ||||||||||||||
Sbjct  130  TTCTGGGAGGTCATCTCCGATGAGCACGGCATTGACCCCACCGGCACCTACCACGGTGAC  189

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| || ||||||||||||||||| || |||||||| |||||  ||||||||||||| 
Sbjct  190  AGCGATCTCCAGCTGGAGCGCATCAACGTCTACTACAACGAGGCCACCGGTGGCAAGTAT  249

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| ||||| ||||| || |||||||| ||||||||||| || ||  | || 
Sbjct  250  GTGCCCCGCGCCGTCCTCGTCGACCTTGAGCCCGGAACCATGGACTCAGTCCGCGCTGGC  309

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||| | |||||||||||||| || |||||||| || ||||| |||
Sbjct  310  CCCTTCGGCCAGATCTTCCGCCCCGACAACTTTGTCTTTGGCCAGTCTGGCGCCGGTAAC  369

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| |||||||||||||| || ||||| || |||||||| 
Sbjct  370  AACTGGGCCAAGGGTCACTACACCGAGGGTGCTGAGCTCGTCGACTCTGTCCTCGATGTC  429

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||| ||   |||||||||||| || |||||||| ||||| ||||| || 
Sbjct  430  GTCCGCAAGGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGCTCACCCACTCGCTC  489

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || |||||||| ||||| || || || || ||||||||||| |||||||||
Sbjct  490  GGCGGTGGTACCGGCTCCGGCATGGGTACTCTCCTCATCTCCAAGATCCGTGAGGAGTAC  549

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | ||| || ||||| || |||||||| ||||||||||||
Sbjct  550  CCCGACCGCATCATGAACACCTTCTCCGTGGTGCCCTCCCCCAAGGTCTCGGACACCGTT  609

Query  481  GT  482
            ||
Sbjct  610  GT  611


>emb|BX056514.1| Single read from an extremity of a full-length cDNA clone made 
from Anopheles gambiae total adult females. 5-PRIME end of 
clone FK0AAC35DE01 of strain 6-9 of Anopheles gambiae (African 
malaria mosquito)
Length=833

 Score =  558 bits (618),  Expect = 1e-155
 Identities = 415/483 (86%), Gaps = 2/483 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || |||||||||||||| || |||||||| ||||| |  |||||||| |||
Sbjct  198  TTCTGGGAAATTATCTCCGATGAGCACGGTATCGATGCGACCGGTGGATACCACGGCGAC  257

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || |||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct  258  TCAGATCTGCAGCTAGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  317

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||| | || |||||||| |||||||| ||||||||||| || || || || 
Sbjct  318  GTGCCGCGTGCTTTGCTGGTCGATCTCGAGCCCGGTACCATGGACTCGGTCCGCTCCGGC  377

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| |||||||| |||||||| ||||| |||
Sbjct  378  CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTGTTCGGACAGTCGGGCGCCGGTAAC  437

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||||||||||||||| ||||| |||||||| || 
Sbjct  438  AACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTCGACTCCGTGCTCGACGTG  497

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||||||||||||||| ||||| |||||||| || || ||||| || 
Sbjct  498  GTGCGCAAGGAGGCCGAATCCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTC  557

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || ||| |||| ||||| || |||||||| || || |||||||||||||||
Sbjct  558  GGTGGCGGTACCGGCCCCGGCATGGGCACGCTGCTGATCTCGAAAATCCGCGAGGAGTAC  617

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGT-CGGACACCGT  479
            || ||| | |||||||||||||||||||||||||||||||| || |||| ||||||||||
Sbjct  618  CCGGACCGCATCATGAACACATACTCGGTTGTGCCGTCGCCGAA-GTGTCCGGACACCGT  676

Query  480  TGT  482
             ||
Sbjct  677  GGT  679


>emb|BX060680.1| Single read from an extremity of a full-length cDNA clone made 
from Anopheles gambiae total adult females. 5-PRIME end of 
clone FK0AAC41AF07 of strain 6-9 of Anopheles gambiae (African 
malaria mosquito)
Length=894

 Score =  556 bits (616),  Expect = 4e-155
 Identities = 416/484 (86%), Gaps = 3/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCC-TACCACGGTGA  59
            |||||||| || |||||||||||||| || |||||||| ||||| |   |||||||| ||
Sbjct  209  TTCTGGGAAATTATCTCCGATGAGCACGGTATCGATGCGACCGGTGTGATACCACGGCGA  268

Query  60   CAGCGACCTGCAGCTGGAGC-GCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGT  118
            |   || |||||||| |||| ||||||| |||||||||||||||||||||||||||||||
Sbjct  269  CTCAGATCTGCAGCTAGAGCTGCATCAACGTGTACTACAATGAGGCGTCCGGTGGCAAGT  328

Query  119  ACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGG  178
            ||||||| || || || || |||||||| |||||||| ||||||||||| || || || |
Sbjct  329  ACGTGCCGCGTGCGGTGCTGGTCGATCTCGAGCCCGGTACCATGGACTCGGTCCGCTCCG  388

Query  179  GACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCA  238
            | || ||||| ||||||||| | || |||||||| |||||||| |||||||| ||||| |
Sbjct  389  GCCCATTCGGACAGATCTTCCGCCCGGACAACTTCGTGTTCGGACAGTCGGGCGCCGGTA  448

Query  239  ACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATG  298
            |||||||||||||||| || ||||| ||||||||||||||||| ||||| |||||||| |
Sbjct  449  ACAACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTCGACTCCGTGCTCGACG  508

Query  299  TTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCC  358
            | || |||||||||||||||||||||||||| ||||| |||||||| || || ||||| |
Sbjct  509  TGGTGCGCAAGGAGGCCGAATCCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGC  568

Query  359  TTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGT  418
            | || ||||| || |||||||| ||||| || |||||||| || || |||||||||||||
Sbjct  569  TCGGTGGCGGTACCGGCTCCGGCATGGGCACGCTGCTGATCTCGAAAATCCGCGAGGAGT  628

Query  419  ACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCG  478
            |||| ||| | |||||||||||||||||||||||||||||||| || |||||||||||||
Sbjct  629  ACCCGGACCGCATCATGAACACATACTCGGTTGTGCCGTCGCCGAA-GTGTCGGACACCG  687

Query  479  TTGT  482
            | ||
Sbjct  688  TGGT  691


>dbj|AK383913.1| Bombyx mori mRNA, clone: MFB-26O24
Length=1963

 Score =  554 bits (614),  Expect = 2e-154
 Identities = 412/482 (86%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  134  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  193

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  194  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  253

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || ||||||
Sbjct  254  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCGGGA  313

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  314  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTTTTCGGACAGTCCGGCGCCGGCAAC  373

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||||||||||||||| || ||||| || |||||||| 
Sbjct  374  AACTGGGCCAAGGGACACTACACAGAGGGTGCTGAGCTCGTTGACTCGGTCCTCGATGTA  433

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||| ||  | ||||| ||||| ||||| || ||||||||||| ||||| ||||| 
Sbjct  434  GTCCGCAAAGAATCAGAATCTTGCGATTGCCTACAGGGCTTCCAACTTACACATTCCCTC  493

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || ||||||||||| ||||| || || || |||||||| || ||||||
Sbjct  494  GGTGGCGGCACCGGGTCCGGTATGGGCACCCTCCTCATCTCAAAGATCCGTGAAGAGTAC  553

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| || || || |||||||| || || ||||| || 
Sbjct  554  CCCGACAGAATCATGAACACATACTCAGTAGTCCCCTCGCCCAAAGTATCAGACACTGTC  613

Query  481  GT  482
            ||
Sbjct  614  GT  615


>emb|BX043950.1| Single read from an extremity of a full-length cDNA clone made 
from Anopheles gambiae total adult females. 5-PRIME end of 
clone FK0AAC17AD12 of strain 6-9 of Anopheles gambiae (African 
malaria mosquito)
Length=961

 Score =  554 bits (614),  Expect = 2e-154
 Identities = 415/483 (86%), Gaps = 3/483 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || |||||||||||||| || |||||||| ||||| |  |||||||| |||
Sbjct  287  TTCTGGGAAATTATCTCCGATGAGCACGGTATCGATGCGACCGGTGGATACCACGGCGAC  346

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || |||||||| ||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct  347  TCAGATCTGCAGCTAGAGCGCATCAACGTGTACTGCAATGAGGCGTCCGGTGGCAAGTAC  406

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || || || || |||||||| |||||||| ||||||||||| || || || || 
Sbjct  407  GTGCCGCGTGCCGTGCTGGTCGATCTCGAGCCCGGTACCATGGACTCGGTCCGCTCCGGC  466

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| |||||||| |||||||| ||||| |||
Sbjct  467  CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTGTTCGGACAGTCGGGCGCCGGTAAC  526

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||||||||||||||| ||||| |||||||| || 
Sbjct  527  AACTGGGCCAAGGG-CACTACACCGAGGGTGCTGAGCTGGTCGACTCCGTGCTCGACGTG  585

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||||||||||||||| ||||| |||||||| || || ||||| || 
Sbjct  586  GTGCGCAAGGAGGCCGAATCCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTC  645

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || |||||||| ||||| || |||||||| || || |||||||||||||||
Sbjct  646  GGTGGCGGTACCGGCTCCGGCATGGGCACGCTGCTGATCTCGAAAATCCGCGAGGAGTAC  705

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAG-GTGTCGGACACCGT  479
            || ||| | |||||||||||||||||||||||||||||||| ||| ||| ||||||||||
Sbjct  706  CCGGACCGCATCATGAACACATACTCGGTTGTGCCGTCGCCGAAGTGTG-CGGACACCGT  764

Query  480  TGT  482
             ||
Sbjct  765  GGT  767


>gb|AY026071.1| Monosiga brevicollis beta-tubulin mRNA, complete cds
Length=1526

 Score =  554 bits (614),  Expect = 2e-154
 Identities = 412/482 (86%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||||||||| ||||| ||  |||||||| ||||||||||||||
Sbjct  69   TTCTGGGAGGTCATCTCCGATGAGCACGGCATTGACCCCACCGGCACCTACCACGGTGAC  128

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| || ||||||||||||||||| || |||||||| |||||  ||||||||||||| 
Sbjct  129  AGCGATCTCCAGCTGGAGCGCATCAACGTCTACTACAACGAGGCCACCGGTGGCAAGTAT  188

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| ||||| ||||| || |||||||| ||||||||||| || ||  | || 
Sbjct  189  GTGCCCCGCGCCGTCCTCGTCGACCTTGAGCCCGGAACCATGGACTCGGTCCGCGCTGGC  248

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||||||||| | |||||||||||||| || |||||||| || ||||| |||
Sbjct  249  CCCTTTGGCCAGATCTTCCGCCCCGACAACTTTGTCTTTGGCCAGTCTGGCGCCGGTAAC  308

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| |||||||||||||| || ||||| || |||||||||
Sbjct  309  AACTGGGCCAAGGGTCACTACACCGAGGGTGCTGAGCTCGTCGACTCTGTCCTCGATGTT  368

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||| ||   |||||||||||| || |||||||| ||||| ||||| || 
Sbjct  369  GTCCGCAAGGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGCTCACCCACTCGCTC  428

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || ||||| || ||||| || || || || ||||||||||| |||||||||
Sbjct  429  GGCGGTGGTACCGGCTCTGGCATGGGTACTCTCCTCATCTCCAAGATCCGTGAGGAGTAC  488

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | ||| || ||||| || |||||||| ||||||||||||
Sbjct  489  CCCGACCGCATCATGAACACCTTCTCCGTGGTGCCCTCCCCCAAGGTCTCGGACACCGTT  548

Query  481  GT  482
            ||
Sbjct  549  GT  550


>dbj|AP009001.1| Bombyx mori genomic DNA, chromosome 20, BAC clone:014E18, complete 
sequence
Length=173544

 Score =  549 bits (608),  Expect = 7e-153
 Identities = 411/482 (86%), Gaps = 0/482 (0%)
 Strand=Plus/Minus

Query  1      TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
              |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  85565  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGAGAC  85506

Query  61     AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                 ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  85505  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  85446

Query  121    GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
              |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  85445  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCCGGA  85386

Query  181    CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
              |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  85385  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  85326

Query  241    AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
              |||||||||||||| || |||||||||||||||||||| || ||||| || |||||||| 
Sbjct  85325  AACTGGGCCAAGGGACACTACACAGAGGGTGCTGAGCTCGTTGACTCGGTCCTCGATGTA  85266

Query  301    GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
              |||||||| ||  | ||||| ||||| ||||| || ||||||||||| ||||| ||||| 
Sbjct  85265  GTCCGCAAAGAATCAGAATCTTGCGATTGCCTACAGGGCTTCCAACTTACACATTCCCTC  85206

Query  361    GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
              || |||||||| || ||||||||||| ||||| || || || |||||||| || ||||||
Sbjct  85205  GGTGGCGGCACCGGGTCCGGTATGGGCACCCTCCTCATCTCAAAGATCCGTGAAGAGTAC  85146

Query  421    CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
              |||||||| ||||||||||||||||| || || || |||||||| || || ||||| || 
Sbjct  85145  CCCGACAGAATCATGAACACATACTCAGTAGTCCCCTCGCCCAAAGTATCAGACACTGTC  85086

Query  481    GT  482
              ||
Sbjct  85085  GT  85084


 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Minus

Query  1      TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
              |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  56281  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  56222

Query  61     AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                 ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  56221  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  56162

Query  121    GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
              |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  56161  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  56102

Query  181    CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
              |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  56101  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  56042

Query  241    AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
              |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  56041  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  55982

Query  301    GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
              || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  55981  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  55922

Query  361    GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
              ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  55921  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  55862

Query  421    CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
              || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  55861  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  55802

Query  481    GT  482
              ||
Sbjct  55801  GT  55800


>ref|XM_001743385.1| Monosiga brevicollis MX1 beta tubulin MONBRDRAFT_44315 (TUB_1) 
mRNA, complete cds
Length=1604

 Score =  549 bits (608),  Expect = 7e-153
 Identities = 411/482 (86%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||||||||| ||||| ||  |||||||| ||||||||||||||
Sbjct  147  TTCTGGGAGGTCATCTCCGATGAGCACGGCATTGACCCCACCGGCACCTACCACGGTGAC  206

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| || ||||||||||||||||| || |||||||| |||||  ||||||||||||| 
Sbjct  207  AGCGATCTCCAGCTGGAGCGCATCAACGTCTACTACAACGAGGCCACCGGTGGCAAGTAT  266

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| ||||| ||||| || |||||||| ||||||||||| || ||  | || 
Sbjct  267  GTGCCCCGCGCCGTCCTCGTCGACCTTGAGCCCGGAACCATGGACTCGGTCCGCGCTGGC  326

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||||||||| | |||||||||||||| || |||||||| || ||||| |||
Sbjct  327  CCCTTTGGCCAGATCTTCCGCCCCGACAACTTTGTCTTTGGCCAGTCTGGCGCCGGTAAC  386

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| |||||||||||||| || ||||| || |||||||| 
Sbjct  387  AACTGGGCCAAGGGTCACTACACCGAGGGTGCTGAGCTCGTCGACTCTGTCCTCGATGTC  446

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||| ||   |||||||||||| || |||||||| ||||| ||||| || 
Sbjct  447  GTCCGCAAGGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGCTCACCCACTCGCTC  506

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || ||||| || ||||| || || || || ||||||||||| |||||||||
Sbjct  507  GGCGGTGGTACCGGCTCTGGCATGGGTACTCTCCTCATCTCCAAGATCCGTGAGGAGTAC  566

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | ||| || ||||| || |||||||| ||||||||||||
Sbjct  567  CCCGACCGCATCATGAACACCTTCTCCGTGGTGCCCTCCCCCAAGGTCTCGGACACCGTT  626

Query  481  GT  482
            ||
Sbjct  627  GT  628


>ref|NM_001043422.1| Bombyx mori beta-tubulin (Tub1), mRNA
 dbj|AB072307.1| Bombyx mori bmtub1 mRNA for beta-tubulin, complete cds
Length=1975

 Score =  549 bits (608),  Expect = 7e-153
 Identities = 411/482 (86%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  152  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  211

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  212  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  271

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  272  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCCGGA  331

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  332  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  391

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||||||||||||||| || ||||| || |||||||| 
Sbjct  392  AACTGGGCCAAGGGACACTACACAGAGGGTGCTGAGCTCGTTGACTCGGTCCTCGATGTA  451

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||| ||  | ||||| ||||| ||||| || ||||||||||| ||||| ||||| 
Sbjct  452  GTCCGCAAAGAATCAGAATCTTGCGATTGCCTACAGGGCTTCCAACTTACACATTCCCTC  511

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || ||||||||||| ||||| || || || |||||||| || ||||||
Sbjct  512  GGTGGCGGCACCGGGTCCGGTATGGGCACCCTCCTCATCTCAAAGATCCGTGAAGAGTAC  571

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| || || || |||||||| || || ||||| || 
Sbjct  572  CCCGACAGAATCATGAACACATACTCAGTAGTCCCCTCGCCCAAAGTATCAGACACTGTC  631

Query  481  GT  482
            ||
Sbjct  632  GT  633


>dbj|AB003287.1| Bombyx mori mRNA for beta-tubulin, complete cds
Length=1952

 Score =  549 bits (608),  Expect = 7e-153
 Identities = 411/482 (86%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  172  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  231

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  232  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  291

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| ||||   ||||||||||||||||||||||||| || || |||
Sbjct  292  GTGCCCCGCGCCCTCCTCGTCGCCTTGGAGCCCGGCACCATGGACTCTGTCCGCTCCGGA  351

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  352  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  411

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||||||||||||||| || ||||| || |||||||| 
Sbjct  412  AACTGGGCCAAGGGACACTACACAGAGGGTGCTGAGCTCGTTGACTCGGTCCTCGATGTA  471

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||| ||  | ||||| ||||| ||||| |||||||||||||| ||||| ||||| 
Sbjct  472  GTCCGCAAAGAATCAGAATCTTGCGATTGCCTACAAGGCTTCCAACTTACACATTCCCTC  531

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || ||||||||||| ||||| || || || |||||||| || ||||||
Sbjct  532  GGTGGCGGCACCGGGTCCGGTATGGGCACCCTCCTCATCTCAAAGATCCGTGAAGAGTAC  591

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| || || || |||||||| || || ||||| || 
Sbjct  592  CCCGACAGAATCATGAACACATACTCAGTAGTCCCCTCGCCCAAAGTATCAGACACTGTC  651

Query  481  GT  482
            ||
Sbjct  652  GT  653


>emb|BX033714.1| Single read from an extremity of a full-length cDNA clone made 
from Anopheles gambiae total adult females. 5-PRIME end of 
clone FK0AAA5BC08 of strain 6-9 of Anopheles gambiae (African 
malaria mosquito)
Length=961

 Score =  542 bits (600),  Expect = 1e-150
 Identities = 413/484 (86%), Gaps = 3/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTG-GGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGA  59
            ||||| ||| || |||||||||||||| || |||||||| ||||| |  |||||||| ||
Sbjct  239  TTCTGTGGAAATTATCTCCGATGAGCACGGTATCGATGCGACCGGTGGATACCACGGCGA  298

Query  60   CAGCGACCTGCAGCTGGAGCGCATCAATGTGTAC-TACAATGAGGCGTCCGGTGGCAAGT  118
            |   || |||||||| ||||||||||| |||||| |||||||||||||||||||||||||
Sbjct  299  CTCAGATCTGCAGCTAGAGCGCATCAACGTGTACCTACAATGAGGCGTCCGGTGGCAAGT  358

Query  119  ACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGG  178
            |||||||    || || || |||||||| |||||||| ||||||||||| || || || |
Sbjct  359  ACGTGCCGTTTGCCGTGCTGGTCGATCTCGAGCCCGGTACCATGGACTCGGTCCGCTCCG  418

Query  179  GACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCA  238
            | || ||||| ||||||||| | || |||||||| |||||||| |||||||| ||||| |
Sbjct  419  GCCCATTCGGACAGATCTTCCGCCCGGACAACTTCGTGTTCGGACAGTCGGGCGCCGGTA  478

Query  239  ACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATG  298
            |||||||||||||||| || ||||| ||||||||||||||||| || || |||||||| |
Sbjct  479  ACAACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTCGATTCCGTGCTCGACG  538

Query  299  TTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCC  358
            | || |||||||||||||||||||||||||| ||||| |||||||| || || ||||| |
Sbjct  539  TGGTGCGCAAGGAGGCCGAATCCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGC  598

Query  359  TTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGT  418
            | || ||||| || |||||||| ||||| || |||||||| || || |||||||||||||
Sbjct  599  TCGGTGGCGGTACCGGCTCCGGCATGGGCACGCTGCTGATCTCGAAAATCCGCGAGGAGT  658

Query  419  ACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCG  478
            |||| ||| | |||||||||||||||||||||||||||||||| || |||||||||||||
Sbjct  659  ACCCGGACCGCATCATGAACACATACTCGGTTGTGCCGTCGCCGAA-GTGTCGGACACCG  717

Query  479  TTGT  482
            | ||
Sbjct  718  TGGT  721


>dbj|AK384111.1| Bombyx mori mRNA, clone: fcaL08B15_K01268
Length=1959

 Score =  540 bits (598),  Expect = 3e-150
 Identities = 409/482 (85%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||| || ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  146  TTCTGGGAGATCATCTCTGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  205

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  206  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  265

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  266  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  325

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || || ||||||
Sbjct  326  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCTGGCAAC  385

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||||||||||||||| || ||||| || |||||||| 
Sbjct  386  AACTGGGCCAAGGGACACTACACAGAGGGTGCTGAGCTCGTTGACTCGGTCCTCGATGTA  445

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||| ||  | ||||| ||||| ||||| || ||||||||||| ||||| ||||| 
Sbjct  446  GTCCGCAAAGAATCAGAATCTTGCGATTGCCTACAGGGCTTCCAACTTACACATTCCCTC  505

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || ||||||||||| ||||| || || || |||||||| || ||||||
Sbjct  506  GGTGGCGGCACCGGGTCCGGTATGGGCACCCTCCTCATCTCAAAGATCCGTGAAGAGTAC  565

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| || || || |||||||| || || ||||| || 
Sbjct  566  CCCGACAGAATCATGAACACATACTCAGTAGTCCCCTCGCCCAAAGTATCAGACACTGTC  625

Query  481  GT  482
            ||
Sbjct  626  GT  627


>gb|JN029962.1| Agrotis ipsilon beta-tubulin mRNA, complete cds
Length=1724

 Score =  540 bits (598),  Expect = 3e-150
 Identities = 409/482 (85%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||||||||| ||||||||  |||||||||||||||| || |||
Sbjct  63   TTCTGGGAGATCATCTCCGATGAGCACGGCATCGACCCCACCGGCGCCTACCATGGCGAC  122

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct  123  TCGGACCTGCAGCTGGAGCGCATCAACGTTTACTACAATGAGGCCTCCGGCGGCAAGTAC  182

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| ||||| || |||||||||||||||||||| ||||| ||||||
Sbjct  183  GTGCCCCGCGCCATCCTCGTCGACCTCGAGCCCGGCACCATGGACTCGGTGCGCTCGGGA  242

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| |||||||| ||||| || ||||| |||
Sbjct  243  CCCTTCGGACAGATCTTCCGACCAGACAACTTCGTGTTCGGACAGTCCGGAGCCGGTAAC  302

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| |||||||| ||||| ||||| ||||||||||| || |||||  | || || 
Sbjct  303  AACTGGGCTAAGGGTCACTACACCGAGGGAGCTGAGCTGGTCGATTCAGTATTAGACGTC  362

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||| || || || || ||||| || ||||| ||||||||||||||||| || 
Sbjct  363  GTACGCAAGGAAGCAGAGTCATGTGACTGTCTACAAGGATTCCAACTCACACACTCGCTC  422

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||||||||| ||||| ||||| || || || || ||||| ||| | || || || 
Sbjct  423  GGCGGCGGCACTGGTTCCGGAATGGGCACACTTCTTATCTCCAAAATCAGAGAAGAATAT  482

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| || |||||||||||||| ||||| || |||||||| ||||| ||||| || 
Sbjct  483  CCCGACAGAATTATGAACACATACTCAGTTGTACCTTCGCCCAAAGTGTCAGACACAGTA  542

Query  481  GT  482
            ||
Sbjct  543  GT  544


>gb|JF767013.1| Helicoverpa armigera beta-tubulin mRNA, complete cds
Length=1775

 Score =  540 bits (598),  Expect = 3e-150
 Identities = 409/482 (85%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  |||||||||||||||| || |||
Sbjct  63   TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGCGCCTACCATGGCGAC  122

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||
Sbjct  123  TCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAATGAGGCCTCCGGCGGCAAGTAC  182

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  |||| ||||| ||||||||||||||||||||||| ||||| ||||| 
Sbjct  183  GTGCCGCGCGCCATCCTCGTCGACCTGGAGCCCGGCACCATGGACTCGGTGCGCTCGGGC  242

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| |||||||| ||||| || |||||||||
Sbjct  243  CCCTTCGGACAGATCTTCCGGCCGGACAACTTCGTGTTCGGACAGTCCGGCGCCGGCAAC  302

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| ||||| || || || || || |||||  | || || 
Sbjct  303  AACTGGGCCAAGGGTCACTACACCGAGGGAGCCGAACTAGTCGATTCAGTATTAGACGTC  362

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||| || || || || || ||||| ||||| ||||||||||||||||| || 
Sbjct  363  GTACGCAAGGAAGCAGAGTCATGTGATTGCCTCCAAGGGTTCCAACTCACACACTCGCTC  422

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||||||||| ||||| ||||| || || || || ||||| ||| | ||||| || 
Sbjct  423  GGCGGCGGCACTGGTTCCGGAATGGGCACACTTCTTATCTCCAAAATCAGAGAGGAATAT  482

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| || |||||||||||||| ||||| || |||||||| ||||| ||||| || 
Sbjct  483  CCCGACAGAATTATGAACACATACTCAGTTGTACCTTCGCCCAAAGTGTCAGACACAGTA  542

Query  481  GT  482
            ||
Sbjct  543  GT  544


>gb|BT026927.1| Gasterosteus aculeatus clone CFW104-D01 mRNA sequence
Length=1950

 Score =  535 bits (592),  Expect = 1e-148
 Identities = 409/484 (85%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||| ||||| ||||| || |||||  |||| |||  |||||| || |||
Sbjct  150  TTCTGGGAGATCATTTCCGACGAGCACGGAATCGACCCCACTGGCAGCTACCATGGCGAC  209

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| || |||||||||||||| ||||| || ||||||
Sbjct  210  TCTGACCTGCAGCTGGAGCGCATCAACGTCTACTACAATGAGGCCTCCGGCGGAAAGTAC  269

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || |||||||| ||||| ||||||||||||||||| ||||||||||| |||||||| || 
Sbjct  270  GTCCCCCGCGCCGTCCTCGTCGATCTGGAGCCCGGAACCATGGACTCCGTGCGATCCGGT  329

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||||||||||||||| || ||||||||||| || |||||||| ||||||||||||
Sbjct  330  CCTTTCGGCCAGATCTTCAGACCAGACAACTTTGTCTTTGGCCAGTCTGGTGCCGGCAAC  389

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||||||||| ||||| ||||| ||||| ||| | ||||| 
Sbjct  390  AACTGGGCCAAGGGCCATTACACAGAGGGCGCTGAACTGGTTGACTCTGTGTTGGATGTG  449

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| || || |||||||| || || || ||||| || ||||||||  | 
Sbjct  450  GTGAGGAAGGAGGCAGAGTCTTGCGACTGTCTTCAGGGTTTCCAGCTGACACACTCATTG  509

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || |||||||| |||||||| ||||||||| | || ||||||
Sbjct  510  GGCGGCGGCACCGGCTCTGGCATGGGAACGCTGCTGATCTCCAAGATCAGGGAAGAGTAC  569

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| ||||| |||||||| || ||||| ||    ||||| || 
Sbjct  570  CCCGACCGAATCATGAACACCTACTCCGTTGTGCCTTCCCCCAAAGTCAGTGACACTGTA  629

Query  481  GTGG  484
            ||||
Sbjct  630  GTGG  633


>ref|XM_002609454.1| Branchiostoma floridae hypothetical protein, mRNA
Length=1362

 Score =  531 bits (588),  Expect = 2e-147
 Identities = 407/482 (85%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| || ||||| ||||||||  |  ||||| ||||||||||||||
Sbjct  58   TTCTGGGAGGTGATCTCAGACGAGCACGGCATCGACCCACCCGGCACCTACCACGGTGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              ||| || ||||||||| | ||||| || ||||||||||| ||  | ||||| ||||||
Sbjct  118  TCCGATCTTCAGCTGGAGAGGATCAACGTTTACTACAATGAAGCCACAGGTGGGAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||| | || |||||||| ||||||||||| |||||||||||||||||  |||| || 
Sbjct  178  GTGCCCAGGGCAGTCCTTGTGGATCTGGAGCCAGGCACCATGGACTCTGTCAGATCTGGT  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| |||||||| || || ||||||   ||||| || |||
Sbjct  238  CCCTTCGGACAGATCTTCAGGCCAGACAACTTCGTTTTTGGCCAGAGTGGTGCTGGTAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || |||||||||||||||||| |||| ||||||||||| ||||||
Sbjct  298  AACTGGGCTAAGGGCCACTACACAGAGGGTGCTGAGTTGGTAGACTCAGTGCTGGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||||| ||   ||| ||||||||||| |||||||| || ||||||||||| 
Sbjct  358  GTGCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACACACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| |||||||| ||||| |||||||| || ||||||||||| |||||||||
Sbjct  418  GGCGGTGGCACCGGCTCCGGCATGGGCACCCTGCTCATCTCCAAGATCCGTGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||||||||||||||||| ||| || ||||| || |||||||| |||||||| || 
Sbjct  478  CCCGACAGGATCATGAACACATTCTCAGTCGTGCCATCCCCCAAGGTATCGGACACTGTC  537

Query  481  GT  482
            ||
Sbjct  538  GT  539


>gb|EU234504.1| Mythimna separata beta-tubulin mRNA, complete cds
Length=1906

 Score =  531 bits (588),  Expect = 2e-147
 Identities = 407/482 (85%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  |||| ||||| ||||| || |||
Sbjct  69   TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACTGGCGCTTACCATGGCGAC  128

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct  129  TCAGACCTGCAGCTGGAGCGCATCAACGTTTACTACAATGAGGCCTCCGGAGGCAAGTAC  188

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||||| |||||||||||||||||||| ||||| ||||||
Sbjct  189  GTGCCCCGCGCCATCCTAGTCGATCTCGAGCCCGGCACCATGGACTCGGTGCGCTCGGGA  248

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| || ||||| ||||| || ||||| |||
Sbjct  249  CCCTTCGGACAGATCTTCCGACCTGACAACTTCGTTTTCGGACAGTCCGGAGCCGGTAAC  308

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| |||||||| ||||||||||| || ||||| ||||| || ||  | ||||| 
Sbjct  309  AACTGGGCTAAGGGTCACTACACAGAGGGCGCCGAGCTTGTGGATTCCGTCTTGGATGTC  368

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||| || || || || |||||||| ||||| ||||||||||||||||| || 
Sbjct  369  GTTCGCAAGGAAGCAGAGTCATGTGACTGCCTTCAAGGATTCCAACTCACACACTCTCTC  428

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||||||||| ||||| ||||| || || || || ||||| ||| | ||||| || 
Sbjct  429  GGCGGCGGCACTGGTTCCGGAATGGGCACACTTCTTATCTCCAAAATCAGAGAGGAATAT  488

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| || |||||||||||||| ||||| || ||||| || ||||| ||||| || 
Sbjct  489  CCCGACAGAATTATGAACACATACTCAGTTGTACCTTCGCCTAAAGTGTCAGACACAGTA  548

Query  481  GT  482
            ||
Sbjct  549  GT  550


>ref|XM_001600804.1| PREDICTED: Nasonia vitripennis tubulin beta-1 chain-like (LOC100116329), 
partial mRNA
Length=1011

 Score =  524 bits (580),  Expect = 3e-145
 Identities = 389/455 (86%), Gaps = 0/455 (0%)
 Strand=Plus/Plus

Query  28   GGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAAT  87
            ||||| ||  | || || ||||||||||||||||||||||| ||||| ||| | ||||| 
Sbjct  1    GGCATTGACCCGACTGGTGCCTACCACGGTGACAGCGACCTCCAGCTCGAGAGGATCAAC  60

Query  88   GTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTG  147
            ||||||||||||||||| ||||||||||| || |||||| | ||  ||||||| ||||||
Sbjct  61   GTGTACTACAATGAGGCCTCCGGTGGCAAATATGTGCCCAGAGCCATCCTTGTGGATCTG  120

Query  148  GAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGAC  207
            |||||||||||||||||||| ||  |||| || || ||||||||||||||| | || |||
Sbjct  121  GAGCCCGGCACCATGGACTCGGTCAGATCCGGCCCCTTCGGCCAGATCTTCCGACCGGAC  180

Query  208  AACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAG  267
            ||||| |||||||| ||||| ||||| || |||||||||||||||||||| ||||| |||
Sbjct  181  AACTTCGTGTTCGGACAGTCTGGTGCTGGTAACAACTGGGCCAAGGGTCACTACACCGAG  240

Query  268  GGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGAC  327
            ||||||||||| || |||||||| |||||||| ||||||||||| |||||   |||||||
Sbjct  241  GGTGCTGAGCTCGTAGACTCAGTCCTCGATGTCGTCCGCAAGGAAGCCGAGAGCTGCGAC  300

Query  328  TGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGA  387
            ||||| || |||||||| || || ||||| ||||| || || || || ||||||||||||
Sbjct  301  TGCCTTCAGGGCTTCCAGCTGACCCACTCGCTTGGAGGTGGTACCGGATCCGGTATGGGA  360

Query  388  ACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCG  447
            ||||| || || ||||||||||| ||||| ||||||||||||||||||||||| ||||||
Sbjct  361  ACCCTCCTCATCTCCAAGATCCGTGAGGAATACCCCGACAGGATCATGAACACCTACTCG  420

Query  448  GTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGT  482
            || || || ||||||||||| || |||||||| ||
Sbjct  421  GTCGTACCCTCGCCCAAGGTCTCAGACACCGTCGT  455


>gb|DQ833528.1| Aedes aegypti beta-4 tubulin (B4t) gene, complete cds
Length=1810

 Score =  518 bits (574),  Expect = 1e-143
 Identities = 404/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || ||||| ||||||||||| |||||||| ||||| |||||||| |||||||| ||||||
Sbjct  514  TTTTGGGAAATCATCTCCGACGAGCATGGAATCGACGCCACCGGAGCCTACCATGGTGAC  573

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               |||||||||||||| |||||||| |||||||||||||| || ||||| ||||| |||
Sbjct  574  TCAGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAAGCCTCCGGCGGCAAATAC  633

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || || || || ||||||||||| ||||| ||||||||||| || || ||||| 
Sbjct  634  GTGCCACGTGCCGTGCTAGTCGATCTGGAACCCGGTACCATGGACTCCGTCCGCTCGGGG  693

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | |  |||||||| || ||||| ||||| |||||||| |||
Sbjct  694  CCATTCGGACAGATCTTCCGCCTGGACAACTTCGTCTTCGGACAGTCCGGTGCCGGTAAC  753

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||| || ||||| || |||||| | || |||
Sbjct  754  AACTGGGCCAAGGGACACTACACCGAGGGTGCCGAACTGGTCGATTCAGTGTTGGACGTT  813

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||| || |||||||| ||||||||||||||||| ||||| || || ||||| || 
Sbjct  814  GTCCGCAAAGAAGCCGAATCGTGCGACTGCCTGCAAGGATTCCAGCTGACCCACTCGCTC  873

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || |||||||||||||| || ||| |||| || || |||||||| || |||
Sbjct  874  GGAGGTGGTACCGGCTCCGGTATGGGCACACTGTTGATCTCGAAAATCCGCGAAGAATAC  933

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| ||||| || ||||| || || || |||||||| 
Sbjct  934  CCCGACAGAATCATGAACACATACTCAGTTGTCCCCTCGCCAAAAGTATCAGACACCGTC  993

Query  481  GT  482
            ||
Sbjct  994  GT  995


>gb|EF207965.1| Heliconius erato beta-tubulin-like (Btub) mRNA, complete sequence
Length=1907

 Score =  517 bits (572),  Expect = 4e-143
 Identities = 405/483 (84%), Gaps = 1/483 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||| || ||||| ||||||||  |||| ||||||||||||||||||
Sbjct  133  TTCTGGGAGATCATCTCTGACGAGCACGGCATCGACCCCACTGGCGCCTACCACGGTGAC  192

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||  ||||||| |||||||||||||| |||||||||||||| ||||| |||||||||
Sbjct  193  TCGGATTTGCAGCTCGAGCGCATCAATGTATACTACAATGAGGCCTCCGGCGGCAAGTAC  252

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGG-ACTCTGTGCGATCGGG  179
            |||||||||||  |||| |||||  |||||||||||||||||| ||||||| || |||||
Sbjct  253  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGGACTCTGTCCGCTCGGG  312

Query  180  ACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAA  239
            ||||||||| ||||||||| | ||||||||||| |||||||| ||||| ||||| || ||
Sbjct  313  ACCTTTCGGACAGATCTTCCGCCCCGACAACTTCGTGTTCGGACAGTCTGGTGCTGGTAA  372

Query  240  CAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGT  299
            ||||||||||||||| |||||||| ||||| || ||||| || ||||||||  | || ||
Sbjct  373  CAACTGGGCCAAGGGACATTACACTGAGGGCGCCGAGCTCGTAGACTCAGTTTTAGACGT  432

Query  300  TGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCT  359
             || || ||||| || || || || |||||||| ||||| ||||||||||||||||||||
Sbjct  433  CGTACGTAAGGAAGCAGAGTCATGTGACTGCCTCCAAGGTTTCCAACTCACACACTCCCT  492

Query  360  TGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTA  419
             || || || || || ||||||||||| || || || |||||||| ||| | || || ||
Sbjct  493  CGGTGGTGGTACCGGATCCGGTATGGGTACACTTCTTATTTCCAAAATCAGAGAAGAATA  552

Query  420  CCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGT  479
            ||| ||||| || |||||||||||||| ||||| || ||||| || ||||| || || ||
Sbjct  553  CCCTGACAGAATTATGAACACATACTCAGTTGTACCCTCGCCTAAAGTGTCAGATACAGT  612

Query  480  TGT  482
             ||
Sbjct  613  AGT  615


>dbj|AK377493.1| Bombyx mori mRNA, clone: fwd-31A24
Length=1970

 Score =  515 bits (570),  Expect = 1e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  156  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  215

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  216  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  275

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||| |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  276  GTGCCCCGCGCTATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  335

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  336  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  395

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  396  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  455

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  456  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  515

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  516  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  575

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || |  ||||||||||| || 
Sbjct  576  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTANAGTGTCGGACACAGTA  635

Query  481  GT  482
            ||
Sbjct  636  GT  637


>ref|XM_003461107.1| PREDICTED: Cavia porcellus tubulin, beta 4 (Tubb4), mRNA
Length=1386

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||||||  |||||||| |||||||||| |||
Sbjct  58   TTCTGGGAGGTGATCAGCGACGAGCATGGCATCGACCCCACCGGCACCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||||||||||||||| |||||||| |||||||| |||||  | || || || |||
Sbjct  118  AGTGACCTGCAGCTGGAGCGGATCAATGTCTACTACAACGAGGCCACGGGAGGGAATTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| || || || || || ||||||||||||||||||||||| || || || || 
Sbjct  178  GTGCCCCGAGCGGTGCTGGTGGACCTGGAGCCCGGCACCATGGACTCCGTCCGCTCAGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||| |||||||||||||| || || ||||||
Sbjct  238  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTCGTGTTCGGCCAGTCTGGGGCTGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||||||||| || |||||||||||| | || || || || 
Sbjct  298  AACTGGGCAAAGGGCCACTACACAGAGGGCGCGGAGCTGGTGGACGCCGTCCTGGACGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||||| ||   ||| ||||| ||||| |||||||| ||||||||||| || 
Sbjct  358  GTTCGGAAGGAGGCGGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTCACACACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || ||||| ||||| || ||||| |||||||| ||   ||||||||||||||||| |
Sbjct  418  GGGGGTGGCACCGGCTCGGGCATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTTC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |   || ||||| ||||||||||||||||||||||| 
Sbjct  478  CCTGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>dbj|AK378049.1| Bombyx mori mRNA, clone: ffbm37A20
Length=3060

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1     TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
             |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  1167  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  1226

Query  61    AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  1227  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  1286

Query  121   GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  1287  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  1346

Query  181   CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  1347  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  1406

Query  241   AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
             |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  1407  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  1466

Query  301   GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
             || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  1467  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  1526

Query  361   GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
             ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  1527  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  1586

Query  421   CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
             || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  1587  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  1646

Query  481   GT  482
             ||
Sbjct  1647  GT  1648


>dbj|AK377518.1| Bombyx mori mRNA, clone: fwd-33B15
Length=2011

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  201  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  260

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  261  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  320

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  321  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  380

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  381  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  440

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || ||||||||  | || || 
Sbjct  441  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGACTCAGTTTTAGACGTC  500

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  501  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  560

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  561  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  620

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || || |||||||| || ||||| || || || || ||||||||||| || 
Sbjct  621  CCTGACAGAATAATCAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  680

Query  481  GT  482
            ||
Sbjct  681  GT  682


>ref|NM_001194791.1| Macaca mulatta tubulin, beta 4B class IVb (TUBB2C), mRNA
Length=1619

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  115  TTCTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  174

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||||||||| ||||||||||| |||||  |||| |||||||||
Sbjct  175  AGCGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGCGGCAAGTAC  234

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  235  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  294

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  295  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCTGGGAAC  354

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  355  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  414

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  415  GTGAGGAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGATTCCAGCTGACCCACTCCCTG  474

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  475  GGTGGGGGGACGGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  534

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || ||||| |||||||||||||| ||||| || 
Sbjct  535  CCAGACAGGATCATGAACACGTTCAGTGTGGTGCCTTCGCCCAAGGTGTCAGACACAGTG  594

Query  481  GTGG  484
            ||||
Sbjct  595  GTGG  598


>ref|XM_002799911.1| PREDICTED: Macaca mulatta tubulin beta-2C chain-like, transcript 
variant 4 (LOC100425863), mRNA
Length=1656

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  152  TTCTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  211

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||||||||| ||||||||||| |||||  |||| |||||||||
Sbjct  212  AGCGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGCGGCAAGTAC  271

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  272  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  331

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  332  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCTGGGAAC  391

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  392  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  451

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  452  GTGAGGAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGATTCCAGCTGACCCACTCCCTG  511

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  512  GGTGGGGGGACGGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  571

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || ||||| |||||||||||||| ||||| || 
Sbjct  572  CCAGACAGGATCATGAACACGTTCAGTGTGGTGCCTTCGCCCAAGGTGTCAGACACAGTG  631

Query  481  GTGG  484
            ||||
Sbjct  632  GTGG  635


>ref|XM_002799910.1| PREDICTED: Macaca mulatta tubulin beta-2C chain-like, transcript 
variant 3 (LOC100425863), mRNA
Length=1582

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  78   TTCTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  137

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||||||||| ||||||||||| |||||  |||| |||||||||
Sbjct  138  AGCGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGCGGCAAGTAC  197

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  198  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  257

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  258  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCTGGGAAC  317

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  318  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  377

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  378  GTGAGGAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGATTCCAGCTGACCCACTCCCTG  437

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  438  GGTGGGGGGACGGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  497

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || ||||| |||||||||||||| ||||| || 
Sbjct  498  CCAGACAGGATCATGAACACGTTCAGTGTGGTGCCTTCGCCCAAGGTGTCAGACACAGTG  557

Query  481  GTGG  484
            ||||
Sbjct  558  GTGG  561


>ref|XM_002799908.1| PREDICTED: Macaca mulatta tubulin beta-2C chain-like, transcript 
variant 1 (LOC100425863), mRNA
Length=1647

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  143  TTCTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  202

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||||||||| ||||||||||| |||||  |||| |||||||||
Sbjct  203  AGCGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGCGGCAAGTAC  262

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  263  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  322

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  323  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCTGGGAAC  382

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  383  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  442

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  443  GTGAGGAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGATTCCAGCTGACCCACTCCCTG  502

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  503  GGTGGGGGGACGGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  562

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || ||||| |||||||||||||| ||||| || 
Sbjct  563  CCAGACAGGATCATGAACACGTTCAGTGTGGTGCCTTCGCCCAAGGTGTCAGACACAGTG  622

Query  481  GTGG  484
            ||||
Sbjct  623  GTGG  626


>gb|EF432510.1| Chlorophyte sp. W-c clone B6 beta tubulin (btub) mRNA, partial 
cds
Length=1128

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| || ||||||| ||||| ||||||||  |||||||| ||||||| ||||||
Sbjct  34   TTCTGGGAGGTCGTCTCCGACGAGCACGGCATCGACCCCACCGGCACCTACCATGGTGAC  93

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              ||| || ||||||||||||||||| || |||| ||| |||||  |||| |||   |||
Sbjct  94   TCCGATCTTCAGCTGGAGCGCATCAACGTCTACTTCAACGAGGCCACCGGCGGCCGTTAC  153

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  ||||  | || |||||||||||||||||||||||||| || || || 
Sbjct  154  GTGCCCCGCGCCATCCTGATGGACCTGGAGCCCGGCACCATGGACTCTGTCCGCTCCGGC  213

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||||||| | || |||||||| |||||||||||| | || |||||||||
Sbjct  214  CCCTACGGCCAGATCTTCCGCCCTGACAACTTCGTGTTCGGCCAGACCGGCGCCGGCAAC  273

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||||||||||||| | ||||| ||||| || || 
Sbjct  274  AACTGGGCCAAGGGGCACTACACCGAGGGTGCTGAGCTGATTGACTCCGTGCTGGACGTC  333

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||| ||   ||||||||||||||| ||||||||  ||   ||||| || 
Sbjct  334  GTGCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGCTTCCAGGTCTGCCACTCGCTG  393

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| ||||| || ||||| |||||||| || |||||||| ||||||||||||
Sbjct  394  GGTGGCGGCACCGGCTCGGGCATGGGCACCCTGCTCATCTCCAAGATTCGCGAGGAGTAC  453

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||  ||| | |||||| ||||||||||||||||||||||||||||| 
Sbjct  454  CCCGACCGCATGATGCTCACCTTCTCGGTGGTGCCGTCGCCCAAGGTGTCGGACACCGTG  513

Query  481  GTGG  484
            ||||
Sbjct  514  GTGG  517


>ref|XM_002096902.1| Drosophila yakuba GE24779 (Dyak\GE24779), mRNA
Length=1341

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||||| ||||||||  |||| || ||||| ||  | ||| | || || 
Sbjct  58   TTCTGGGAGGTCATCTCGGATGAGCACTGCATAGACGCCACTGGAACGTACTATGGCGAT  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || ||||||||||||||||||||||||||||||||||| ||  |||||| |||||| 
Sbjct  118  AGTGATCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAAGCCACCGGTGCCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||  ||||||| || ||||| |||||||||||||| || || || || || 
Sbjct  178  GTTCCGCGTGCCATCCTTGTGGACCTGGAACCCGGCACCATGGATTCCGTTCGCTCCGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || || ||||||||| |||| ||||||||||| |||||||||||||| || ||||||
Sbjct  238  GCCTTTGGTCAGATCTTCCGGCCGGACAACTTTGTCTTCGGCCAGTCGGGGGCAGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||  | ||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAACTGGTGGACTCCGTCTTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| | ||   |||||| ||||| || || ||||| || || ||||| || 
Sbjct  358  GTGCGAAAGGAGTCTGAGGGCTGCGATTGCCTTCAGGGATTCCAGCTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct  418  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGCTGATCTCAAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |||||| ||||| |||||||||||||| || || || 
Sbjct  478  CCCGACCGCATCATGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_001694020.1| Chlamydomonas reinhardtii beta tubulin 1 (TUB1) mRNA, complete 
cds
Length=2043

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| || ||||||| ||||| ||||||||  |||||||| ||||||| || |||
Sbjct  208  TTCTGGGAGGTCGTCTCCGACGAGCACGGCATCGACCCCACCGGCACCTACCATGGCGAC  267

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||||||||||||||||||||| ||||||| ||| |||||  |||| |||   |||
Sbjct  268  TCCGACCTGCAGCTGGAGCGCATCAACGTGTACTTCAACGAGGCCACCGGCGGCCGCTAC  327

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  ||||  | || |||||||||||||||||||| || ||||| ||||| 
Sbjct  328  GTGCCCCGCGCCATCCTGATGGACCTGGAGCCCGGCACCATGGATTCCGTGCGCTCGGGC  387

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||| ||| | || |||||||| |||||||||||| | ||||||||||||
Sbjct  388  CCCTACGGCCAGATTTTCCGCCCGGACAACTTCGTGTTCGGCCAGACCGGTGCCGGCAAC  447

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| ||||||||| | ||||| ||||| || || 
Sbjct  448  AACTGGGCCAAGGGCCACTACACCGAGGGCGCTGAGCTGATTGACTCCGTGCTGGACGTC  507

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||| ||   ||||||||||||||| ||||||||  |    ||||| || 
Sbjct  508  GTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGCTTCCAGGTTTGCCACTCTCTG  567

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || |||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||
Sbjct  568  GGTGGTGGCACTGGCTCCGGCATGGGCACCCTGCTGATCTCCAAGATCCGTGAGGAGTAC  627

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||   || | |||||| ||||| |||||||||||||| |||||||| 
Sbjct  628  CCCGACCGCATGATGCTGACCTTCTCGGTCGTGCCCTCGCCCAAGGTGTCCGACACCGTG  687

Query  481  GTGG  484
            ||||
Sbjct  688  GTGG  691


>ref|XM_001693945.1| Chlamydomonas reinhardtii beta tubulin 2 (TUB2) mRNA, complete 
cds
Length=1915

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| || ||||||| ||||| ||||||||  |||||||| ||||||| || |||
Sbjct  182  TTCTGGGAGGTCGTCTCCGACGAGCACGGCATCGACCCCACCGGCACCTACCATGGCGAC  241

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| ||||||| ||| |||||  ||||||||   |||
Sbjct  242  TCAGACCTGCAGCTGGAGCGCATCAACGTGTACTTCAACGAGGCCACCGGTGGCCGCTAC  301

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  ||||  | || |||||||| |||||||||||||| || || ||||| 
Sbjct  302  GTGCCCCGCGCCATCCTGATGGACCTGGAGCCTGGCACCATGGACTCCGTCCGCTCGGGC  361

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||||||| | || |||||||| |||||||||||| | ||||||||||||
Sbjct  362  CCCTACGGCCAGATCTTCCGCCCGGACAACTTCGTGTTCGGCCAGACCGGTGCCGGCAAC  421

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| ||||||||| | ||||| ||||| || || 
Sbjct  422  AACTGGGCCAAGGGCCACTACACCGAGGGCGCTGAGCTGATTGACTCCGTGCTGGACGTC  481

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||| ||   ||||||||||||||| ||||||||  ||   ||||| || 
Sbjct  482  GTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGCTTCCAGGTCTGCCACTCTCTG  541

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| |||||||| ||||| ||||||||||| ||||||||||| |||||||||
Sbjct  542  GGTGGCGGCACCGGCTCCGGCATGGGCACCCTGCTGATCTCCAAGATCCGTGAGGAGTAC  601

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||   || | |||||| ||||| |||||||||||||| ||||| || 
Sbjct  602  CCCGACCGCATGATGCTGACCTTCTCGGTCGTGCCCTCGCCCAAGGTGTCCGACACGGTG  661

Query  481  GTGG  484
            ||||
Sbjct  662  GTGG  665


>ref|XM_001655975.1| Aedes aegypti tubulin beta chain partial mRNA
Length=2376

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || ||||| ||||||||||| || ||||| ||||| |||||||| |||||||| ||||||
Sbjct  311  TTTTGGGAAATCATCTCCGACGAACATGGAATCGACGCCACCGGAGCCTACCATGGTGAC  370

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               |||||||||||||| |||||||| |||||||||||||| || ||||| ||||| |||
Sbjct  371  TCAGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAAGCCTCCGGCGGCAAATAC  430

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || || || || ||||||||||| ||||| ||||||||||| || || ||||| 
Sbjct  431  GTGCCACGTGCCGTGCTAGTCGATCTGGAACCCGGTACCATGGACTCCGTCCGCTCGGGG  490

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| || ||||| ||||| |||||||| |||
Sbjct  491  CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTCTTCGGACAGTCCGGTGCCGGTAAC  550

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||| || ||||| || |||||| | || |||
Sbjct  551  AACTGGGCCAAGGGACACTACACCGAGGGTGCCGAACTGGTCGATTCAGTGTTGGACGTT  610

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||| || |||||||| ||||||||||||||||| ||||| || || ||||| || 
Sbjct  611  GTCCGCAAAGAAGCCGAATCGTGCGACTGCCTGCAAGGATTCCAGCTGACCCACTCGCTC  670

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || |||||||||||||| || ||| |||| || || |||||||| || || 
Sbjct  671  GGAGGTGGTACCGGCTCCGGTATGGGCACACTGTTGATCTCGAAAATCCGCGAAGAATAT  730

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||||||| ||||| || ||||| || || || |||||||| 
Sbjct  731  CCCGACAGAATCATGAACACATACTCAGTTGTCCCCTCGCCAAAAGTATCAGACACCGTC  790

Query  481  GT  482
            ||
Sbjct  791  GT  792


>dbj|AB170261.1| Macaca fascicularis brain cDNA clone: QbsB-11061, similar to 
human tubulin, beta, 2 (TUBB2), mRNA, RefSeq: NM_006088.3
Length=1521

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  129  TTCTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  188

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||||||||| ||||||||||| |||||  |||| |||||||||
Sbjct  189  AGCGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGCGGCAAGTAC  248

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  249  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  308

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  309  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCTGGGAAC  368

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  369  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  428

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  429  GTGAGGAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGATTCCAGCTGACCCACTCCCTG  488

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  489  GGTGGGGGGACGGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  548

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || ||||| |||||||||||||| ||||| || 
Sbjct  549  CCAGACAGGATCATGAACACGTTCAGTGTGGTGCCTTCGCCCAAGGTGTCAGACACAGTG  608

Query  481  GTGG  484
            ||||
Sbjct  609  GTGG  612


>gb|EF064248.1| Blastocladiella emersonii beta-tubulin mRNA, complete cds
Length=1667

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||| ||||| ||||||||  ||| |||  ||||||| || |||
Sbjct  111  TTCTGGGAGGTCATCTCCGACGAGCACGGCATCGACCCCATCGGTACCTACCATGGCGAC  170

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||| ||||| ||||||||||| || |||||||| |||||  |||| |||||||||
Sbjct  171  TCGGACCTCCAGCTCGAGCGCATCAACGTCTACTACAACGAGGCCACCGGCGGCAAGTAC  230

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || |||||||| || || ||||| || |||||||| ||||||||||| || ||  | || 
Sbjct  231  GTCCCCCGCGCCGTGCTCGTCGACCTCGAGCCCGGAACCATGGACTCGGTCCGCGCCGGC  290

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||| | ||| | |||||||||||||| ||||||||||| || |||||||||
Sbjct  291  CCCTTCGGCCAGCTGTTCCGCCCCGACAACTTTGTCTTCGGCCAGTCTGGCGCCGGCAAC  350

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||| ||||| || ||||| || |||||||| 
Sbjct  351  AACTGGGCCAAGGGCCACTACACCGAGGGTGCCGAGCTCGTCGACTCTGTCCTCGATGTC  410

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||| || |||||||||||||| ||||||||  |||| ||||| || 
Sbjct  411  GTGCGCAAGGAGGCCGAGTCGTGCGACTGCCTGCAGGGCTTCCAGATCACGCACTCGCTG  470

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || ||  |||| ||||| || ||||| || |||||||||||||||||||||
Sbjct  471  GGCGGTGGTACCGGTGCCGGCATGGGCACGCTGCTCATCTCCAAGATCCGCGAGGAGTAC  530

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||  ||| | |||||| |||||||||||||||||||||||||| |||
Sbjct  531  CCCGACCGCATGATGTGCACCTTCTCGGTGGTGCCGTCGCCCAAGGTGTCGGACACGGTT  590

Query  481  GT  482
            ||
Sbjct  591  GT  592


>gb|DQ833529.1| Aedes aegypti beta-1 tubulin (B1t) gene, partial cds
Length=2303

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1     TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
             || ||||| ||||||||||| || ||||| ||||| |||||||| |||||||| ||||||
Sbjct  707   TTTTGGGAAATCATCTCCGACGAACATGGAATCGACGCCACCGGAGCCTACCATGGTGAC  766

Query  61    AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                |||||||||||||| |||||||| |||||||||||||| || ||||| ||||| |||
Sbjct  767   TCAGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAAGCCTCCGGCGGCAAATAC  826

Query  121   GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             ||||| || || || || ||||||||||| ||||| ||||||||||| || || ||||| 
Sbjct  827   GTGCCACGTGCCGTGCTAGTCGATCTGGAACCCGGTACCATGGACTCCGTCCGCTCGGGG  886

Query  181   CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             || ||||| ||||||||| | || |||||||| || ||||| ||||| |||||||| |||
Sbjct  887   CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTCTTCGGACAGTCCGGTGCCGGTAAC  946

Query  241   AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
             |||||||||||||| || ||||| |||||||| || ||||| || |||||| | || |||
Sbjct  947   AACTGGGCCAAGGGACACTACACCGAGGGTGCCGAACTGGTCGATTCAGTGTTGGACGTT  1006

Query  301   GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
             |||||||| || |||||||| ||||||||||||||||| ||||| || || ||||| || 
Sbjct  1007  GTCCGCAAAGAAGCCGAATCGTGCGACTGCCTGCAAGGATTCCAGCTGACCCACTCGCTC  1066

Query  361   GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
             || || || || |||||||||||||| || ||| |||| || || |||||||| || || 
Sbjct  1067  GGAGGTGGTACCGGCTCCGGTATGGGCACACTGTTGATCTCGAAAATCCGCGAAGAATAT  1126

Query  421   CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
             |||||||| ||||||||||||||||| ||||| || ||||| || || || |||||||| 
Sbjct  1127  CCCGACAGAATCATGAACACATACTCAGTTGTCCCCTCGCCAAAAGTATCAGACACCGTC  1186

Query  481   GT  482
             ||
Sbjct  1187  GT  1188


>gb|AY770744.1| Drosophila teissieri beta 2 tubulin mRNA, complete cds
Length=1341

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 404/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||||| ||||||||  |||| || ||||| ||  | ||| | || || 
Sbjct  58   TTCTGGGAGGTCATCTCGGATGAGCACTGCATAGACGCCACTGGAACGTACTATGGCGAT  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || ||||||||||||||||||||||||||||||||||| ||  |||||| |||||| 
Sbjct  118  AGTGATCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAAGCCACCGGTGCCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||  ||||||| || ||||| |||||||||||||| || || || || || 
Sbjct  178  GTTCCGCGTGCCATCCTTGTGGACCTGGAACCCGGCACCATGGATTCCGTTCGCTCTGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || || ||||||||| |||| ||||||||||| |||||||||||||| || ||||||
Sbjct  238  GCCTTTGGTCAGATCTTCCGGCCGGACAACTTTGTCTTCGGCCAGTCGGGGGCAGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||  | ||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAACTGGTGGACTCCGTCTTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| | ||   |||||| ||||| || || ||||| || || ||||| || 
Sbjct  358  GTGCGAAAGGAGTCTGAGGGCTGCGATTGCCTTCAGGGATTCCAGCTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct  418  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGCTGATCTCAAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |||||| ||||| |||||||||||||| || || || 
Sbjct  478  CCCGACCGCATCATGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCTGATACTGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|NM_001043499.1| Bombyx mori beta-tubulin (Tub2), mRNA
 dbj|AB072308.1| Bombyx mori bmtub2 mRNA for beta-tubulin, complete cds
Length=1954

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  129  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  188

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  189  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  248

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  249  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  308

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  309  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  368

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  369  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  428

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  429  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  488

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  489  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  548

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  549  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  608

Query  481  GT  482
            ||
Sbjct  609  GT  610


>dbj|AB011069.1| Bombyx mori mRNA for beta-tubulin, complete cds
Length=1943

 Score =  513 bits (568),  Expect = 5e-142
 Identities = 403/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  150  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  209

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  210  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  269

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  270  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  329

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  330  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  389

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  390  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  449

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  450  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  509

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  510  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  569

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  570  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  629

Query  481  GT  482
            ||
Sbjct  630  GT  631


>dbj|AK377475.1| Bombyx mori mRNA, clone: fwd-29C23
Length=1969

 Score =  509 bits (564),  Expect = 6e-141
 Identities = 402/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  156  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  215

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| ||  |||| |||||||||
Sbjct  216  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCCCCGGCGGCAAGTAC  275

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  276  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  335

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  336  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  395

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  396  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  455

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  456  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  515

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  516  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  575

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  576  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  635

Query  481  GT  482
            ||
Sbjct  636  GT  637


>dbj|AK377309.1| Bombyx mori mRNA, clone: fwd-11J16
Length=2015

 Score =  509 bits (564),  Expect = 6e-141
 Identities = 402/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  190  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  249

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  250  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  309

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  310  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  369

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  370  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  429

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  430  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  489

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||| | || 
Sbjct  490  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACCCGCTC  549

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  550  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  609

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  610  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  669

Query  481  GT  482
            ||
Sbjct  670  GT  671


>gb|AF030547.1|AF030547 Manduca sexta beta-1 tubulin mRNA, complete cds
Length=1937

 Score =  509 bits (564),  Expect = 6e-141
 Identities = 402/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||||||||||| || ||||||||||||||  |||||||||| ||||| || |||
Sbjct  129  TTCTGGGAGATCATCTCTGACGAGCATGGCATCGACCCCACCGGCGCTTACCATGGCGAC  188

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||
Sbjct  189  TCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAATGAGGCCTCCGGCGGCAAGTAC  248

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  |||| || || || ||||||||||||||||||||||| || || |||
Sbjct  249  GTGCCGCGCGCCATCCTCGTGGACCTCGAGCCCGGCACCATGGACTCTGTCCGCTCCGGA  308

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || ||||| |||
Sbjct  309  CCTTTCGGACAGATCTTCCGCCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGTAAC  368

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || ||||| || ||||| ||  | || || 
Sbjct  369  AACTGGGCCAAGGGACACTACACAGAGGGCGCCGAGCTTGTCGACTCGGTCTTAGACGTC  428

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| ||||||||||| || || ||||||||||||||||| || 
Sbjct  429  GTACGTAAGGAAGCAGAATCATGCGACTGCCTCCAGGGATTCCAACTCACACACTCGCTC  488

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||| || || ||||| ||||| ||||| || || ||||| ||| | || || |||
Sbjct  489  GGCGGCGGTACCGGTTCCGGAATGGGCACCCTCCTTATCTCCAAAATCAGGGAAGAATAC  548

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| || ||||||||||| || ||||| || || ||||| ||||| || || || 
Sbjct  549  CCCGACAGAATTATGAACACATATTCAGTTGTACCATCACCCAAAGTGTCTGATACAGTA  608

Query  481  GT  482
            ||
Sbjct  609  GT  610


>ref|XM_002092765.1| Drosophila yakuba GE14397 (Dyak\GE14397), mRNA
Length=1365

 Score =  508 bits (562),  Expect = 2e-140
 Identities = 412/502 (83%), Gaps = 18/502 (3%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||   ||  |||  ||||   || |||
Sbjct  58   TTCTGGGAGATCATCTCCGAGGAGCACGGCATCGACAGCAATGGCATCTACGTGGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTC----------CGG  110
            ||||||||||||||||||||| ||| ||| |||||||| ||||| ||          |||
Sbjct  118  AGCGACCTGCAGCTGGAGCGCGTCAGTGTCTACTACAACGAGGCATCGGCAGTCACGCGG  177

Query  111  T--------GGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATG  162
            |        ||||||||||||||| | ||  ||||  ||||||||||||| || ||||||
Sbjct  178  TCGTCGGGCGGCAAGTACGTGCCCAGGGCCATCCTGCTCGATCTGGAGCCGGGAACCATG  237

Query  163  GACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGC  222
            || || ||||| || || || | ||||||| ||||| |||| |||||||| |||| ||| 
Sbjct  238  GAGTCGGTGCGCTCCGGTCCCTACGGCCAGCTCTTCCGGCCGGACAACTTCGTGTACGGA  297

Query  223  CAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTG  282
            |||||||| || ||||||||||||||||||||||| ||||| ||||| || |||||||||
Sbjct  298  CAGTCGGGAGCGGGCAACAACTGGGCCAAGGGTCACTACACCGAGGGCGCCGAGCTGGTG  357

Query  283  GACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTC  342
            |||   |||||||| || ||||||||||||  |||   ||||||||||||||| ||||||
Sbjct  358  GACCATGTGCTCGACGTGGTCCGCAAGGAGTGCGAGAACTGCGACTGCCTGCAGGGCTTC  417

Query  343  CAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCC  402
            ||||| || ||||| || |||||||||||||||||||| ||||| ||||||||||| || 
Sbjct  418  CAACTGACGCACTCGCTGGGCGGCGGCACTGGCTCCGGAATGGGCACCCTGCTGATCTCG  477

Query  403  AAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCC  462
            |||||||||||||||||||||||| | ||||||||||| |||||||| ||||| ||||| 
Sbjct  478  AAGATCCGCGAGGAGTACCCCGACCGCATCATGAACACCTACTCGGTGGTGCCCTCGCCG  537

Query  463  AAGGTGTCGGACACCGTTGTGG  484
            ||||| ||||||||||| ||||
Sbjct  538  AAGGTCTCGGACACCGTGGTGG  559


>gb|AY226059.1| Proterospongia sp. ATCC 50818 beta-tubulin mRNA, partial cds
Length=1161

 Score =  508 bits (562),  Expect = 2e-140
 Identities = 404/483 (84%), Gaps = 2/483 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGG-TGA  59
            ||||||||| |||||||||| ||||| ||||| ||  | || ||| | | |||||| |||
Sbjct  13   TTCTGGGAGGTCATCTCCGACGAGCACGGCATTGACCCAACGGGCAC-TGCCACGGGTGA  71

Query  60   CAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTA  119
            |   ||||| ||||| ||||||||||| || |||||||| |||||  |||| ||||||||
Sbjct  72   CTCGGACCTCCAGCTCGAGCGCATCAACGTCTACTACAACGAGGCCACCGGCGGCAAGTA  131

Query  120  CGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGG  179
             ||||||||||| ||||| |||||||||||||||||||| |||||||| || || || ||
Sbjct  132  TGTGCCCCGCGCCGTCCTCGTCGATCTGGAGCCCGGCACGATGGACTCCGTCCGCTCCGG  191

Query  180  ACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAA  239
             || | ||||||| ||||| | |||||||||||||| ||||||||||| || ||||||||
Sbjct  192  TCCCTACGGCCAGCTCTTCCGCCCCGACAACTTTGTCTTCGGCCAGTCTGGCGCCGGCAA  251

Query  240  CAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGT  299
            ||||||||||||||| || ||||| ||||| || ||||| || ||| | || ||||| ||
Sbjct  252  CAACTGGGCCAAGGGCCACTACACCGAGGGCGCCGAGCTTGTCGACGCCGTCCTCGACGT  311

Query  300  TGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCT  359
            ||||||||||||||||||   |||||||||||| || |||||||| ||||||||||||||
Sbjct  312  TGTCCGCAAGGAGGCCGAGGGCTGCGACTGCCTTCAGGGCTTCCAGCTCACACACTCCCT  371

Query  360  TGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTA  419
             || ||||| || ||||| || ||||| || ||||| || ||||||||||||||||||||
Sbjct  372  CGGTGGCGGTACCGGCTCTGGCATGGGCACGCTGCTCATCTCCAAGATCCGCGAGGAGTA  431

Query  420  CCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGT  479
            ||||||| | ||||||  ||| | ||| || ||||| || ||||||||||| ||||||||
Sbjct  432  CCCCGACCGCATCATGTGCACCTTCTCCGTCGTGCCTTCCCCCAAGGTGTCCGACACCGT  491

Query  480  TGT  482
             ||
Sbjct  492  CGT  494


>emb|AL832497.1| Homo sapiens mRNA; cDNA DKFZp686J1451 (from clone DKFZp686J1451)
Length=1641

 Score =  508 bits (562),  Expect = 2e-140
 Identities = 403/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||   ||||| |||||||||||  |||||||| |||||||||| |||
Sbjct  193  TTCTGGGAGGTGATCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGGGGAC  252

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  253  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  312

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  313  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  372

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  373  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  432

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  433  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  492

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  493  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  552

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  553  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  612

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  613  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  672

Query  481  GTGG  484
            ||||
Sbjct  673  GTGG  676


>dbj|AK380732.1| Bombyx mori mRNA, clone: fufe12I11
Length=2038

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 401/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  || |||| |||||||| || |||
Sbjct  222  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCGCCGGTGCCTACCATGGGGAC  281

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  282  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  341

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  342  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  401

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  402  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  461

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  462  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  521

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  522  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  581

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  582  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  641

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || |||||||| || || ||||| || || || || ||||||||||| || 
Sbjct  642  CCTGACAGAATAATGAACACGTATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  701

Query  481  GT  482
            ||
Sbjct  702  GT  703


>dbj|AK377513.1| Bombyx mori mRNA, clone: fwd-32M22
Length=1975

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 401/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  156  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  215

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||  ||| |||||
Sbjct  216  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGACGGCGAGTAC  275

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  276  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  335

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  336  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  395

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  396  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  455

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  456  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  515

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  516  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  575

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  576  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  635

Query  481  GT  482
            ||
Sbjct  636  GT  637


>dbj|AK377476.1| Bombyx mori mRNA, clone: fwd-29D19
Length=2003

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 401/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || |||
Sbjct  178  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGAC  237

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  238  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  297

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||  |||||  ||||||||||||||||||||||||| || || |||
Sbjct  298  GTGCCCCGCGCCATCCCCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  357

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  358  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  417

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || |  
Sbjct  418  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGCC  477

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  478  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  537

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  538  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  597

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct  598  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  657

Query  481  GT  482
            ||
Sbjct  658  GT  659


>dbj|AK377425.1| Bombyx mori mRNA, clone: fwd-23C23
Length=2006

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 401/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||||||||||||||| ||||| ||||||||  || |||| |||||||| || |||
Sbjct  190  TTCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCGCCGGTGCCTACCATGGGGAC  249

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| |||||||||||||||| ||||||||||| || ||||| |||||||||
Sbjct  250  TCTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTAC  309

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  |||| |||||  ||||||||||||||||||||||||| || || |||
Sbjct  310  GTGCCCCGCGCCATCCTCGTCGACTTGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  369

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  370  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  429

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  430  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  489

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  490  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  549

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  550  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  609

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || |||||||| || || ||||| || || || || ||||||||||| || 
Sbjct  610  CCTGACAGAATAATGAACACGTATTCAGTTGTACCATCACCTAAAGTGTCGGACACAGTA  669

Query  481  GT  482
            ||
Sbjct  670  GT  671


>ref|NM_001246378.1| Pan troglodytes tubulin, beta 2C (TUBB2C), mRNA
 dbj|AK306296.1| Pan troglodytes mRNA for tubulin beta-2C chain, complete cds, 
clone: PtsC-51-5_A01
Length=1577

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  129  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  188

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  189  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  248

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  249  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  308

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  309  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  368

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  369  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  428

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  429  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  488

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  489  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  548

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  549  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  608

Query  481  GTGG  484
            ||||
Sbjct  609  GTGG  612


>gb|HQ447292.1| Synthetic construct Homo sapiens clone IMAGE:100070603; CCSB002550_03 
tubulin, beta 2C (TUBB2C) gene, encodes complete protein
Length=1437

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  108  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  167

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  168  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  227

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  228  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  287

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  288  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  347

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  348  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  407

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  408  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  467

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  468  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  527

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  528  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  587

Query  481  GTGG  484
            ||||
Sbjct  588  GTGG  591


>dbj|AB491615.1| Oltmannsiellopsis viridis Btub mRNA for beta-tubulin, partial 
cds, strain: NIES-360
Length=1190

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| || | | ||||||||| ||||||||  |||| ||| ||||||||||||||
Sbjct  37   TTCTGGGAGGTCGTTTGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGTGAC  96

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||||||||||||||| ||||||| ||| |||||  |||| ||    |||
Sbjct  97   TCCGACCTCCAGCTGGAGCGCATCAACGTGTACTTCAACGAGGCCACCGGCGGTCGCTAC  156

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || ||  | || || |||||||| ||||||||||| ||||| || || 
Sbjct  157  GTGCCCCGCGCCGTGCTGATGGACCTCGAGCCCGGTACCATGGACTCCGTGCGCTCCGGC  216

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||||||| | || |||||||| |||||||||||| |||||||||| |||
Sbjct  217  CCCTACGGCCAGATCTTCCGCCCGGACAACTTCGTGTTCGGCCAGACGGGTGCCGGTAAC  276

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||| |||||  | ||||| |||||||| |||
Sbjct  277  AACTGGGCCAAGGGCCACTACACCGAGGGTGCCGAGCTCATCGACTCCGTGCTCGACGTT  336

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||| ||||||||||||||||| || |||||  || | |||||||| 
Sbjct  337  GTGCGCAAGGAGGCCGAGTCCTGCGACTGCCTGCAGGGTTTCCAGGTCGCCCACTCCCTG  396

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| |||||||| ||||| || || || || ||||||||||| |||||||||
Sbjct  397  GGCGGTGGCACCGGCTCCGGCATGGGCACGCTCCTCATCTCCAAGATCCGTGAGGAGTAC  456

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||  ||| | ||| || ||||| || ||||||||||| |||||||| 
Sbjct  457  CCCGACCGTATGATGCTCACCTTCTCCGTCGTGCCCTCCCCCAAGGTGTCTGACACCGTG  516

Query  481  GTGG  484
            ||||
Sbjct  517  GTGG  520


>dbj|AB590760.1| Synthetic construct DNA, clone: pFN21AE1911, Homo sapiens TUBB2C 
gene for tubulin, beta 2C, without stop codon, in Flexi 
system
Length=1352

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  67   TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  126

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  127  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  186

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  187  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  246

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  247  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  306

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  307  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  366

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  367  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  426

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  427  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  486

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  487  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  546

Query  481  GTGG  484
            ||||
Sbjct  547  GTGG  550


>ref|XM_001980792.1| Drosophila erecta betaTub85D (Dere\betaTub85D), mRNA
Length=1341

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  |||| || || |||||  | ||| | || |||
Sbjct  58   TTCTGGGAGGTGATCTCGGATGAGCACTGCATAGACGCGACCGGAACGTACTATGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| || ||||||||||||||||||||||||||||| |||||  |||||| |||||| 
Sbjct  118  AGCGATCTTCAGCTGGAGCGCATCAATGTGTACTACAACGAGGCCACCGGTGCCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||  ||||||| || || ||||||||||||||||| || || || || || 
Sbjct  178  GTTCCTCGTGCCATCCTTGTGGACCTAGAGCCCGGCACCATGGATTCCGTTCGCTCTGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || || ||||||||| |||| ||||||||||| || ||||||||||| || ||||||
Sbjct  238  GCCTTTGGTCAGATCTTCCGGCCGGACAACTTTGTCTTTGGCCAGTCGGGGGCAGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| ||||||||||| ||||||||||| ||  | ||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAACTGGTGGACTCTGTCTTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| | ||   |||||| ||||| || |||||||| || || ||||| || 
Sbjct  358  GTGCGAAAGGAGTCTGAGGGCTGCGATTGCCTTCAGGGCTTCCAGCTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||||||||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct  418  GGTGGCGGCACTGGCTCGGGTATGGGAACCCTGCTGATCTCGAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| |  ||||| ||||| |||||||||||||| || || || 
Sbjct  478  CCCGACCGCATCATGAACACCTTTTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|BC071888.1| Homo sapiens cDNA clone IMAGE:3958193, **** WARNING: chimeric 
clone ****
Length=1933

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  482  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  541

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  542  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  601

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  602  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  661

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  662  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  721

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  722  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  781

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  782  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  841

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  842  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  901

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  902  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  961

Query  481  GTGG  484
            ||||
Sbjct  962  GTGG  965


>gb|AY167990.1| Homo sapiens class IVb beta tubulin mRNA, complete cds
Length=1338

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  58   TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  118  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  178  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  238  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  298  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  358  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  418  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  478  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>dbj|AK026594.1| Homo sapiens cDNA: FLJ22941 fis, clone KAT08078, highly similar 
to HSBT278 Homo sapiens mRNA for beta tubulin
Length=1587

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  132  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  191

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  192  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  251

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  252  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  311

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  312  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  371

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  372  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  431

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  432  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  491

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  492  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  551

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  552  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  611

Query  481  GTGG  484
            ||||
Sbjct  612  GTGG  615


>dbj|AK026167.1| Homo sapiens cDNA: FLJ22514 fis, clone HRC12119, highly similar 
to HSBT278 Homo sapiens mRNA for beta tubulin
Length=1579

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  131  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  190

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  191  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  250

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  251  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  310

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  311  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  370

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  371  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  430

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  431  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  490

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  491  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  550

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  551  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  610

Query  481  GTGG  484
            ||||
Sbjct  611  GTGG  614


>dbj|AK000560.1| Homo sapiens cDNA FLJ20553 fis, clone KAT11806, highly similar 
to X79535 H
Length=1586

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  132  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  191

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  192  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  251

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  252  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  311

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  312  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  371

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  372  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  431

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  432  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  491

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  492  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  551

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  552  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  611

Query  481  GTGG  484
            ||||
Sbjct  612  GTGG  615


>ref|NM_006088.5| Homo sapiens tubulin, beta 4B class IVb (TUBB4B), mRNA
Length=1591

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  160  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  219

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  220  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  279

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  280  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  339

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  340  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  399

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  400  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  459

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  460  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  519

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  520  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  579

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  580  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  639

Query  481  GTGG  484
            ||||
Sbjct  640  GTGG  643


>gb|BC071889.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:88568 IMAGE:4905049), 
complete cds
Length=1590

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  96   TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  155

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  156  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  215

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  216  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  275

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  276  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  335

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  336  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  395

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  396  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  455

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  456  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  515

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  516  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  575

Query  481  GTGG  484
            ||||
Sbjct  576  GTGG  579


>gb|BC002885.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:11278 IMAGE:3944735), 
complete cds
Length=1560

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  102  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  161

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  162  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  221

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  222  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  281

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  282  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  341

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  342  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  401

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  402  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  461

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  462  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  521

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  522  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  581

Query  481  GTGG  484
            ||||
Sbjct  582  GTGG  585


>gb|BC007889.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:14233 IMAGE:4127195), 
complete cds
Length=1550

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  96   TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  155

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  156  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  215

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  216  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  275

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  276  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  335

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  336  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  395

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  396  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  455

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  456  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  515

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  516  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  575

Query  481  GTGG  484
            ||||
Sbjct  576  GTGG  579


>gb|BC012835.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:4826 IMAGE:3603755), 
complete cds
Length=1568

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  107  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  166

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  167  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  226

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  227  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  286

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  287  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  346

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  347  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  406

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  407  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  466

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  467  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  526

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  527  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  586

Query  481  GTGG  484
            ||||
Sbjct  587  GTGG  590


>gb|BC004188.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:2826 IMAGE:2964559), 
complete cds
Length=1568

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  107  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  166

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  167  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  226

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  227  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  286

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  287  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  346

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  347  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  406

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  407  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  466

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  467  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  526

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  527  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  586

Query  481  GTGG  484
            ||||
Sbjct  587  GTGG  590


>gb|BC039175.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:21910 IMAGE:4385885), 
complete cds
Length=1551

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  105  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  164

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  165  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  224

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  225  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  284

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  285  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  344

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  345  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  404

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  405  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  464

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  465  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  524

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  525  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  584

Query  481  GTGG  484
            ||||
Sbjct  585  GTGG  588


>gb|BC024038.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:10845 IMAGE:3616531), 
complete cds
Length=1544

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  96   TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  155

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  156  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  215

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  216  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  275

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  276  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  335

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  336  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  395

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  396  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  455

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  456  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  515

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  516  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  575

Query  481  GTGG  484
            ||||
Sbjct  576  GTGG  579


>gb|BC029529.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:33915 IMAGE:5274343), 
complete cds
Length=1579

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  132  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  191

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  192  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  251

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  252  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  311

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  312  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  371

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  372  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  431

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  432  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  491

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  492  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  551

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  552  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  611

Query  481  GTGG  484
            ||||
Sbjct  612  GTGG  615


>gb|BC019829.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:29954 IMAGE:5110038), 
complete cds
Length=1577

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  121  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  180

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  181  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  240

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  241  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  300

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  301  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  360

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  361  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  420

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  421  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  480

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  481  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  540

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  541  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  600

Query  481  GTGG  484
            ||||
Sbjct  601  GTGG  604


>gb|BC019359.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:13231 IMAGE:4024979), 
complete cds
Length=1548

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  98   TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  157

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  158  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  217

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  218  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  277

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  278  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  337

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  338  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  397

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  398  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  457

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  458  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  517

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  518  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  577

Query  481  GTGG  484
            ||||
Sbjct  578  GTGG  581


>gb|BC001911.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:2666 IMAGE:3544236), 
complete cds
Length=1557

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  95   TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  154

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  155  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  214

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  215  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  274

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  275  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  334

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  335  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  394

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  395  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  454

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  455  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  514

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  515  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  574

Query  481  GTGG  484
            ||||
Sbjct  575  GTGG  578


>gb|BC002783.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:4028 IMAGE:3614023), 
complete cds
Length=1552

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 402/484 (84%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  105  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  164

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  165  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  224

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  225  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  284

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  285  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  344

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  345  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  404

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  405  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  464

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  465  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  524

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  525  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  584

Query  481  GTGG  484
            ||||
Sbjct  585  GTGG  588


>gb|AF102890.1|AF102890 Gadus morhua beta-1 tubulin mRNA, complete cds
Length=1546

 Score =  504 bits (558),  Expect = 2e-139
 Identities = 401/482 (84%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||  | |||  |||||||||||| |||||  | || ||| | |||||||| |||
Sbjct  95   TTCTGGGAAGTGATCAGCGATGAGCATGGAATCGACCCAACTGGCACATACCACGGAGAC  154

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||  | ||||| || |||||||||||||| || |||||||| |||
Sbjct  155  AGCGACCTGCAGCTGGACAGGATCAACGTCTACTACAATGAGGCCTCGGGTGGCAAATAC  214

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||||| || |||||||| |||||||||||||||||||||||| | || || 
Sbjct  215  GTCCCCCGTGCTGTTCTGGTCGATCTTGAGCCCGGCACCATGGACTCTGTGAGGTCCGGT  274

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             ||||||| ||| |||||||||| |||||||| || |||||||||   ||||| ||||||
Sbjct  275  GCTTTCGGTCAGGTCTTCAGGCCGGACAACTTCGTTTTCGGCCAGAGTGGTGCTGGCAAC  334

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| || ||||| |||||||||||||| || ||||| || 
Sbjct  335  AACTGGGCCAAGGGTCACTACACGGAAGGTGCCGAGCTGGTGGACTCTGTCCTCGACGTG  394

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | || ||||| ||   ||||||||||||||| |||||||| ||||||||||| |||
Sbjct  395  GTGAGGAAAGAGGCGGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTCACACACTCGCTT  454

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || ||||| ||||| ||||| || |||  ||||||||| |||||||||
Sbjct  455  GGTGGCGGCACCGGTTCCGGCATGGGTACCCTCCTCATTAGCAAGATCCGTGAGGAGTAC  514

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| |||||||| ||||||||||| || 
Sbjct  515  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAAGTGTCGGACACAGTG  574

Query  481  GT  482
            ||
Sbjct  575  GT  576


>dbj|AK377284.1| Bombyx mori mRNA, clone: fwd-07N19
Length=1961

 Score =  502 bits (556),  Expect = 9e-139
 Identities = 401/482 (84%), Gaps = 1/482 (0%)
 Strand=Plus/Plus

Query  2    TCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACA  61
            ||||||||||||||||||| ||||| ||||||||  ||||||| |||||||| || ||| 
Sbjct  146  TCTGGGAGATCATCTCCGACGAGCACGGCATCGACCCCACCGGTGCCTACCATGGGGACT  205

Query  62   GCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACG  121
              ||| ||||| |||||||||||||||| ||||||||||| || ||||| ||||||||||
Sbjct  206  CTGACTTGCAGTTGGAGCGCATCAATGTATACTACAATGAAGCCTCCGGCGGCAAGTACG  265

Query  122  TGCCCCGCGCTGTCCTTGTCGATCTGG-AGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||  |||| |||||  ||| |||||||||||||||||||||| || || |||
Sbjct  266  TGCCCCGCGCCATCCTCGTCGACTTGGGAGCCCGGCACCATGGACTCTGTCCGCTCTGGA  325

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||| | || |||||||| || ||||| ||||| || |||||||||
Sbjct  326  CCTTTCGGACAGATCTTCCGTCCGGACAACTTCGTCTTCGGACAGTCCGGCGCCGGCAAC  385

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||||| || || |||||  | || || 
Sbjct  386  AACTGGGCCAAGGGACACTACACGGAGGGTGCTGAGCTCGTCGATTCAGTTTTAGACGTC  445

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || ||||| || ||||| || || ||||| || || |||||||| |||||||| || 
Sbjct  446  GTTCGAAAGGAAGCGGAATCGTGTGATTGCCTCCAGGGATTCCAACTGACACACTCGCTC  505

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| || ||||||||||| ||||| || || ||||| ||| | || ||||||
Sbjct  506  GGCGGCGGCACCGGTTCCGGTATGGGCACCCTCCTCATCTCCAAAATCAGAGAAGAGTAC  565

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| || ||||||||||| || ||||| || || || |  ||||||||||| || 
Sbjct  566  CCTGACAGAATAATGAACACATATTCAGTTGTACCATCACCTANAGTGTCGGACACAGTA  625

Query  481  GT  482
            ||
Sbjct  626  GT  627


>dbj|AB491666.1| Prasinoderma coloniale Btub gene for beta-tubulin, partial cds, 
strain: MBIC10720
Length=1162

 Score =  500 bits (554),  Expect = 3e-138
 Identities = 401/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||| ||| ||||| ||| ||||  |||||||| ||||||| || |||
Sbjct  19   TTCTGGGAGGTCATCTGCGACGAGCACGGCGTCGACCCCACCGGCACCTACCATGGCGAC  78

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||||||||||||||| ||||||| ||| |||||| |||| |||   |||
Sbjct  79   TCCGACCTCCAGCTGGAGCGCATCAACGTGTACTTCAACGAGGCGACCGGCGGCCGCTAC  138

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  ||||  | || || |||||||||||||||||||| || || ||||| 
Sbjct  139  GTGCCCCGCGCGATCCTGATGGACCTCGAGCCCGGCACCATGGACTCCGTCCGCTCGGGC  198

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||||||| | || |||||||| |||||||||||| | || |||||||||
Sbjct  199  CCCTACGGCCAGATCTTCCGCCCGGACAACTTCGTGTTCGGCCAGACCGGCGCCGGCAAC  258

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| ||||||||  | ||||| |||||||| || 
Sbjct  259  AACTGGGCCAAGGGCCACTACACCGAGGGCGCTGAGCTCATCGACTCGGTGCTCGACGTC  318

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||| | || || ||||||||||| || ||||||||  |    |||||| | 
Sbjct  319  GTGCGCAAGGAGTCSGAGTCGTGCGACTGCCTCCAGGGCTTCCAGGTGTGCCACTCCATG  378

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| |||||||| ||||| ||||| ||||| |||||||||||||||||||||
Sbjct  379  GGCGGCGGCACCGGCTCCGGCATGGGCACCCTCCTGATCTCCAAGATCCGCGAGGAGTAC  438

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||  ||| | ||||||  | || ||||||||||||||||||||||| 
Sbjct  439  CCCGACCGCATGATGCTCACCTTCTCGGTGTTCCCCTCGCCCAAGGTGTCGGACACCGTG  498

Query  481  GTGG  484
            ||||
Sbjct  499  GTGG  502


>ref|XM_843368.2| PREDICTED: Canis lupus familiaris tubulin, beta 2C, transcript 
variant 1 (TUBB2C), mRNA
Length=1591

 Score =  499 bits (552),  Expect = 1e-137
 Identities = 401/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||||||| | |||||| | ||||| || |||
Sbjct  154  TTCTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACTTACCATGGCGAC  213

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||| |||||||||||||| ||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  214  AGCGATCTGCAGCTGGAGCGGATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  273

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || || || |||||||||||||||||||| ||||| ||||||
Sbjct  274  GTGCCCCGCGCTGTGCTCGTGGACCTAGAGCCCGGCACCATGGACTCCGTGCGCTCGGGA  333

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| || || |||||||| |||||||| || ||||| |||   ||||| || |||
Sbjct  334  CCCTTCGGGCAAATATTCAGGCCAGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  393

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||| ||||| ||||| ||||| 
Sbjct  394  AACTGGGCCAAGGGGCACTACACAGAAGGCGCAGAGCTGGTCGACTCGGTGCTGGATGTC  453

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| |||  ||| ||||||||||| |||||||| || || |||||||| 
Sbjct  454  GTGAGGAAGGAGGCTGAAAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCCCTG  513

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  514  GGTGGGGGGACTGGGTCTGGGATGGGGACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  573

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||||| |   || || || ||||||||||| |||||||| || 
Sbjct  574  CCAGACAGGATCATGAACACATTCAGTGTGGTACCCTCGCCCAAGGTATCGGACACGGTG  633

Query  481  GTGG  484
            ||||
Sbjct  634  GTGG  637


>ref|XM_002926120.1| PREDICTED: Ailuropoda melanoleuca tubulin beta-2C chain-like 
(LOC100463763), mRNA
Length=1535

 Score =  499 bits (552),  Expect = 1e-137
 Identities = 401/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||||||| | |||||| | ||||| || |||
Sbjct  114  TTCTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACTTACCATGGCGAC  173

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||| ||||| ||||||||||| |||||  ||||||||||||||
Sbjct  174  AGCGACCTGCAGCTGGAGCGGATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAC  233

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  ||||||| |||||||||||||| ||||| ||||| 
Sbjct  234  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCGGGCACCATGGACTCCGTGCGCTCGGGG  293

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| || ||||||||||| |||||||| || ||||| |||   ||||| || |||
Sbjct  294  CCCTTCGGGCAAATCTTCAGGCCGGACAACTTCGTTTTCGGTCAGAGCGGTGCTGGGAAC  353

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||| ||||| ||| | ||||||
Sbjct  354  AACTGGGCCAAGGGGCACTACACAGAAGGCGCAGAGCTGGTCGACTCGGTGTTGGATGTT  413

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || |||  ||| ||||||||||| |||||||| || || |||||||| 
Sbjct  414  GTGAGAAAGGAAGCTGAAAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCCCTG  473

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| || || || ||   ||||||||| ||||| |||
Sbjct  474  GGTGGGGGGACTGGGTCTGGGATGGGTACTCTCCTCATCAGCAAGATCCGGGAGGAATAC  533

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||||| |   || ||||| |||||||||||||||||||| || 
Sbjct  534  CCAGACAGGATCATGAACACATTCAGTGTGGTGCCCTCGCCCAAGGTGTCGGACACGGTG  593

Query  481  GTGG  484
            ||||
Sbjct  594  GTGG  597


>ref|XM_002608871.1| Branchiostoma floridae hypothetical protein, mRNA
Length=2175

 Score =  499 bits (552),  Expect = 1e-137
 Identities = 401/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| || ||||| ||||||||  |||||||| | |||||||| |||
Sbjct  96   TTCTGGGAGGTGATCTCAGACGAGCACGGCATCGACCCCACCGGCACGTACCACGGAGAC  155

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||||||||||||| | |||| ||| ||||||||||| ||    ||||||||||||
Sbjct  156  TCCGACCTGCAGCTGGAGAGGATCAGTGTTTACTACAATGAAGCCAGTGGTGGCAAGTAC  215

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||||||| | || || || ||||| ||||||||||||||||| || ||||| |||
Sbjct  216  GTTCCCCGCGCTATTCTGGTGGACCTGGAACCCGGCACCATGGACTCCGTACGATCAGGA  275

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| || ||||| |||   ||||| || |||
Sbjct  276  CCCTTCGGACAGATCTTCCGCCCAGACAACTTCGTCTTCGGTCAGAGTGGTGCAGGGAAC  335

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || || |||||||||||||| ||||| || || 
Sbjct  336  AACTGGGCCAAGGGCCACTACACGGAAGGAGCGGAGCTGGTGGACTCCGTGCTGGACGTG  395

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||| ||| ||||   ||||||||| ||||| |||||||| || || ||||| || 
Sbjct  396  GTGCGCAAAGAGTCCGAGAGCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTC  455

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| |||||||| ||||| ||||| || || |||||||||||||||||||||
Sbjct  456  GGCGGCGGCACCGGCTCCGGCATGGGCACCCTCCTCATCTCCAAGATCCGCGAGGAGTAC  515

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||||| ||| || ||||| || ||||| ||||||||||| || 
Sbjct  516  CCCGACCGCATCATGAACACATTCTCCGTCGTGCCTTCCCCCAAAGTGTCGGACACGGTG  575

Query  481  GTGG  484
            ||||
Sbjct  576  GTGG  579


>dbj|AK026609.1| Homo sapiens cDNA: FLJ22956 fis, clone KAT09938, highly similar 
to HSBT278 Homo sapiens mRNA for beta tubulin
Length=1579

 Score =  499 bits (552),  Expect = 1e-137
 Identities = 401/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  132  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  191

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  192  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  251

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  252  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  311

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||| |||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  312  CCCTTCGGGCAGACCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  371

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  372  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  431

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  432  GTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  491

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  492  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  551

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| |     || ||||| |||||||| ||||| ||||| || 
Sbjct  552  CCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTG  611

Query  481  GTGG  484
            ||||
Sbjct  612  GTGG  615


>dbj|AB642157.1| Haemaphysalis longicornis Hltub mRNA for beta-tubulin, complete 
cds
Length=1596

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 399/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||| || |||||||| ||||||||| | |||||  ||||||| || |||
Sbjct  112  TTCTGGGAGGTCATATCTGATGAGCACGGCATCGATCCTACCGGAACCTACCATGGCGAC  171

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || |||||| | ||||| |||||||||||||||||||| || || || || || |||
Sbjct  172  TCGGATCTGCAGTTAGAGCGGATCAATGTGTACTACAATGAAGCCTCTGGAGGTAAATAC  231

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || ||||| ||||| || ||||||||||| |||||||| |||
Sbjct  232  GTGCCTCGTGCCATCCTGGTTGATCTTGAGCCTGGAACCATGGACTCGGTGCGATCTGGA  291

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||| |||||||||| |||||||||||||| ||||||   ||||| ||||||
Sbjct  292  CCCTTTGGGCAGCTCTTCAGGCCTGACAACTTTGTGTTTGGCCAGAGTGGTGCTGGCAAC  351

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||| ||||| || ||||| |||||||| ||||||||||||
Sbjct  352  AACTGGGCTAAGGGCCACTACACGGAGGGCGCCGAGCTCGTGGACTCTGTGCTCGATGTT  411

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||||  |||||||||||| || || ||||| ||||| ||||| || 
Sbjct  412  GTCCGCAAGGAGGCCGAAAGCTGCGACTGCCTCCAGGGTTTCCAGCTCACCCACTCTCTC  471

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || ||||| |||||||| ||||| || ||||| || |||||||||||||||||||||
Sbjct  472  GGTGGTGGCACCGGCTCCGGCATGGGCACGCTGCTCATCTCCAAGATCCGCGAGGAGTAC  531

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |   || ||||| || |||||||| || |||||||| 
Sbjct  532  CCAGACCGCATCATGAACACTTTCAGCGTGGTGCCCTCTCCCAAGGTCTCTGACACCGTG  591

Query  481  GT  482
            ||
Sbjct  592  GT  593


>ref|XM_003122352.2| PREDICTED: Sus scrofa tubulin beta-2C chain-like (LOC100516352), 
mRNA
Length=1564

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||| ||||||||||||||| | |||||| |||||||||| |||
Sbjct  138  TTTTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACCTACCACGGGGAC  197

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||| ||||| ||||||||||| |||||  ||||||||||||||
Sbjct  198  AGCGACCTGCAGCTGGAGCGGATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAC  257

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||| || || || || || ||||| |||||||||||||| ||||| ||||| 
Sbjct  258  GTGCCTCGCGCCGTGCTCGTGGACCTTGAGCCGGGCACCATGGACTCCGTGCGCTCGGGG  317

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| |||||||| || ||||| |||   |||||||| |||
Sbjct  318  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCCGGGAAC  377

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || ||||| || ||||| ||||| ||||| 
Sbjct  378  AACTGGGCCAAGGGGCACTACACAGAAGGCGCAGAGCTTGTCGACTCGGTGCTGGATGTC  437

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| |||||||| || || ||||| || 
Sbjct  438  GTGAGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  497

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| |||||||| ||   ||||||||| |||||||||
Sbjct  498  GGTGGGGGGACCGGGTCTGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAGGAGTAC  557

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| |||||||||||||||||||| || 
Sbjct  558  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACGGTG  617

Query  481  GTGG  484
            ||||
Sbjct  618  GTGG  621


>ref|XM_001154870.2| PREDICTED: Pan troglodytes tubulin beta-8 chain-like (LOC746788), 
mRNA
Length=672

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  118  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  178  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGT  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  238  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||| |||| |||||| | ||||||
Sbjct  298  AACTGGGCCAAGGGACACTACACAGAAGGTGCGGAGCTGATGGAGTCAGTGATGGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  358  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||    |||||||| |||||||||
Sbjct  418  GGTGGGGGAACTGGGTCTGGGATGGGTACCCTTCTCATCAGTAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||| || |||||||| 
Sbjct  478  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTATCAGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|NM_079566.4| Drosophila melanogaster beta-Tubulin at 85D (betaTub85D), mRNA
Length=1841

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  | || ||||| |||||  | ||| |||| || 
Sbjct  288  TTCTGGGAGGTAATCTCGGATGAGCACTGTATAGATGCGACCGGAACGTACTACGGCGAT  347

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || || |||||||||||||||||||| ||||||||||| ||  |||||| |||||| 
Sbjct  348  AGTGATCTCCAGCTGGAGCGCATCAATGTATACTACAATGAAGCCACCGGTGCCAAGTAT  407

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  | || || || |||||||||||||||||||| || || || || || 
Sbjct  408  GTGCCACGCGCAATTCTCGTGGACCTGGAGCCCGGCACCATGGATTCGGTTCGTTCTGGC  467

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || |||||||||||| |||| ||||| |||||||| ||||| ||||| || ||||||
Sbjct  468  GCCTTTGGCCAGATCTTCCGGCCGGACAATTTTGTGTTTGGCCAATCGGGAGCAGGCAAC  527

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| ||||||||||| |||||||| || ||  | ||||| 
Sbjct  528  AACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAACTGGTGGATTCCGTCTTGGATGTG  587

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| ||||    ||||| ||||| || |||||||| || || ||||| || 
Sbjct  588  GTGCGAAAGGAGTCCGAGGGATGCGATTGCCTTCAGGGCTTCCAGCTGACCCACTCGCTG  647

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct  648  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGCTGATCTCGAAGATCCGCGAGGAGTAC  707

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |||||| ||||| |||||||||||||| || || || 
Sbjct  708  CCGGACCGCATCATGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  767

Query  481  GTGG  484
            ||||
Sbjct  768  GTGG  771


>dbj|AK349426.1| Sus scrofa mRNA, clone:PTG010068E12, expressed in pituitary gland
Length=1587

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||| ||||||||||||||| | |||||| |||||||||| |||
Sbjct  147  TTTTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACCTACCACGGGGAC  206

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||| ||||| ||||||||||| |||||  ||||||||||||||
Sbjct  207  AGCGACCTGCAGCTGGAGCGGATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAC  266

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||| || || || || || ||||| |||||||||||||| ||||| ||||| 
Sbjct  267  GTGCCTCGCGCCGTGCTCGTGGACCTTGAGCCGGGCACCATGGACTCCGTGCGCTCGGGG  326

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| |||||||| || ||||| |||   |||||||| |||
Sbjct  327  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCCGGGAAC  386

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || ||||| || ||||| ||||| ||||| 
Sbjct  387  AACTGGGCCAAGGGGCACTACACAGAAGGCGCAGAGCTTGTCGACTCGGTGCTGGATGTC  446

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| |||||||| || || ||||| || 
Sbjct  447  GTGAGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  506

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| |||||||| ||   ||||||||| |||||||||
Sbjct  507  GGTGGGGGGACCGGGTCTGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAGGAGTAC  566

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| |||||||||||||||||||| || 
Sbjct  567  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACGGTG  626

Query  481  GTGG  484
            ||||
Sbjct  627  GTGG  630


>gb|FJ637829.1| Synthetic construct Drosophila melanogaster clone BS14906 encodes 
betaTub85D-RA
Length=1373

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  | || ||||| |||||  | ||| |||| || 
Sbjct  74   TTCTGGGAGGTAATCTCGGATGAGCACTGTATAGATGCGACCGGAACGTACTACGGCGAT  133

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || || |||||||||||||||||||| ||||||||||| ||  |||||| |||||| 
Sbjct  134  AGTGATCTCCAGCTGGAGCGCATCAATGTATACTACAATGAAGCCACCGGTGCCAAGTAT  193

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  | || || || |||||||||||||||||||| || || || || || 
Sbjct  194  GTGCCACGCGCAATTCTCGTGGACCTGGAGCCCGGCACCATGGATTCGGTTCGTTCTGGC  253

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || |||||||||||| |||| ||||| |||||||| ||||| ||||| || ||||||
Sbjct  254  GCCTTTGGCCAGATCTTCCGGCCGGACAATTTTGTGTTTGGCCAATCGGGAGCAGGCAAC  313

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| ||||||||||| |||||||| || ||  | ||||| 
Sbjct  314  AACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAACTGGTGGATTCCGTCTTGGATGTG  373

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| ||||    ||||| ||||| || |||||||| || || ||||| || 
Sbjct  374  GTGCGAAAGGAGTCCGAGGGATGCGATTGCCTTCAGGGCTTCCAGCTGACCCACTCGCTG  433

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct  434  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGCTGATCTCGAAGATCCGCGAGGAGTAC  493

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |||||| ||||| |||||||||||||| || || || 
Sbjct  494  CCGGACCGCATCATGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  553

Query  481  GTGG  484
            ||||
Sbjct  554  GTGG  557


>gb|FJ633272.1| Synthetic construct Drosophila melanogaster clone BO14906 encodes 
betaTub85D-RA
Length=1372

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  | || ||||| |||||  | ||| |||| || 
Sbjct  74   TTCTGGGAGGTAATCTCGGATGAGCACTGTATAGATGCGACCGGAACGTACTACGGCGAT  133

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || || |||||||||||||||||||| ||||||||||| ||  |||||| |||||| 
Sbjct  134  AGTGATCTCCAGCTGGAGCGCATCAATGTATACTACAATGAAGCCACCGGTGCCAAGTAT  193

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  | || || || |||||||||||||||||||| || || || || || 
Sbjct  194  GTGCCACGCGCAATTCTCGTGGACCTGGAGCCCGGCACCATGGATTCGGTTCGTTCTGGC  253

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || |||||||||||| |||| ||||| |||||||| ||||| ||||| || ||||||
Sbjct  254  GCCTTTGGCCAGATCTTCCGGCCGGACAATTTTGTGTTTGGCCAATCGGGAGCAGGCAAC  313

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| ||||||||||| |||||||| || ||  | ||||| 
Sbjct  314  AACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAACTGGTGGATTCCGTCTTGGATGTG  373

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| ||||    ||||| ||||| || |||||||| || || ||||| || 
Sbjct  374  GTGCGAAAGGAGTCCGAGGGATGCGATTGCCTTCAGGGCTTCCAGCTGACCCACTCGCTG  433

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct  434  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGCTGATCTCGAAGATCCGCGAGGAGTAC  493

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |||||| ||||| |||||||||||||| || || || 
Sbjct  494  CCGGACCGCATCATGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  553

Query  481  GTGG  484
            ||||
Sbjct  554  GTGG  557


>gb|EU429675.1| Chilo suppressalis beta-tubulin mRNA, complete cds
Length=1862

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 399/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| |||||||| || ||||| ||||||||  |||||||||| ||||| || |||
Sbjct  69   TTCTGGGAAATCATCTCTGACGAGCACGGCATCGACCCCACCGGCGCTTACCATGGCGAC  128

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||| | ||| | ||||| ||||| || |||||||||||||| ||||||||||| || 
Sbjct  129  TCCGACTTACAGTTAGAGCGTATCAACGTATACTACAATGAGGCTTCCGGTGGCAAATAT  188

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| ||||||||||||||||||||||||||||| || || || |||
Sbjct  189  GTGCCTCGTGCCATCCTCGTCGATCTGGAGCCCGGCACCATGGACTCCGTCCGCTCAGGA  248

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| || |||||| | || |||||||| || ||||| ||||| ||||||||||||
Sbjct  249  CCCTTCGGACAAATCTTCCGCCCGGACAACTTCGTCTTCGGGCAGTCCGGTGCCGGCAAC  308

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||||||||| || || ||||| || || || 
Sbjct  309  AACTGGGCCAAGGGACACTACACAGAAGGTGCTGAGCTTGTCGATTCAGTACTTGACGTA  368

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || || ||  | ||||| ||||| ||||| || |||||||| |||||||||||||||
Sbjct  369  GTACGTAAAGAATCAGAATCATGCGATTGCCTACAGGGCTTCCAGCTCACACACTCCCTT  428

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || |||||||| ||||| ||||| || || || ||||||||||| || |||
Sbjct  429  GGCGGTGGTACCGGCTCCGGCATGGGTACCCTACTTATCTCAAAGATCCGCGAAGAATAC  488

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||| ||| || || || |||||||| || || ||||| || 
Sbjct  489  CCCGACAGAATCATGAACACATGCTCAGTCGTCCCCTCGCCCAAAGTATCAGACACTGTC  548

Query  481  GT  482
            ||
Sbjct  549  GT  550


>dbj|AK235338.1| Sus scrofa mRNA, clone:OVRM10070A11, expressed in ovary
Length=1588

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||| ||||||||||||||| | |||||| |||||||||| |||
Sbjct  143  TTTTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACCTACCACGGGGAC  202

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||| ||||| ||||||||||| |||||  ||||||||||||||
Sbjct  203  AGCGACCTGCAGCTGGAGCGGATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAC  262

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||| || || || || || ||||| |||||||||||||| ||||| ||||| 
Sbjct  263  GTGCCTCGCGCCGTGCTCGTGGACCTTGAGCCGGGCACCATGGACTCCGTGCGCTCGGGG  322

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| |||||||| || ||||| |||   |||||||| |||
Sbjct  323  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCCGGGAAC  382

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || ||||| || ||||| ||||| ||||| 
Sbjct  383  AACTGGGCCAAGGGGCACTACACAGAAGGCGCAGAGCTTGTCGACTCGGTGCTGGATGTC  442

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| |||||||| || || ||||| || 
Sbjct  443  GTGAGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  502

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| |||||||| ||   ||||||||| |||||||||
Sbjct  503  GGTGGGGGGACCGGGTCTGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAGGAGTAC  562

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| |||||||||||||||||||| || 
Sbjct  563  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACGGTG  622

Query  481  GTGG  484
            ||||
Sbjct  623  GTGG  626


>dbj|AK234279.1| Sus scrofa mRNA, clone:OVR010036H08, expressed in ovary
Length=1587

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||| ||||||||||||||| | |||||| |||||||||| |||
Sbjct  146  TTTTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACCTACCACGGGGAC  205

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||| ||||| ||||||||||| |||||  ||||||||||||||
Sbjct  206  AGCGACCTGCAGCTGGAGCGGATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAC  265

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||| || || || || || ||||| |||||||||||||| ||||| ||||| 
Sbjct  266  GTGCCTCGCGCCGTGCTCGTGGACCTTGAGCCGGGCACCATGGACTCCGTGCGCTCGGGG  325

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| |||||||| || ||||| |||   |||||||| |||
Sbjct  326  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCCGGGAAC  385

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || ||||| || ||||| ||||| ||||| 
Sbjct  386  AACTGGGCCAAGGGGCACTACACAGAAGGCGCAGAGCTTGTCGACTCGGTGCTGGATGTC  445

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| |||||||| || || ||||| || 
Sbjct  446  GTGAGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  505

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| |||||||| ||   ||||||||| |||||||||
Sbjct  506  GGTGGGGGGACCGGGTCTGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAGGAGTAC  565

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| |||||||||||||||||||| || 
Sbjct  566  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACGGTG  625

Query  481  GTGG  484
            ||||
Sbjct  626  GTGG  629


>gb|AY118725.1| Drosophila melanogaster GH02051 full insert cDNA
Length=1779

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  | || ||||| |||||  | ||| |||| || 
Sbjct  207  TTCTGGGAGGTAATCTCGGATGAGCACTGTATAGATGCGACCGGAACGTACTACGGCGAT  266

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || || |||||||||||||||||||| ||||||||||| ||  |||||| |||||| 
Sbjct  267  AGTGATCTCCAGCTGGAGCGCATCAATGTATACTACAATGAAGCCACCGGTGCCAAGTAT  326

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  | || || || |||||||||||||||||||| || || || || || 
Sbjct  327  GTGCCACGCGCAATTCTCGTGGACCTGGAGCCCGGCACCATGGATTCGGTTCGTTCTGGC  386

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || |||||||||||| |||| ||||| |||||||| ||||| ||||| || ||||||
Sbjct  387  GCCTTTGGCCAGATCTTCCGGCCGGACAATTTTGTGTTTGGCCAATCGGGAGCAGGCAAC  446

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| ||||||||||| |||||||| || ||  | ||||| 
Sbjct  447  AACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAACTGGTGGATTCCGTCTTGGATGTG  506

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| ||||    ||||| ||||| || |||||||| || || ||||| || 
Sbjct  507  GTGCGAAAGGAGTCCGAGGGATGCGATTGCCTTCAGGGCTTCCAGCTGACCCACTCGCTG  566

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct  567  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGCTGATCTCGAAGATCCGCGAGGAGTAC  626

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |||||| ||||| |||||||||||||| || || || 
Sbjct  627  CCGGACCGCATCATGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  686

Query  481  GTGG  484
            ||||
Sbjct  687  GTGG  690


>ref|NM_001004400.2| Gallus gallus tubulin, beta 2B class IIb (TUBB2B), mRNA
 emb|V00389.1| Messenger RNA for chicken beta-tubulin
Length=1651

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||  ||||||||| ||||||||| ||||||||  ||||||||| |||
Sbjct  145  TTCTGGGAGGTCATCAGCGATGAGCACGGCATCGATCCCACCGGCAGCTACCACGGGGAC  204

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||| | ||||| |||||||||||||||||  | |||  |||||||
Sbjct  205  AGCGACCTGCAGCTGGAGAGGATCAACGTGTACTACAATGAGGCCACAGGTAACAAGTAC  264

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || || |||||||||||||| |||||||| ||||| || || 
Sbjct  265  GTCCCCCGTGCCATCCTGGTTGACCTGGAGCCCGGCACGATGGACTCGGTGCGCTCCGGC  324

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||| | |||||||||||||| || || |||   || |||||||||
Sbjct  325  CCCTTTGGACAGATCTTCCGACCCGACAACTTTGTCTTTGGTCAGAGCGGGGCCGGCAAC  384

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || ||||||||||||||||| ||||| ||||| 
Sbjct  385  AACTGGGCCAAGGGGCACTACACGGAAGGCGCTGAGCTGGTGGACTCTGTGCTGGATGTG  444

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||| | |||  ||||||||||||||| ||||||||  | || ||||| || 
Sbjct  445  GTGAGGAAGGAGTCGGAAAGCTGCGACTGCCTGCAGGGCTTCCAGTTGACCCACTCGCTG  504

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| ||||| || ||   |||||||||||||||||||
Sbjct  505  GGCGGCGGCACCGGCTCGGGGATGGGCACCCTCCTCATCAGCAAGATCCGCGAGGAGTAC  564

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| || ||||||||||||||||| || 
Sbjct  565  CCCGACCGCATCATGAACACGTTCAGCGTCATGCCCTCCCCCAAGGTGTCGGACACGGTG  624

Query  481  GTGG  484
            ||||
Sbjct  625  GTGG  628


>gb|M11443.1|CHKTUBB2 Chicken beta-2 tubulin gene, complete cds
Length=1338

 Score =  495 bits (548),  Expect = 1e-136
 Identities = 400/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||  ||||||||| ||||||||| ||||||||  ||||||||| |||
Sbjct  58   TTCTGGGAGGTCATCAGCGATGAGCACGGCATCGATCCCACCGGCAGCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||| | ||||| |||||||||||||||||  | |||  |||||||
Sbjct  118  AGCGACCTGCAGCTGGAGAGGATCAACGTGTACTACAATGAGGCCACAGGTAACAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || || |||||||||||||| |||||||| ||||| || || 
Sbjct  178  GTCCCCCGTGCCATCCTGGTTGACCTGGAGCCCGGCACGATGGACTCGGTGCGCTCCGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||| | |||||||||||||| || || |||   || |||||||||
Sbjct  238  CCCTTTGGACAGATCTTCCGACCCGACAACTTTGTCTTTGGTCAGAGCGGGGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || ||||||||||||||||| ||||| ||||| 
Sbjct  298  AACTGGGCCAAGGGGCACTACACGGAAGGCGCTGAGCTGGTGGACTCTGTGCTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||| | |||  ||||||||||||||| ||||||||  | || ||||| || 
Sbjct  358  GTGAGGAAGGAGTCGGAAAGCTGCGACTGCCTGCAGGGCTTCCAGTTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| ||||| || ||   |||||||||||||||||||
Sbjct  418  GGCGGCGGCACCGGCTCGGGGATGGGCACCCTCCTCATCAGCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| || ||||||||||||||||| || 
Sbjct  478  CCCGACCGCATCATGAACACGTTCAGCGTCATGCCCTCCCCCAAGGTGTCGGACACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|AY705361.1| Drosophila yakuba testis beta tubulin mRNA, partial cds
Length=1180

 Score =  493 bits (546),  Expect = 4e-136
 Identities = 392/471 (84%), Gaps = 0/471 (0%)
 Strand=Plus/Plus

Query  14   TCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGC  73
            |||| ||||||||  |||| || ||||| ||  | ||| | || || || || |||||||
Sbjct  1    TCTCGGATGAGCACTGCATAGACGCCACTGGAACGTACTATGGCGATAGTGATCTGCAGC  60

Query  74   TGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTG  133
            |||||||||||||||||||||||||||| ||  |||||| |||||| || || || ||  
Sbjct  61   TGGAGCGCATCAATGTGTACTACAATGAAGCCACCGGTGCCAAGTATGTTCCGCGTGCCA  120

Query  134  TCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGA  193
            ||||||| || |||||||||||||||||||| || || || || ||  | || || ||||
Sbjct  121  TCCTTGTGGACCTGGAGCCCGGCACCATGGATTCCGTTCGCTCTGGCGCCTTTGGTCAGA  180

Query  194  TCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGG  253
            ||||| |||| ||||||||||| || ||||||||||| || |||||||||||||||||||
Sbjct  181  TCTTCCGGCCGGACAACTTTGTCTTTGGCCAGTCGGGGGCAGGCAACAACTGGGCCAAGG  240

Query  254  GTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGG  313
            |||||||||||||||||||||| ||||||||||| ||  | ||||| || || |||||| 
Sbjct  241  GTCATTACACAGAGGGTGCTGAACTGGTGGACTCCGTCTTGGATGTGGTGCGAAAGGAGT  300

Query  314  CCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTG  373
            | ||   |||||| ||||| || || ||||| || || ||||| || || ||||||||||
Sbjct  301  CTGAGGGCTGCGATTGCCTTCAGGGATTCCAGCTGACCCACTCGCTGGGTGGCGGCACTG  360

Query  374  GCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCA  433
            ||||||| ||||||||||||||||| || |||||||||||||||||||||||| | ||||
Sbjct  361  GCTCCGGCATGGGAACCCTGCTGATCTCAAAGATCCGCGAGGAGTACCCCGACCGCATCA  420

Query  434  TGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGTGG  484
            ||||||| | |||||| ||||| |||||||||||||| || || || ||||
Sbjct  421  TGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCTGATACTGTGGTGG  471


>gb|BT082806.1| Anoplopoma fimbria clone afim-evh-504-080 Tubulin beta-1 chain 
putative mRNA, complete cds
Length=1524

 Score =  491 bits (544),  Expect = 2e-135
 Identities = 398/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||||||||| ||||||||  | |||||  ||||||||||||||
Sbjct  123  TTCTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCTACCGGTACCTACCACGGTGAC  182

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||  | ||||| || ||||||||||| || || ||||| || || 
Sbjct  183  AGCGACCTGCAGCTGGACAGGATCAACGTCTACTACAATGAAGCATCGGGTGGTAAATAT  242

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||||| || || || |||||||| |||||||||||||||||| | || |||
Sbjct  243  GTGCCCCGTGCTGTGCTGGTGGACCTGGAGCCAGGCACCATGGACTCTGTGAGGTCCGGA  302

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||||||| |||||||||| ||||||||||| |||||||||   ||||||||||||
Sbjct  303  CCTTTCGGCCAGGTCTTCAGGCCAGACAACTTTGTCTTCGGCCAGAGTGGTGCCGGCAAC  362

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||||||||| || |||||||||||||| || || ||||| 
Sbjct  363  AACTGGGCCAAGGGCCATTACACAGAGGGAGCAGAGCTGGTGGACTCTGTCCTGGATGTG  422

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||    || |||||||| || |||||||| |||||||||||| | 
Sbjct  423  GTGAGGAAGGAGGCAGAGAGTTGTGACTGCCTTCAGGGCTTCCAGCTCACACACTCCTTG  482

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || ||||| |||||||| ||| |||| ||   ||||||||| || ||||||
Sbjct  483  GGTGGCGGTACAGGCTCTGGTATGGGCACCTTGCTCATCAGCAAGATCCGTGAAGAGTAC  542

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| || || || || || ||||| |||
Sbjct  543  CCCGACCGCATCATGAACACCTTCAGCGTAGTGCCCTCCCCAAAAGTATCAGACACAGTT  602

Query  481  GT  482
            ||
Sbjct  603  GT  604


>gb|AF267186.1|AF267186 Malawimonas jakobiformis clone 7 beta-tubulin gene, partial cds
Length=1162

 Score =  491 bits (544),  Expect = 2e-135
 Identities = 398/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||| ||||| ||| | ||  | || ||||||||||||||||||
Sbjct  14   TTCTGGGAGGTCATCTCCGACGAGCACGGCGTAGACCCGACTGGCGCCTACCACGGTGAC  73

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| ||||||||||||| || |||| ||| |||||  ||||||||||||||
Sbjct  74   TCTGACTTGCAGTTGGAGCGCATCAACGTTTACTTCAACGAGGCCACCGGTGGCAAGTAC  133

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| ||| | || ||  ||||||||||||||||||||||||| ||  | || 
Sbjct  134  GTGCCCCGCGCCGTCTTGGTTGACTTGGAGCCCGGCACCATGGACTCTGTCCGCGCCGGT  193

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| |||||||||||| | |||||||| |||
Sbjct  194  CCCTTCGGTCAGATCTTCCGCCCGGACAACTTCGTGTTCGGCCAGACTGGTGCCGGTAAC  253

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| |||||||| ||| || | ||||| ||||| || |||
Sbjct  254  AACTGGGCCAAGGGTCACTACACTGAGGGTGCCGAGTTGATCGACTCCGTGCTGGACGTT  313

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||||||   |||||||||||| || ||||||||  ||   ||||| || 
Sbjct  314  GTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCTGTCACTCTCTG  373

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || ||||| || ||||| || ||| ||||| ||||||||||||||||||||
Sbjct  374  GGTGGTGGTACCGGCTCTGGCATGGGCACTCTGTTGATTGCCAAGATCCGCGAGGAGTAC  433

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||  ||| | ||| |||||||| || ||||||||||| ||||| || 
Sbjct  434  CCCGACCGCATGATGTGCACTTTCTCCGTTGTGCCCTCCCCCAAGGTGTCCGACACTGTG  493

Query  481  GT  482
            ||
Sbjct  494  GT  495


>ref|XM_003281893.1| PREDICTED: Nomascus leucogenys tubulin beta-8 chain-like, transcript 
variant 1 (LOC100594805), mRNA
Length=1510

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||||||||| |||| | ||||  || | ||| |||||||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCCGATGAACATGCCGTCGACTCCGCTGGCACCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  118  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             ||||||||||||| || || ||||||||||| |||||||||||||||||||| || || 
Sbjct  178  ATGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCAGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  238  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | || |||
Sbjct  298  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  358  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  418  GGTGGGGGGACTGGGTCTGGGATGGGCACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  478  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_003279817.1| PREDICTED: Nomascus leucogenys tubulin beta-8 chain-like, transcript 
variant 2 (LOC100600563), mRNA
Length=1437

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||||||||| |||| | ||||  || | ||| |||||||||| |||
Sbjct  160  TTCTGGGAGGTGATCTCCGATGAACATGCCGTCGACTCCGCTGGCACCTACCACGGGGAC  219

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  220  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  279

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| || || 
Sbjct  280  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCAGGG  339

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  340  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  399

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | || |||
Sbjct  400  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  459

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  460  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  519

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  520  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  579

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| |||||||||||||| |||||||| 
Sbjct  580  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCAGACACCGTG  639

Query  481  GTGG  484
            ||||
Sbjct  640  GTGG  643


>ref|XM_003279816.1| PREDICTED: Nomascus leucogenys tubulin beta-8 chain-like, transcript 
variant 1 (LOC100600563), mRNA
Length=1507

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||||||||| |||| | ||||  || | ||| |||||||||| |||
Sbjct  127  TTCTGGGAGGTGATCTCCGATGAACATGCCGTCGACTCCGCTGGCACCTACCACGGGGAC  186

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  187  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  246

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| || || 
Sbjct  247  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCAGGG  306

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  307  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  366

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | || |||
Sbjct  367  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  426

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  427  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  486

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  487  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  546

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| |||||||||||||| |||||||| 
Sbjct  547  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCAGACACCGTG  606

Query  481  GTGG  484
            ||||
Sbjct  607  GTGG  610


>ref|XM_003279810.1| PREDICTED: Nomascus leucogenys tubulin, beta 2C (TUBB2C), mRNA
Length=1887

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 398/481 (83%), Gaps = 1/481 (0%)
 Strand=Plus/Plus

Query  4    TGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGC  63
            |||||| | |||  ||||||||| ||||||||  |||| ||| | |||||||| || |||
Sbjct  15   TGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCAC-TACCACGGGGATAGC  73

Query  64   GACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTG  123
            ||||||||||||||||||||||| ||||||||||| |||||  |||| ||||||||||||
Sbjct  74   GACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGCGGCAAGTACGTG  133

Query  124  CCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCT  183
            |||||||| || || || |||||||||||||||||||||||||| ||||| ||||| || 
Sbjct  134  CCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGGCCC  193

Query  184  TTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAAC  243
            ||||| ||||||||| |||| |||||||| || || || |||   ||||| || ||||||
Sbjct  194  TTCGGGCAGATCTTCCGGCCGGACAACTTCGTCTTTGGTCAGAGTGGTGCTGGGAACAAC  253

Query  244  TGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTC  303
            ||||||||||| || |||||||| || || |||||||||||||| ||| | |||||||| 
Sbjct  254  TGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGTTGGATGTTGTG  313

Query  304  CGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGC  363
             | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| || 
Sbjct  314  AGGAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTGGGT  373

Query  364  GGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCC  423
            || || ||||| || || ||||| ||||| || ||   ||||||||| ||||||||||| 
Sbjct  374  GGGGGGACTGGGTCTGGGATGGGCACCCTCCTCATCAGCAAGATCCGAGAGGAGTACCCA  433

Query  424  GACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGTG  483
            ||||||||||||||||| | |   || ||||| |||||||||||||| ||||| || |||
Sbjct  434  GACAGGATCATGAACACGTTCAGTGTGGTGCCTTCGCCCAAGGTGTCAGACACAGTGGTG  493

Query  484  G  484
            |
Sbjct  494  G  494


>tpg|BK007274.1| TPA_exp: Amblyomma variegatum beta-tubulin mRNA, partial cds
Length=686

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||||| |||||||||||||||||  | || |||  ||||||||| |||
Sbjct  58   TTCTGGGAGGTCATCTCGGATGAGCATGGCATCGACCCTACGGGCAGCTACCACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||| ||||| ||||||||||| ||||||||||||||||| ||||| |||||||| 
Sbjct  118  TCTGACCTCCAGCTCGAGCGCATCAACGTGTACTACAATGAGGCTTCCGGGGGCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  | || || || || || || |||||||||||||||||||| || |||
Sbjct  178  GTGCCACGTGCCATACTGGTGGACCTTGAACCAGGCACCATGGACTCTGTGCGGTCTGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||| ||||| | ||||||||||||||||| || |||   ||||||||||||
Sbjct  238  CCCTTTGGCCAGCTCTTCCGCCCCGACAACTTTGTGTTTGGTCAGAGTGGTGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| |||||||| || 
Sbjct  298  AACTGGGCCAAGGGCCACTACACAGAAGGCGCCGAGCTGGTGGACTCTGTGCTCGACGTC  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||| ||   ||| ||||| || || |||||||| || || |||||  | 
Sbjct  358  GTACGCAAGGAGGCAGAGGGCTGTGACTGTCTCCAGGGCTTCCAGCTGACCCACTCATTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| |||||||| || |||||||||||||||||||||
Sbjct  418  GGTGGCGGCACGGGGTCTGGCATGGGCACCCTGCTCATCTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |   || ||||| ||||| |||||||||||||| || 
Sbjct  478  CCTGACCGTATCATGAACACGTTCAGCGTGGTGCCCTCGCCTAAGGTGTCGGACACTGTC  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|NM_177987.2| Homo sapiens tubulin, beta 8 class VIII (TUBB8), transcript variant 
1, mRNA
Length=1504

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  118  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  178  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  238  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || || |||||| |||| |||||| | || |||
Sbjct  298  AACTGGGCCAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  358  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  418  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  478  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_001231209.1| PREDICTED: Gallus gallus similar to tubulin, beta 3 (LOC768337), 
mRNA
Length=1300

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||  ||||||||| ||||||||  ||||||||  ||||||||| |||
Sbjct  58   TTCTGGGAGGTCATCAGCGATGAGCACGGCATCGACCCCACCGGCAGCTACCACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||| | ||||| |||||||||||||| ||  |||||  |||||||
Sbjct  118  AGCGACCTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCTGCCGGTAACAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || || |||||||||||||| |||||||| ||||| || || 
Sbjct  178  GTCCCCCGTGCCATCCTGGTTGACCTGGAGCCCGGCACGATGGACTCGGTGCGCTCCGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||| | |||||||||||||| || || |||   || |||||||||
Sbjct  238  CCCTTTGGACAGATCTTCCGACCCGACAACTTTGTCTTTGGTCAGAGCGGGGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || ||||||||||||||||| ||||| ||||| 
Sbjct  298  AACTGGGCCAAGGGGCACTACACGGAAGGCGCTGAGCTGGTGGACTCTGTGCTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||| | |||  ||||||||||||||| ||||||||  | || ||||| || 
Sbjct  358  GTGAGGAAGGAGTCGGAAAGCTGCGACTGCCTGCAGGGCTTCCAGTTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| ||||| || ||   |||||||||||||||||||
Sbjct  418  GGCGGCGGCACCGGCTCGGGGATGGGCACCCTCCTCATCAGCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| || ||||||||||||||||| || 
Sbjct  478  CCCGACCGCATCATGAACACGTTCAGCGTCATGCCCTCCCCCAAGGTGTCGGACACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>dbj|AK235126.1| Sus scrofa mRNA, clone:OVRM10051G07, expressed in ovary
Length=1583

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||| ||||||||||||||| | |||||| |||||||||| |||
Sbjct  143  TTTTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACCTACCACGGGGAC  202

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||| ||||| ||||||||||| |||||  ||||||||||||||
Sbjct  203  AGCGACCTGCAGCTGGAGCGGATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAC  262

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||| || || || || || ||||| |||||||||||||| ||||| ||||| 
Sbjct  263  GTGCCTCGCGCCGTGCTCGTGGACCTTGAGCCGGGCACCATGGACTCCGTGCGCTCGGGG  322

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||| ||||||||| |||||||| || ||||| |||   |||||||| |||
Sbjct  323  CCCTTCGGGCAGACCTTCAGGCCGGACAACTTCGTCTTCGGTCAGAGTGGTGCCGGGAAC  382

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || ||||| || ||||| ||||| ||||| 
Sbjct  383  AACTGGGCCAAGGGGCACTACACAGAAGGCGCAGAGCTTGTCGACTCGGTGCTGGATGTC  442

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| |||||||| || || ||||| || 
Sbjct  443  GTGAGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  502

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| |||||||| ||   ||||||||| |||||||||
Sbjct  503  GGTGGGGGGACCGGGTCTGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAGGAGTAC  562

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| |||||||||||||||||||| || 
Sbjct  563  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACGGTG  622

Query  481  GTGG  484
            ||||
Sbjct  623  GTGG  626


>ref|XM_962174.1| PREDICTED: Tribolium castaneum similar to beta1-tubulin (LOC655614), 
mRNA
Length=1598

 Score =  489 bits (542),  Expect = 5e-135
 Identities = 399/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| |||||||| || ||||| ||||||||  ||||||||||||||||||| |||
Sbjct  133  TTCTGGGAAATCATCTCAGACGAGCACGGCATCGACCCCACCGGCGCCTACCACGGCGAC  192

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||| ||||  ||||||||||||| || ||||||||||| || ||||||||||| |||
Sbjct  193  TCCGACTTGCAATTGGAGCGCATCAACGTCTACTACAATGAAGCCTCCGGTGGCAAATAC  252

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || ||  |||||||||||||||||||||| || || || || 
Sbjct  253  GTCCCCCGTGCCATCCTCGTGGACTTGGAGCCCGGCACCATGGACTCAGTCCGTTCCGGT  312

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||||||||| ||| | ||||||||||| || ||||||||||| || ||||| |||
Sbjct  313  CCTTTCGGCCAGATTTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGAGCCGGAAAC  372

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || || || || ||||||||  | || || 
Sbjct  373  AACTGGGCCAAGGGCCACTACACAGAAGGCGCCGAACTAGTCGACTCAGTCTTGGACGTG  432

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||| |||||||| |||||||||||||| |||||||||||  | |||||||| |||
Sbjct  433  GTGCGCAAAGAGGCCGAGTCCTGCGACTGCCTCCAAGGCTTCCAGTTGACACACTCGCTT  492

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| |||||||| ||||| || || || || ||||| ||| | |||||||| 
Sbjct  493  GGGGGCGGCACCGGCTCCGGCATGGGCACTCTACTCATCTCCAAAATCAGGGAGGAGTAT  552

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||||| |||||||||||||| || || || || || || || || || || ||||| || 
Sbjct  553  CCCGATAGGATCATGAACACGTATTCAGTAGTACCTTCACCTAAAGTTTCCGACACGGTC  612

Query  481  GTGG  484
            ||||
Sbjct  613  GTGG  616


>ref|XM_003356513.2| PREDICTED: Sus scrofa tubulin beta-2A chain-like (LOC100624785), 
mRNA
Length=2022

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 397/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1     TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
             || |||||| |||||  ||| ||||||||||||||  |||| |||   ||||| || |||
Sbjct  547   TTTTGGGAGGTCATCAGCGACGAGCATGGCATCGACCCCACTGGCAGTTACCATGGCGAC  606

Query  61    AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
             |||||| ||||||||||| | ||||| |||||||||||||| ||  | |||  |||||| 
Sbjct  607   AGCGACTTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCCGCTGGTAACAAGTAT  666

Query  121   GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             |||||||| ||  |||| || ||||||||||| |||||||||||||| ||  | || |||
Sbjct  667   GTGCCCCGGGCCATCCTGGTGGATCTGGAGCCGGGCACCATGGACTCGGTCAGGTCTGGA  726

Query  181   CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             || ||||||||||||||||||||||||||||||||||||||||||   ||||||||||||
Sbjct  727   CCCTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGAGCGGTGCCGGCAAC  786

Query  241   AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
             |||||||||||||| || ||||| ||||| || |||||||||||||| || || || || 
Sbjct  787   AACTGGGCCAAGGGCCACTACACGGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  846

Query  301   GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
             ||| | |||||| | ||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  847   GTCAGGAAGGAGTCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  906

Query  361   GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
             || |||||||| |||||||| ||||| |||||||| |||  |||||||||||||||||||
Sbjct  907   GGGGGCGGCACGGGCTCCGGGATGGGCACCCTGCTCATTAGCAAGATCCGCGAGGAGTAC  966

Query  421   CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
             |||||| | ||||||||||| | |   ||  |||| || |||||||| |||||||| || 
Sbjct  967   CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCAAGGTCTCGGACACGGTG  1026

Query  481   GT  482
             ||
Sbjct  1027  GT  1028


>ref|XM_533934.3| PREDICTED: Canis lupus familiaris tubulin, beta 4 (TUBB4), mRNA
Length=1506

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||   |||||||||||||||||  |||| ||| | |||||||| |||
Sbjct  194  TTTTGGGAGGTGATCAGTGATGAGCATGGCATCGACCCCACGGGCACATACCACGGGGAC  253

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || |||||||||||| | ||||| || |||||||| |||||  | || || || || 
Sbjct  254  AGTGATCTGCAGCTGGAGAGAATCAACGTATACTACAACGAGGCCACAGGAGGAAATTAT  313

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||| | || || || || || |||||||| ||||||||||||||||| || || || 
Sbjct  314  GTTCCCAGAGCGGTGCTGGTGGACCTGGAGCCTGGCACCATGGACTCTGTTCGCTCCGGG  373

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||| |||| |||||||||||||| |||||||| || |||||||||
Sbjct  374  CCCTTCGGCCAGATCTTCCGGCCTGACAACTTTGTGTTTGGCCAGTCCGGAGCCGGCAAC  433

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||||||||| | || || || || 
Sbjct  434  AACTGGGCCAAGGGCCACTACACGGAGGGCGCCGAGCTGGTGGACGCGGTCCTGGACGTG  493

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||||||||   ||||||||||||||| |||||||| || || ||||| || 
Sbjct  494  GTGCGGAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTGACGCACTCGCTG  553

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| || ||||| ||   ||||||||||||||||| |
Sbjct  554  GGCGGCGGCACGGGCTCGGGCATGGGCACGCTGCTCATCAGCAAGATCCGCGAGGAGTTC  613

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || |||||||||||||||||||||||||| || 
Sbjct  614  CCGGACAGGATCATGAACACCTTCAGCGTGGTGCCGTCGCCCAAGGTGTCGGACACGGTG  673

Query  481  GTGG  484
            ||||
Sbjct  674  GTGG  677


>ref|XM_001496273.3| PREDICTED: Equus caballus tubulin beta-4 chain-like (LOC100065776), 
mRNA
Length=1719

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||   |||||||||||||| ||  |||||||| | |||||||| |||
Sbjct  433  TTTTGGGAGGTGATCAGTGATGAGCATGGCATTGACCCCACCGGCACTTACCACGGGGAC  492

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||||||||||||| | ||||| |||||||||||||||||  | || || || || 
Sbjct  493  AGTGACCTGCAGCTGGAGAGGATCAACGTGTACTACAATGAGGCCACAGGAGGAAATTAT  552

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||| | || || || || || |||||||| |||||||||||||| || || || || 
Sbjct  553  GTGCCCAGAGCCGTGCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCCGCTCCGGC  612

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||  |||| ||||||||||| ||||||||||| || |||||||||
Sbjct  613  CCCTTCGGCCAGATCTTTCGGCCTGACAACTTTGTTTTCGGCCAGTCCGGAGCCGGCAAC  672

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||| | || ||||| || 
Sbjct  673  AACTGGGCCAAGGGCCACTACACAGAGGGCGCGGAGCTGGTGGACGCCGTCCTCGACGTG  732

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||| |||||||| ||   |||||||||||| || |||||||| || || ||||| || 
Sbjct  733  GTCCGGAAGGAGGCGGAGAGCTGCGACTGCCTCCAGGGCTTCCAGCTGACCCACTCGCTG  792

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| ||||| || ||||| || ||||| ||   ||||||||| ||||||| |
Sbjct  793  GGCGGGGGCACGGGCTCGGGCATGGGCACGCTGCTCATCAGCAAGATCCGGGAGGAGTTC  852

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || ||||| |||||||||||||||||||| || 
Sbjct  853  CCGGACAGGATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACGGTG  912

Query  481  GTGG  484
            ||||
Sbjct  913  GTGG  916


>ref|XM_003281493.1| PREDICTED: Nomascus leucogenys tubulin beta-8 chain-like (LOC100592418), 
mRNA
Length=1314

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||||||||| |||| | ||||  || | ||| ||| |||||| |||
Sbjct  37   TTCTGGGAGGTGATCTCCGATGAACATGCCGTCGACTCCGCTGGCACCTGCCACGGGGAC  96

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  97   AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  156

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| || || 
Sbjct  157  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCAGGG  216

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| | ||||||  | ||||| ||||  || ||||| |||
Sbjct  217  CCCTTCGGGCAGATCTTCAGGCCGGTCAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  276

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | ||||||
Sbjct  277  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGATGTT  336

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  337  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  396

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  397  GGTGGGGGGACTGGGTCTGGGATGGGCACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  456

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| |||||||||||||| |||||||| 
Sbjct  457  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCAGACACCGTG  516

Query  481  GTGG  484
            ||||
Sbjct  517  GTGG  520


>dbj|AB491630.1| Pseudoscourfieldia marina Btub gene for beta-tubulin, partial 
cds, strain: NIES-1419
Length=1177

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 397/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||| ||||||||| || || ||  |||| ||  | |||||||| |||
Sbjct  22   TTCTGGGAGGTCATCTGCGATGAGCACGGAATTGACCCCACGGGAACGTACCACGGAGAC  81

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||| ||| ||||| || || ||    |||
Sbjct  82   AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTTCAACGAGGCCTCGGGAGGACGCTAC  141

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  ||||  | || || |||||||||||||||||||| || || ||||||
Sbjct  142  GTGCCCCGCGCCATCCTCATGGACCTCGAGCCCGGCACCATGGACTCCGTCCGCTCGGGA  201

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||| ||||||||| | ||||||||||| |||||||| ||| |||| |||||||||
Sbjct  202  CCCTACGGACAGATCTTCCGCCCCGACAACTTCGTGTTCGGACAGACGGGAGCCGGCAAC  261

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| ||||||||  | ||||| |||||||| || 
Sbjct  262  AACTGGGCCAAGGGACACTACACGGAGGGCGCTGAGCTCATCGACTCCGTGCTCGACGTC  321

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||| |||| || ||||||||||| || ||||||||  ||   ||||| || 
Sbjct  322  GTGCGCAAGGAGTCCGAGTCGTGCGACTGCCTCCAGGGCTTCCAGATCTGCCACTCGCTC  381

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            |||||||| |||||||||||||||||||| || || || |||||||||||||||||||||
Sbjct  382  GGCGGCGGAACTGGCTCCGGTATGGGAACGCTCCTCATCTCCAAGATCCGCGAGGAGTAC  441

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | || |||   || ||||| || ||||| || || |||||||| |||||||| 
Sbjct  442  CCTGACCGCATGATGGTGACGTACTCCGTCGTGCCCTCCCCGAAGGTGTCTGACACCGTC  501

Query  481  GT  482
            ||
Sbjct  502  GT  503


>ref|XM_002820461.1| PREDICTED: Pongo abelii tubulin beta-8 chain-like, transcript 
variant 1 (LOC100452363), mRNA
Length=1335

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| |||||||||| ||||||  || | ||| ||||||| || |||
Sbjct  58   TTCTGGGAGGTGATCTCTGATGAGCATGCCATCGACTCCGCTGGCACCTACCAGGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  118  AGCGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || |||||||||||||||||||||||||||||||| ||||  
Sbjct  178  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCTGTGCGCTCGGCG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| || || ||  | ||||| ||||  || ||||| |||
Sbjct  238  CCCTTCGGGCAGGTCTTCAGGCCAGATAATTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | || || 
Sbjct  298  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTC  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  358  GTCAGAAAGGAGGCTGAGAACTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  418  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  478  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_001998470.1| Drosophila mojavensis GI23599 (Dmoj\GI23599), mRNA
Length=1341

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||||| || |||||| |||| ||||| || ||  | ||  |||| |||
Sbjct  58   TTCTGGGAGGTCATCTCGGACGAGCATTGCATTGATGCTACGGGGACTTATTACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| |||||||||||||||||||||| ||||||||||||||  | |||| |||||| 
Sbjct  118  AGTGACTTGCAGCTGGAGCGCATCAATGTCTACTACAATGAGGCTACTGGTGCCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  | |||||||| |||||||| |||||||||||||||||||| ||||| 
Sbjct  178  GTGCCTCGGGCCATACTTGTCGACCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | ||||||||||||||| ||||||| |||||||| ||||||||||| || || ||||||
Sbjct  238  GCCTTCGGCCAGATCTTCCGGCCCGATAACTTTGTTTTCGGCCAGTCTGGCGCAGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| |||||||| |||||||| ||||| ||||| || || 
Sbjct  298  AACTGGGCCAAGGGTCACTACACCGAGGGTGCAGAGCTGGTTGACTCGGTGCTTGACGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||| | ||    ||||| || || || ||||| || || || |||||| | 
Sbjct  358  GTTCGCAAGGAGTCTGAGGGATGCGATTGTCTACAGGGCTTTCAGCTAACTCACTCCTTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || ||||| ||||| || ||||| ||||| || ||||| ||||| || || ||||| 
Sbjct  418  GGTGGGGGCACCGGCTCGGGCATGGGCACCCTACTCATTTCGAAGATACGTGAAGAGTAT  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||  | |||||||| || | ||| ||||| ||||| |||||||||||||||||||| 
Sbjct  478  CCCGATCGTATCATGAATACCTTCTCCGTTGTACCGTCACCCAAGGTGTCGGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|DQ113487.1| Pterosperma cristatum pctub1 beta-tubulin gene, partial cds
Length=1193

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 397/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||| ||||||||| || |||||  |||| ||| ||||||||||||||
Sbjct  19   TTTTGGGAGGTCATCTGCGATGAGCACGGTATCGACCCCACAGGCACCTACCACGGTGAC  78

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||||||||||||||||||||| || |||||||| ||||| |||||||||   |||
Sbjct  79   TCCGACCTGCAGCTGGAGCGCATCAACGTCTACTACAACGAGGCCTCCGGTGGCCGCTAC  138

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || |||||||||||  |  | || || |||||||| ||||||||||| || || || || 
Sbjct  139  GTTCCCCGCGCTGTGTTGATGGACCTCGAGCCCGGTACCATGGACTCCGTCCGCTCCGGC  198

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||| ||| | ||||||||||| |||||||||||| | || || || |||
Sbjct  199  CCCTACGGCCAGATTTTCCGCCCCGACAACTTCGTGTTCGGCCAGACCGGCGCTGGTAAC  258

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| ||||||||||||||| | ||||| || || || || 
Sbjct  259  AACTGGGCCAAGGGTCACTACACTGAGGGTGCTGAGCTGATTGACTCCGTCCTTGACGTC  318

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||| | || |||||||| ||||| || ||||||||  || | ||||| || 
Sbjct  319  GTCCGCAAGGAGTCAGAGTCCTGCGATTGCCTCCAGGGCTTCCAGGTCGCTCACTCTCTC  378

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || |||||||||||||||||||| || || |||||||| ||||||||||||
Sbjct  379  GGTGGCGGTACCGGCTCCGGTATGGGAACCCTCCTCATCTCCAAGATTCGCGAGGAGTAC  438

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||   || | ||| || ||||| || ||||||||||| |||||||| 
Sbjct  439  CCCGACCGTATGATGTTGACCTTCTCTGTCGTGCCCTCCCCCAAGGTGTCCGACACCGTG  498

Query  481  GT  482
            ||
Sbjct  499  GT  500


>ref|NM_001034663.1| Bos taurus tubulin, beta 2C (TUBB2C), mRNA
 gb|BC105181.1| Bos taurus tubulin, beta 2C, mRNA (cDNA clone MGC:128183 IMAGE:7898040), 
complete cds
Length=1586

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||| ||||||||||||||| | |||||| |||||||||| || 
Sbjct  146  TTTTGGGAGGTGATCAGCGACGAGCATGGCATCGATCCTACCGGCACCTACCACGGGGAT  205

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||||| ||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  206  AGCGACCTGCAGCTGGAGCGAATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  265

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || || |||||||| |||||||||||||||||||| ||||| 
Sbjct  266  GTGCCCCGCGCGGTGCTCGTGGACCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGC  325

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| |||||||||||||| ||||||||||| ||||| |||   || ||||| |||
Sbjct  326  CCTTTCGGGCAGATCTTCAGGCCGGACAACTTTGTCTTCGGTCAGAGCGGGGCCGGGAAC  385

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || || ||||| || ||||| ||||| || || 
Sbjct  386  AACTGGGCCAAGGGGCACTACACGGAAGGCGCAGAGCTCGTCGACTCGGTGCTGGACGTC  445

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||||||||| |||||||| || || |||||| | 
Sbjct  446  GTGAGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCCTTG  505

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   |||||| || |||||||| 
Sbjct  506  GGTGGGGGGACTGGGTCTGGGATGGGCACCCTCCTCATCAGCAAGATTCGGGAGGAGTAT  565

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || ||||| |||||||| ||||| |||||||| 
Sbjct  566  CCAGACAGGATCATGAACACTTTCAGCGTGGTGCCCTCGCCCAAAGTGTCAGACACCGTC  625

Query  481  GTGG  484
            ||||
Sbjct  626  GTGG  629


>gb|AF267189.1|AF267189 Reclinomonas americana clone 18 beta-tubulin gene, partial cds
Length=1240

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 373/442 (85%), Gaps = 0/442 (0%)
 Strand=Plus/Plus

Query  43   GGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAG  102
            ||| |||||||||||||||||||||| ||||||||||||||||| || ||||  || |||
Sbjct  134  GGCACCTACCACGGTGACAGCGACCTCCAGCTGGAGCGCATCAACGTCTACTTTAACGAG  193

Query  103  GCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATG  162
            ||| | || |||   || ||||||||||| |||||  | |||||||||||||||||||||
Sbjct  194  GCGACTGGCGGCCGCTATGTGCCCCGCGCCGTCCTGATGGATCTGGAGCCCGGCACCATG  253

Query  163  GACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGC  222
            |||||||| ||  | || || | ||||||| ||||| | |||||||||||||| ||||||
Sbjct  254  GACTCTGTCCGCGCCGGCCCCTACGGCCAGCTCTTCCGCCCCGACAACTTTGTCTTCGGC  313

Query  223  CAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTG  282
            ||| | || ||||||||||||||||||||||| || ||||| ||||| ||||||||| | 
Sbjct  314  CAGACTGGCGCCGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGCGCTGAGCTGATT  373

Query  283  GACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTC  342
            ||||| ||||||||||| || |||||||||||||| || |||||||||||||| ||||||
Sbjct  374  GACTCCGTGCTCGATGTGGTGCGCAAGGAGGCCGAGTCGTGCGACTGCCTGCAGGGCTTC  433

Query  343  CAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCC  402
            ||  |  | ||||| || || |||||||| |||||||| ||||| ||||| ||||| |||
Sbjct  434  CAGATTGCCCACTCGCTCGGTGGCGGCACCGGCTCCGGCATGGGCACCCTCCTGATCTCC  493

Query  403  AAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCC  462
            |||||||||||||||||||||||| | || |||  ||| | |||||| ||||| ||||||
Sbjct  494  AAGATCCGCGAGGAGTACCCCGACCGCATGATGCTCACGTTCTCGGTCGTGCCCTCGCCC  553

Query  463  AAGGTGTCGGACACCGTTGTGG  484
            |||||||| || ||||| ||||
Sbjct  554  AAGGTGTCTGATACCGTCGTGG  575


>gb|AF267187.1| Reclinomonas americana clone 12 beta-tubulin gene, partial cds
Length=1237

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 373/442 (85%), Gaps = 0/442 (0%)
 Strand=Plus/Plus

Query  43   GGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAG  102
            ||| |||||||||||||||||||||| ||||||||||||||||| || ||||  || |||
Sbjct  131  GGCACCTACCACGGTGACAGCGACCTCCAGCTGGAGCGCATCAACGTCTACTTTAACGAG  190

Query  103  GCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATG  162
            ||| | || |||   || ||||||||||| |||||  | |||||||||||||||||||||
Sbjct  191  GCGACTGGCGGCCGCTATGTGCCCCGCGCCGTCCTGATGGATCTGGAGCCCGGCACCATG  250

Query  163  GACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGC  222
            |||||||| ||  | || || | ||||||| ||||| | |||||||||||||| ||||||
Sbjct  251  GACTCTGTCCGCGCAGGCCCCTACGGCCAGCTCTTCCGCCCCGACAACTTTGTCTTCGGC  310

Query  223  CAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTG  282
            ||| | || ||||||||||||||||||||||| || ||||| ||||| ||||||||| | 
Sbjct  311  CAGACTGGCGCCGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGCGCTGAGCTGATT  370

Query  283  GACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTC  342
            ||||| ||||||||||| || |||||||||||||| || |||||||||||||| ||||||
Sbjct  371  GACTCCGTGCTCGATGTGGTGCGCAAGGAGGCCGAGTCTTGCGACTGCCTGCAGGGCTTC  430

Query  343  CAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCC  402
            ||  |  | ||||| || || |||||||| |||||||| ||||| ||||| ||||| |||
Sbjct  431  CAGATTGCCCACTCGCTCGGTGGCGGCACCGGCTCCGGCATGGGCACCCTCCTGATCTCC  490

Query  403  AAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCC  462
            |||||||||||||||||||||||| | || |||  ||| | |||||| ||||| ||||||
Sbjct  491  AAGATCCGCGAGGAGTACCCCGACCGCATGATGCTCACGTCCTCGGTCGTGCCCTCGCCC  550

Query  463  AAGGTGTCGGACACCGTTGTGG  484
            |||||||| || ||||| ||||
Sbjct  551  AAGGTGTCTGATACCGTCGTGG  572


>gb|AY729818.1| Isochrysis galbana beta-tubulin gene, partial cds
Length=1203

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 388/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |  |||| || ||||| ||||||||  | |||||| |||||||||| || 
Sbjct  22   TTCTGGGAGGTYGTCTCSGAYGAGCAYGGCATCGACCCSACCGGCACCTACCACGGCGAY  81

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||| ||||||||||||||||| ||||||||||| |||||| | || |||   |||
Sbjct  82   TCGGACCTCCAGCTGGAGCGCATCAACGTGTACTACAAYGAGGCGACGGGCGGCCGCTAC  141

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||||||  ||||  | || || ||||| |||||||||||||| || || ||||| 
Sbjct  142  GTRCCCCGCGCCATCCTGATGGACCTCGAGCCGGGCACCATGGACTCGGTCCGSTCGGGC  201

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||  | || ||||||||||| |||||||||||||| |||||||||
Sbjct  202  CCCTTYGGSCAGATCTTYCGCCCGGACAACTTTGTCTTCGGCCAGTCGGGCGCCGGCAAC  261

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||  | ||| | || ||||| || 
Sbjct  262  AACTGGGCCAAGGGCCACTACACCGAGGGCGCYGAGCTCATYGACGCYGTSCTCGACGTY  321

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||||||   ||||||||| || || ||||||   ||  | ||||| || 
Sbjct  322  GTGCGCAAGGAGGCCGAGGGCTGCGACTGYCTSCAGGGCTTCACMCTSKCGCACTCGCTK  381

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| |||||||| ||||| || || || || |||||||||||||||||||||
Sbjct  382  GGCGGCGGCACCGGCTCCGGCATGGGCACMCTSCTCATCTCCAAGATCCGCGAGGAGTAC  441

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| |  |||||  ||| ||||||||  | || ||||| |||||||| |||||||| 
Sbjct  442  CCCGACCGCGTCATGTGCACCTACTCGGTCTTCCCRTCGCCGAAGGTGTCAGACACCGTG  501

Query  481  GT  482
            ||
Sbjct  502  GT  503


>gb|M11442.1|CHKTUBB1 Chicken beta-1 tubulin gene, complete cds
Length=1338

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||  ||||||||| ||||||||  |||| |||  ||||||||| |||
Sbjct  58   TTCTGGGAGGTCATCAGCGATGAGCACGGCATCGACCCCACTGGCAGCTACCACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||| | ||||| |||||||||||||| ||  |||||  |||||||
Sbjct  118  AGCGACCTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCTGCCGGTAACAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || || |||||||||||||| |||||||| ||||| || || 
Sbjct  178  GTCCCCCGTGCCATCCTGGTTGACCTGGAGCCCGGCACGATGGACTCGGTGCGCTCCGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||| | |||||||||||||| || || |||   || |||||||||
Sbjct  238  CCCTTTGGACAGATCTTCCGACCCGACAACTTTGTCTTTGGTCAGAGCGGGGCCGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || ||||||||||||||||| ||||| ||||| 
Sbjct  298  AACTGGGCCAAGGGGCACTACACGGAAGGCGCTGAGCTGGTGGACTCTGTGCTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||| | |||  ||||||||||||||| ||||||||  | || ||||| || 
Sbjct  358  GTGAGGAAGGAGTCGGAAAGCTGCGACTGCCTGCAGGGCTTCCAGTTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| ||||| || ||   |||||||||||||||||||
Sbjct  418  GGCGGCGGCACCGGCTCGGGGATGGGCACCCTCCTCATCAGCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| || ||||||||||||||||| || 
Sbjct  478  CCCGACCGCATCATGAACACGTTCAGCGTCATGCCCTCCCCCAAGGTGTCGGACACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|M20420.1|DROTUBB2A D.melanogaster beta-2 tubulin mRNA, complete cds
Length=1870

 Score =  486 bits (538),  Expect = 7e-134
 Identities = 398/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  | || ||||| |||||  | ||| |||| || 
Sbjct  288  TTCTGGGAGGTAATCTCGGATGAGCACTGTATAGATGCGACCGGAACGTACTACGGCGAT  347

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || || |||||||||||||||||||| ||||||||||| ||  |||||| |||||| 
Sbjct  348  AGTGATCTCCAGCTGGAGCGCATCAATGTATACTACAATGAAGCCACCGGTGCCAAGTAT  407

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  | || || || |||||||||||||||||||| || || || || || 
Sbjct  408  GTGCCACGCGCAATTCTCGTGGACCTGGAGCCCGGCACCATGGATTCGGTTCGTTCTGGC  467

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || |||||||||||| |||| ||||| |||||||| ||||| ||||| || ||||||
Sbjct  468  GCCTTTGGCCAGATCTTCCGGCCGGACAATTTTGTGTTTGGCCAATCGGGAGCAGGCAAC  527

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| ||||||||||| |||||||| || ||  | ||||| 
Sbjct  528  AACTGGGCCAAGGGTCATTACACCGAGGGTGCTGAACTGGTGGATTCCGTCTTGGATGTG  587

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| ||||    ||||| ||||| || ||||||||    || ||||| || 
Sbjct  588  GTGCGAAAGGAGTCCGAGGGATGCGATTGCCTTCAGGGCTTCCAGTCGACCCACTCGCTG  647

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct  648  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGCTGATCTCGAAGATCCGCGAGGAGTAC  707

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |||||| ||||| |||||||||||||| || || || 
Sbjct  708  CCGGACCGCATCATGAACACCTTCTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  767

Query  481  GTGG  484
            ||||
Sbjct  768  GTGG  771


>dbj|AK240294.1| Sus scrofa mRNA, clone:UTR010051F07, expressed in uterus
Length=1638

 Score =  482 bits (534),  Expect = 8e-133
 Identities = 396/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||  ||| ||||||||||||||  |||| |||   ||||| || |||
Sbjct  135  TTTTGGGAGGTCATCAGCGACGAGCATGGCATCGACCCCACTGGCAGTTACCATGGCGAC  194

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||| ||||||||||| | ||||| |||||||||||||| ||  | |||  |||||| 
Sbjct  195  AGCGACTTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCCGCTGGTAACAAGTAT  254

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||  |||| || ||||||||||| |||||||||||||| ||  | || |||
Sbjct  255  GTGCCCCGGGCCATCCTGGTGGATCTGGAGCCGGGCACCATGGACTCGGTCAGGTCTGGA  314

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||||||||||||||||   ||||||||||||
Sbjct  315  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGAGCGGTGCCGGCAAC  374

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||||||||||| || || || || 
Sbjct  375  AACTGGGCCAAGGGCCACTACACGGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  434

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| | ||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  435  GTCAGGAAGGAGTCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  494

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| |||||||| ||||| |||| ||| |||  |||||||||||||||||||
Sbjct  495  GGGGGCGGCACGGGCTCCGGGATGGGCACCCCGCTCATTAGCAAGATCCGCGAGGAGTAC  554

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| || |||||||| |||||||| || 
Sbjct  555  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCAAGGTCTCGGACACGGTG  614

Query  481  GT  482
            ||
Sbjct  615  GT  616


>dbj|AK236779.1| Sus scrofa mRNA, clone:PBL010003G07, expressed in periphral blood 
mononuclear cell
Length=1515

 Score =  482 bits (534),  Expect = 8e-133
 Identities = 396/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||  ||| ||||||||||||||  |||| |||   ||||| || |||
Sbjct  26   TTTTGGGAGGTCATCAGCGACGAGCATGGCATCGACCCCACTGGCAGTTACCATGGCGAC  85

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||| ||||||||||| | ||||| |||||||||||||| ||  | |||  |||||| 
Sbjct  86   AGCGACTTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCCGCTGGTAACAAGTAT  145

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||  |||| || ||||||||||| |||||||||||||| ||  | || |||
Sbjct  146  GTGCCCCGGGCCATCCTGGTGGATCTGGAGCCGGGCACCATGGACTCGGTCAGGTCTGGA  205

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||||||||||||||||   ||||||||||||
Sbjct  206  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGAGCGGTGCCGGCAAC  265

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||||| || || || || 
Sbjct  266  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  325

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| | ||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  326  GTCAGGAAGGAGTCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  385

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| |||||||| ||   |||||||||||||||||||
Sbjct  386  GGGGGCGGCACGGGTTCGGGGATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTAC  445

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| ||||||||||| |||||||| || 
Sbjct  446  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTCTCGGACACGGTG  505

Query  481  GT  482
            ||
Sbjct  506  GT  507


>gb|DQ113488.1| Pterosperma cristatum pctub2 beta-tubulin gene, partial cds
Length=1193

 Score =  482 bits (534),  Expect = 8e-133
 Identities = 396/482 (83%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||| ||||||||| || |||||  |||| ||| ||||||||||||||
Sbjct  19   TTTTGGGAGGTCATCTGCGATGAGCACGGTATCGACCCCACAGGCACCTACCACGGTGAC  78

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||||||||||||||||||||| || |||||||| ||||| |||||||||   |||
Sbjct  79   TCCGACCTGCAGCTGGAGCGCATCAACGTCTACTACAACGAGGCCTCCGGTGGCCGCTAC  138

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || |||||||||||  |  | || || |||||||| ||||||||||| || || || || 
Sbjct  139  GTTCCCCGCGCTGTGTTGATGGACCTCGAGCCCGGTACCATGGACTCCGTCCGCTCCGGC  198

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||| ||| | ||||||||||| |||||||||||| | || ||||| |||
Sbjct  199  CCCTACGGCCAGATTTTCCGCCCCGACAACTTCGTGTTCGGCCAGACCGGCGCCGGTAAC  258

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| ||||||||||||||| | ||||| || || || || 
Sbjct  259  AACTGGGCCAAGGGTCACTACACCGAGGGTGCTGAGCTGATTGACTCCGTCCTTGACGTC  318

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||| | || |||||||| ||||| || ||||||||  || | || || || 
Sbjct  319  GTCCGCAAGGAGTCTGAGTCCTGCGATTGCCTCCAGGGCTTCCAGGTCGCTCATTCTCTG  378

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || ||||||||||||||||| || || || |||||||| ||||||||||||
Sbjct  379  GGTGGCGGTACCGGCTCCGGTATGGGAACTCTCCTCATCTCCAAGATTCGCGAGGAGTAC  438

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||   || | ||| || ||||| || ||||||||||| |||||||| 
Sbjct  439  CCCGACCGTATGATGTTGACCTTCTCTGTCGTGCCCTCCCCCAAGGTGTCCGACACCGTG  498

Query  481  GT  482
            ||
Sbjct  499  GT  500


>ref|XM_003280241.1| PREDICTED: Nomascus leucogenys tubulin beta-8 chain-like (LOC100595133), 
partial mRNA
Length=1125

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||||||||| |||| | ||||  || | ||| ||| |||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCCGATGAACATGCCGTCGACTCCGCTGGCACCTGCCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  118  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| || || 
Sbjct  178  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGTTCAGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  238  CCCTTCGGGCAGATCTTCAGGCCGGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | || |||
Sbjct  298  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  358  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  418  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| | |||||||||||| |||||||| 
Sbjct  478  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTTGCCCAAGGTGTCAGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002714359.1| PREDICTED: Oryctolagus cuniculus tubulin, beta 5-like (LOC100358689), 
mRNA
Length=2266

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||   |||||||| || |||||  |||||||| ||||||| || |||
Sbjct  223  TTCTGGGAGGTGATCAGTGATGAGCACGGGATCGACCCCACCGGCACCTACCATGGGGAC  282

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| ||||||   ||||||||||| || ||  | |||||||| || 
Sbjct  283  AGCGACCTGCAGCTGGACCGCATCTCCGTGTACTACAACGAAGCCACAGGTGGCAAATAT  342

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||| |||| || ||||| || || || ||||||||||||||||| || || 
Sbjct  343  GTCCCTCGTGCTATCCTGGTGGATCTAGAACCGGGAACCATGGACTCTGTGCGCTCAGGG  402

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||||||||||||||| || ||||||||||| || || ||||| || || ||||||
Sbjct  403  CCTTTCGGCCAGATCTTCAGACCAGACAACTTTGTTTTTGGTCAGTCCGGGGCAGGCAAC  462

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||| |||||||||||||| || 
Sbjct  463  AACTGGGCCAAGGGCCACTACACAGAGGGGGCAGAGCTGGTCGACTCAGTGCTCGACGTG  522

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||||| ||   ||| ||||||||||| |||||||| ||||| ||||| || 
Sbjct  523  GTGCGGAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTCACCCACTCGCTG  582

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| ||||| || ||||| |||||||| ||   ||||||||| || ||||||
Sbjct  583  GGTGGCGGCACGGGCTCTGGCATGGGCACCCTGCTCATCAGCAAGATCCGGGAAGAGTAC  642

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |   || || || |||||||||||||| |||||||| 
Sbjct  643  CCTGACCGCATCATGAACACCTTCAGCGTGGTACCCTCGCCCAAGGTGTCAGACACCGTG  702

Query  481  GTGG  484
            ||||
Sbjct  703  GTGG  706


>ref|XM_002104092.1| Drosophila simulans GD20798 (Dsim\GD20798), mRNA
Length=1341

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  | ||||| || |||||  | ||| |||| || 
Sbjct  58   TTCTGGGAGGTAATCTCGGATGAGCACTGTATCGACGCGACCGGAACGTACTACGGCGAT  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || || |||||||||||||||||||| ||||||||||||||  |||||| |||||| 
Sbjct  118  AGTGATCTCCAGCTGGAGCGCATCAATGTATACTACAATGAGGCCACCGGTGCCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || |||||  | || || || |||||||||||||||||||| || || || || || 
Sbjct  178  GTTCCACGCGCCATTCTCGTGGACCTGGAGCCCGGCACCATGGATTCGGTTCGCTCTGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || |||||||||||| |||| ||||||||||| || ||||| ||||| || ||||||
Sbjct  238  GCATTTGGCCAGATCTTCCGGCCGGACAACTTTGTCTTTGGCCAATCGGGGGCTGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| |||||||| || |||||||| || ||  | ||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACCGAGGGTGCCGAACTGGTGGATTCCGTCTTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| | ||   |||||| ||||| || |||||||| || || ||||| || 
Sbjct  358  GTGCGGAAGGAGTCGGAGGGCTGCGATTGCCTACAGGGCTTCCAGCTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| |||||||||||| |||| || ||||||||||||||||||
Sbjct  418  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTGTTGATCTCGAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| |  ||||| ||||| |||||||||||||| || || || 
Sbjct  478  CCGGACCGCATCATGAACACCTTTTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTA  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002031868.1| Drosophila sechellia GM26260 (Dsec\GM26260), mRNA
Length=1341

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||||||  | ||||| || |||||  | ||| |||| || 
Sbjct  58   TTCTGGGAGGTAATCTCGGATGAGCACTGTATCGACGCGACCGGAACGTACTACGGCGAT  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || || || |||||||||||||||||||| ||||||||||||||  |||||| |||||| 
Sbjct  118  AGTGATCTCCAGCTGGAGCGCATCAATGTATACTACAATGAGGCCACCGGTGCCAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || |||||  | || || || |||||||||||||||||||| || || || || || 
Sbjct  178  GTTCCACGCGCCATTCTCGTGGACCTGGAGCCCGGCACCATGGATTCGGTTCGCTCTGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || |||||||||||| |||| ||||||||||| || ||||| ||||| || ||||||
Sbjct  238  GCCTTTGGCCAGATCTTCCGGCCGGACAACTTTGTCTTTGGCCAATCGGGAGCAGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||||||||| |||||||| || |||||||| || ||  | ||||| 
Sbjct  298  AACTGGGCCAAGGGTCATTACACCGAGGGTGCCGAACTGGTGGATTCCGTCTTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| | ||   |||||| ||||| || ||||||||||| || ||||| || 
Sbjct  358  GTGCGGAAGGAGTCTGAGGGCTGCGATTGCCTACAGGGCTTCCAACTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||||||| |||||||||||  |||| || ||||||||||||||||||
Sbjct  418  GGTGGCGGCACTGGCTCCGGCATGGGAACCCTCTTGATCTCGAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| |  ||||| ||||| |||||||||||||| || || || 
Sbjct  478  CCGGACCGCATCATGAACACCTTTTCGGTGGTGCCCTCGCCCAAGGTGTCCGATACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|BC157066.1| Synthetic construct Homo sapiens clone IMAGE:100063286, MGC:190729 
tubulin, beta 8 (TUBB8) mRNA, encodes complete protein
Length=1396

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  92   TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  151

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  152  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  211

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  212  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGG  271

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  272  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  331

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||| || || || |||||| |||| |||||| | || |||
Sbjct  332  AACTGGGCTAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  391

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||| ||||| || ||||| || || |||||||| 
Sbjct  392  GTCAGAAAGGAGGCTGAGAGCTGTGACTGTCTGCAGGGTTTCCAGCTGACCCACTCCCTG  451

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  452  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  511

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  512  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  571

Query  481  GTGG  484
            ||||
Sbjct  572  GTGG  575


>gb|BC156319.1| Synthetic construct Homo sapiens clone IMAGE:100061779, MGC:190100 
tubulin, beta 8 (TUBB8) mRNA, encodes complete protein
Length=1396

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  92   TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  151

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  152  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  211

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  212  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGG  271

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  272  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  331

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||| || || || |||||| |||| |||||| | || |||
Sbjct  332  AACTGGGCTAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  391

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||| ||||| || ||||| || || |||||||| 
Sbjct  392  GTCAGAAAGGAGGCTGAGAGCTGTGACTGTCTGCAGGGTTTCCAGCTGACCCACTCCCTG  451

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  452  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  511

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  512  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  571

Query  481  GTGG  484
            ||||
Sbjct  572  GTGG  575


>gb|BC101271.1| Homo sapiens tubulin, beta 8, mRNA (cDNA clone IMAGE:40024142), 
partial cds
Length=1334

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  51   TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  110

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  111  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  170

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  171  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGG  230

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  231  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  290

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || || |||||| |||| |||||| | || |||
Sbjct  291  AACTGGGCCAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  350

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||| ||||| || ||||| || || |||||||| 
Sbjct  351  GTCAGAAAGGAGGCTGAGAGCTGTGACTGTCTGCAGGGTTTCCAGCTGACCCACTCCCTG  410

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  411  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  470

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| || |||||||||||||||||||| 
Sbjct  471  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCACCCAAGGTGTCGGACACCGTG  530

Query  481  GTGG  484
            ||||
Sbjct  531  GTGG  534


>gb|BC101270.2| Homo sapiens tubulin, beta 8, mRNA (cDNA clone IMAGE:40024141), 
partial cds
Length=1324

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 397/484 (83%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  51   TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  110

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  111  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  170

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  171  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGG  230

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  231  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  290

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||| || || || |||||| |||| |||||| | || |||
Sbjct  291  AACTGGGCTAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  350

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||| ||||| || ||||| || || |||||||| 
Sbjct  351  GTCAGAAAGGAGGCTGAGAGCTGTGACTGTCTGCAGGGTTTCCAGCTGACCCACTCCCTG  410

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  411  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  470

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  471  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  530

Query  481  GTGG  484
            ||||
Sbjct  531  GTGG  534


>gb|AY582851.1| Ministeria vibrans strain ATCC 50519 beta-tubulin-like mRNA, 
partial sequence
Length=1232

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 398/483 (83%), Gaps = 2/483 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||  ||||||| || |||||||| || ||  | || ||  | ||||| || |||
Sbjct  56   TTCTGGGAAGTCATCTCTGACGAGCATGGTATTGACCCGACGGGAACGTACCATGGCGAC  115

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||| ||| |||| || ||||| ||||||||||| |||||| | || |||||||||
Sbjct  116  TCGGACCTCCAGTTGGACCGAATCAACGTGTACTACAACGAGGCGACGGGCGGCAAGTAC  175

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCG-ATCGGG  179
            ||||| ||||| |||||||| ||||| ||||| ||||| |||||||| || || | ||| 
Sbjct  176  GTGCCGCGCGCGGTCCTTGTTGATCTCGAGCCAGGCACGATGGACTCCGTCCGTAGCGGT  235

Query  180  ACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAA  239
             ||||| |||||| ||||| | ||||||||||| || || || |||||||||||||||||
Sbjct  236  CCCTTT-GGCCAGCTCTTCCGCCCCGACAACTTCGTCTTTGGACAGTCGGGTGCCGGCAA  294

Query  240  CAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGT  299
            |||||||||||||||||| ||||| ||||| || ||||| || ||||| || ||||| ||
Sbjct  295  CAACTGGGCCAAGGGTCACTACACCGAGGGCGCCGAGCTCGTCGACTCCGTTCTCGACGT  354

Query  300  TGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCT  359
            |||||||||||||||||| || ||||||||||| || |||||||| ||||| ||||| ||
Sbjct  355  TGTCCGCAAGGAGGCCGAGTCGTGCGACTGCCTTCAGGGCTTCCAGCTCACCCACTCGCT  414

Query  360  TGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTA  419
            ||| || |||||||||||||| ||||| || ||||| ||   ||||||||||||||||||
Sbjct  415  TGGTGGTGGCACTGGCTCCGGCATGGGCACACTGCTCATCAGCAAGATCCGCGAGGAGTA  474

Query  420  CCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGT  479
            ||||||| | ||||||  ||| | ||| || ||||| |||||||||||    ||||||||
Sbjct  475  CCCCGACCGCATCATGGCCACCTTCTCCGTGGTGCCTTCGCCCAAGGTCAGCGACACCGT  534

Query  480  TGT  482
            |||
Sbjct  535  TGT  537


>gb|U22050.1|PCU22050 Phytophthora cinnamomi beta-tubulin gene, complete cds
Length=2220

 Score =  480 bits (532),  Expect = 3e-132
 Identities = 399/485 (83%), Gaps = 2/485 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||| ||||| ||| | ||  | || ||  |||||||||| |||
Sbjct  337  TTCTGGGAGGTCATCTCCGACGAGCACGGCGTGGACCCGACGGGATCCTACCACGGCGAC  396

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||||||||||||||| ||||||||||| |||||  | || |||   |||
Sbjct  397  TCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACGGGCGGCCGCTAC  456

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  ||||  | || ||||||||||||||||||||||| |||||  | || 
Sbjct  457  GTGCCCCGCGCCATCCTCATGGACCTGGAGCCCGGCACCATGGACTCGGTGCGCGCCGGC  516

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||| ||||| | || |||||||| |||||||||||| |||| ||||| |||
Sbjct  517  CCCTACGGCCAGCTCTTCCGCCCGGACAACTTCGTGTTCGGCCAGACGGGCGCCGGTAAC  576

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||  | ||||| ||||||||||| 
Sbjct  577  AACTGGGCCAAGGGACACTACACGGAGGGCGCCGAGCTCATCGACTCGGTGCTCGATGTC  636

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||| ||   ||||||||||||||| || |||||  |||| ||||| || 
Sbjct  637  GTCCGCAAGGAGGCGGAGAGCTGCGACTGCCTGCAGGGATTCCAGATCACGCACTCGCTC  696

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || || ||||||||||| || || || || ||||||||||| |||||||||
Sbjct  697  GGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGGAGTAC  756

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGGTGTCGGACACCGT  479
            || ||| | ||||||  ||| ||||||| |||| ||||||||||||||||||||||| ||
Sbjct  757  CCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGTCGCCCAAGGTGTCGGACACGGT  815

Query  480  TGTGG  484
             ||||
Sbjct  816  CGTGG  820


>emb|Z67992.1| Oomycete-like MacKay2000 TubB2 mRNA for beta-tubulin
Length=1381

 Score =  479 bits (530),  Expect = 1e-131
 Identities = 387/468 (83%), Gaps = 0/468 (0%)
 Strand=Plus/Plus

Query  17   CCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGG  76
            |||| ||||| ||| | ||  |||||||  ||||||| || |||  |||| ||||| |||
Sbjct  1    CCGACGAGCACGGCGTGGACCCCACCGGTACCTACCATGGCGACTCCGACTTGCAGTTGG  60

Query  77   AGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCC  136
            |||||||||| ||||||||||| |||||  |||| |||   ||||||||||||||  |||
Sbjct  61   AGCGCATCAACGTGTACTACAACGAGGCCACCGGCGGCCGCTACGTGCCCCGCGCCATCC  120

Query  137  TTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCT  196
            |  | ||  |||||||||| ||||||||||| || ||  | || || ||||||||| |||
Sbjct  121  TGATGGACTTGGAGCCCGGAACCATGGACTCCGTCCGTGCCGGCCCCTTCGGCCAGCTCT  180

Query  197  TCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTC  256
            || | ||||||||||| |||||||||||| | |||||||| ||||||||||||||||| |
Sbjct  181  TCCGCCCCGACAACTTCGTGTTCGGCCAGACCGGTGCCGGTAACAACTGGGCCAAGGGCC  240

Query  257  ATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCG  316
            | ||||| ||||| || |||||  | ||||| ||| | || |||||||||||||||||||
Sbjct  241  ACTACACCGAGGGCGCCGAGCTCATCGACTCCGTGTTGGACGTTGTCCGCAAGGAGGCCG  300

Query  317  AATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCT  376
            | |||||||| |||||||| ||||||||  |||| |||||||| || |||||||||||||
Sbjct  301  AGTCCTGCGATTGCCTGCAGGGCTTCCAGATCACCCACTCCCTGGGTGGCGGCACTGGCT  360

Query  377  CCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGA  436
            |||| ||||| ||||||||||| ||||||||||||||||||||||||||| |  ||||| 
Sbjct  361  CCGGCATGGGCACCCTGCTGATCTCCAAGATCCGCGAGGAGTACCCCGACCGCGTCATGC  420

Query  437  ACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGTGG  484
              || | ||| ||    ||||| |||||||||||||||||||||||||
Sbjct  421  TGACCTTCTCCGTCTGCCCGTCCCCCAAGGTGTCGGACACCGTTGTGG  468


>ref|XM_003204777.1| PREDICTED: Meleagris gallopavo tubulin beta-2 chain-like (LOC100543297), 
mRNA
Length=1687

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||   ||||||||||| || ||  |||| |||  |||||| || |||
Sbjct  142  TTCTGGGAGGTCATCAGTGATGAGCATGGGATTGACCCCACTGGCAGCTACCATGGGGAC  201

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||| | ||||| |||||||||||||| ||  |||||  |||||||
Sbjct  202  AGCGACCTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCTGCCGGTAACAAGTAC  261

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || || |||||||||||||| |||||||| ||||| || || 
Sbjct  262  GTCCCCCGTGCCATCCTGGTTGACCTGGAGCCCGGCACAATGGACTCGGTGCGCTCCGGC  321

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||| | |||||||||||||| || || |||   || |||||||||
Sbjct  322  CCCTTTGGACAGATCTTCCGACCCGACAACTTTGTCTTTGGTCAGAGCGGGGCCGGCAAC  381

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || |||||||||||||||||||| ||||| || || 
Sbjct  382  AACTGGGCCAAGGGGCACTACACCGAAGGTGCTGAGCTGGTGGACTCCGTGCTGGACGTG  441

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||| | |||  ||||||||||||||| ||||||||  | || ||||| || 
Sbjct  442  GTGAGGAAGGAGTCGGAAAGCTGCGACTGCCTGCAGGGCTTCCAGTTGACCCACTCGCTG  501

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| |||||||| ||   |||||||||||||||||||
Sbjct  502  GGCGGCGGCACCGGCTCGGGGATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTAC  561

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| || ||||||||||||||||| || 
Sbjct  562  CCCGACCGCATCATGAACACGTTCAGCGTCATGCCCTCTCCCAAGGTGTCGGACACGGTG  621

Query  481  GTGG  484
            ||||
Sbjct  622  GTGG  625


>ref|XM_002720954.1| PREDICTED: Oryctolagus cuniculus tubulin, beta 2 (LOC100349792), 
mRNA
Length=1570

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||   ||||| || ||||||||  ||||||||   ||||| || |||
Sbjct  116  TTCTGGGAGGTCATCAGTGATGAACACGGCATCGACCCCACCGGCAGTTACCATGGCGAC  175

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||| ||||||||||| | ||||| ||||||||||| |||||  | ||   |||||||
Sbjct  176  AGCGACTTGCAGCTGGAGAGGATCAACGTGTACTACAACGAGGCCGCAGGCAACAAGTAC  235

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || || ||||||||||||||||||||||| ||  | ||||||
Sbjct  236  GTCCCCCGGGCCATCCTGGTGGACCTGGAGCCCGGCACCATGGACTCGGTCAGGTCGGGA  295

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||| ||||| |||||    || || || |||
Sbjct  296  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTCGTGTTTGGCCAAAGCGGGGCTGGGAAC  355

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||||||||||| ||||| || || 
Sbjct  356  AACTGGGCCAAGGGCCACTACACGGAGGGGGCCGAGCTGGTGGACTCGGTGCTGGACGTG  415

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||  ||||   ||||||||||||||| |||||||| || || ||||| || 
Sbjct  416  GTGAGGAAGGAATCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  475

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| |||||||| ||   |||||||||||||||||||
Sbjct  476  GGCGGCGGCACGGGCTCGGGCATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTAC  535

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| |||||||||||||| |||||||| 
Sbjct  536  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCCGACACCGTG  595

Query  481  GTGG  484
            ||||
Sbjct  596  GTGG  599


>ref|XM_002602687.1| Branchiostoma floridae hypothetical protein, mRNA
Length=1933

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| || ||||| ||||||||  |||||||| | |||||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCAGACGAGCACGGCATCGACCCCACCGGCACGTACCACGGAGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              || ||||||||||||| | |||| ||| ||||||||||| ||    ||||||||||||
Sbjct  118  TCCGTCCTGCAGCTGGAGAGGATCAGTGTTTACTACAATGAAGCCAGTGGTGGCAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||||||| | || || || ||||| ||||||||||||||||| || || || |||
Sbjct  178  GTTCCCCGCGCTATTCTGGTGGACCTGGAACCCGGCACCATGGACTCCGTACGGTCAGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| || ||||| |||   ||||| || |||
Sbjct  238  CCCTTCGGACAGATCTTCCGCCCAGACAACTTCGTCTTCGGTCAGAGCGGTGCAGGGAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||||||||||| ||| | || || 
Sbjct  298  AACTGGGCCAAGGGCCACTACACGGAGGGGGCGGAGCTGGTGGACTCCGTGATGGACGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||| ||| | ||   ||||||| | ||||| |||||||| || || ||||| || 
Sbjct  358  GTGCGCAAAGAGTCGGAGAGCTGCGACAGTCTGCAGGGCTTCCAGCTGACCCACTCGCTC  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| |||||||| ||||| ||||| || || |||||||||||||||||||||
Sbjct  418  GGCGGCGGCACCGGCTCCGGCATGGGCACCCTCCTCATCTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | |||||||||||||  || || ||||| || ||||| ||||||||||| || 
Sbjct  478  CCCGACCGCATCATGAACACATTTTCCGTCGTGCCTTCCCCCAAAGTGTCGGACACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|BT060171.1| Salmo salar clone ssal-rgh-507-117 Tubulin beta-1 chain putative 
mRNA, complete cds
Length=1584

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||   || ||||||||||| ||  | || ||  | ||||| || |||
Sbjct  115  TTCTGGGAGGTGATCAGTGACGAGCATGGCATTGACCCAACTGGTACATACCATGGGGAC  174

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||| ||||| ||  | || ||||||||||||||||| || || ||||| || |||
Sbjct  175  AGTGACCTCCAGCTAGATAGAATTAATGTGTACTACAATGAAGCTTCAGGTGGTAAATAC  234

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| ||||||||  ||||||| || ||||||||||||||| |||| |||
Sbjct  235  GTGCCCCGCGCTGTGCTTGTCGACTTGGAGCCAGGGACCATGGACTCTGTGAGATCCGGA  294

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||| || |||||||||||||||||||||   ||||| || |||
Sbjct  295  CCCTTCGGCCAGATCTTCAGACCTGACAACTTTGTGTTCGGCCAGAGTGGTGCTGGAAAC  354

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct  355  AACTGGGCCAAGGGCCACTACACAGAGGGAGCTGAGCTGGTGGACTCAGTCCTGGATGTT  414

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | || ||||| ||   ||| ||||| ||||| |||||||| ||||| |||||||| 
Sbjct  415  GTGAGGAAAGAGGCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTCACCCACTCCCTG  474

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || |||||||| || ||||| |||||||| ||   ||||||||| || ||||||
Sbjct  475  GGAGGTGGAACTGGCTCTGGCATGGGCACCCTGCTCATCAGCAAGATCCGTGAAGAGTAC  534

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| || ||||| || || ||||| |||
Sbjct  535  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCACCCAAAGTATCAGACACTGTT  594

Query  481  GTGG  484
            ||||
Sbjct  595  GTGG  598


>gb|BT058464.1| Salmo salar clone Contig1066 Tubulin beta-1 chain putative mRNA, 
complete cds
Length=1584

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||   || ||||||||||| ||  | || ||  | ||||| || |||
Sbjct  115  TTCTGGGAGGTGATCAGTGACGAGCATGGCATTGACCCAACTGGTACATACCATGGGGAC  174

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||| ||||| ||  | || ||||||||||||||||| || || ||||| || |||
Sbjct  175  AGTGACCTCCAGCTAGATAGAATTAATGTGTACTACAATGAAGCTTCAGGTGGTAAATAC  234

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| ||||||||  ||||||| || ||||||||||||||| |||| |||
Sbjct  235  GTGCCCCGCGCTGTGCTTGTCGACTTGGAGCCAGGGACCATGGACTCTGTGAGATCCGGA  294

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||| || |||||||||||||||||||||   ||||| || |||
Sbjct  295  CCCTTCGGCCAGATCTTCAGACCTGACAACTTTGTGTTCGGCCAGAGTGGTGCTGGAAAC  354

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct  355  AACTGGGCCAAGGGCCACTACACAGAGGGAGCTGAGCTGGTGGACTCAGTCCTGGATGTT  414

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | || ||||| ||   ||| ||||| ||||| |||||||| ||||| |||||||| 
Sbjct  415  GTGAGGAAAGAGGCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTCACCCACTCCCTG  474

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || |||||||| || ||||| |||||||| ||   ||||||||| || ||||||
Sbjct  475  GGAGGTGGAACTGGCTCTGGCATGGGCACCCTGCTCATCAGCAAGATCCGTGAAGAGTAC  534

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| || ||||| || || ||||| |||
Sbjct  535  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCACCCAAAGTATCAGACACTGTT  594

Query  481  GTGG  484
            ||||
Sbjct  595  GTGG  598


>ref|XM_001357805.2| Drosophila pseudoobscura pseudoobscura GA21728 (Dpse\GA21728), 
mRNA
Length=1341

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | || || || |||||  | || |||||||||||| | ||| |||| |||
Sbjct  58   TTTTGGGAGGTAATATCTGACGAGCACTGTATAGATGCCACCGGCACGTACTACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||  ||||  ||||||| || |||||||||||||| |||||| | || |  ||||| 
Sbjct  118  AGTGATTTGCAATTGGAGCGAATAAATGTGTACTACAACGAGGCGACAGGAGCGAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || |||||  | |||||||| |||||||||||||||||||| || ||||| || || 
Sbjct  178  GTACCACGCGCCATTCTTGTCGACCTGGAGCCCGGCACCATGGATTCGGTGCGCTCTGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | || || || |||||| |||||||||||||||| || || |||||||| || ||||||
Sbjct  238  GCATTTGGTCAAATCTTCCGGCCCGACAACTTTGTCTTTGGGCAGTCGGGGGCGGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || || |||||||||||||| ||||| ||||| 
Sbjct  298  AACTGGGCCAAGGGACACTACACGGAAGGGGCCGAGCTGGTGGACTCTGTGCTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| | ||   ||| || || ||||| |||||||| || || ||||| || 
Sbjct  358  GTGCGAAAGGAGTCGGAGGGCTGTGATTGTCTGCAGGGCTTCCAGCTGACTCACTCGCTC  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| ||||| |||||||| ||||||||||| |||||||||||||||||||||
Sbjct  418  GGCGGAGGCACCGGCTCGGGTATGGGCACCCTGCTGATCTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||| | |||||| ||||| |||||||| ||||||||||| || 
Sbjct  478  CCCGACAGAATCATGAACACCTTCTCGGTGGTGCCATCGCCCAAAGTGTCGGACACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|EF577191.1| Spumella-like flagellate JBNA45 beta-tubulin gene, partial cds
Length=1066

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||| | ||| ||  | ||  |||||||  |||||||||| |||
Sbjct  5    TTCTGGGAGGTCATCTCCGACGGGCACGGTGTTGACCCCACCGGAACCTACCACGGCGAC  64

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||||||||||||| | ||||| ||||||| ||| |||||  |||| |||   |||
Sbjct  65   TCCGACCTGCAGCTGGAGAGAATCAACGTGTACTTCAACGAGGCCACCGGCGGCCGCTAC  124

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||  ||||  | |||||||||||||| ||||||||||| || ||  | || 
Sbjct  125  GTGCCCCGTGCCATCCTGATGGATCTGGAGCCCGGAACCATGGACTCCGTCCGTGCCGGT  184

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||| | ||||| ||||||||| | |||||||| ||| | |||||||| |||
Sbjct  185  CCCTTCGGCCAGCTGTTCAGACCCGACAACCTCGTGTTCGGTCAGACCGGTGCCGGAAAC  244

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||| |||||| | ||||| ||||| || || 
Sbjct  245  AACTGGGCCAAGGGCCACTACACCGAGGGTGCCGAGCTGATCGACTCCGTGCTGGACGTG  304

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||| ||||||||||||||||| |||||||| || || |||||| | 
Sbjct  305  GTCCGCAAGGAGGCCGAGTCCTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCCATG  364

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || |||||||||||||| ||||||||||| ||||||||| | |||||||||
Sbjct  365  GGTGGTGGAACCGGCTCCGGTATGGGCACCCTGCTGATCTCCAAGATCAGAGAGGAGTAC  424

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| |  | |||  ||| ||||| ||  | || || ||||||||||| |||||||| 
Sbjct  425  CCCGACCGTGTGATGTCCACCTACTCCGTGATTCCCTCCCCCAAGGTGTCCGACACCGTG  484

Query  481  GTGG  484
            ||||
Sbjct  485  GTGG  488


>gb|AF267190.1|AF267190 Reclinomonas americana clone 22 beta-tubulin gene, partial cds
Length=1232

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 371/442 (84%), Gaps = 0/442 (0%)
 Strand=Plus/Plus

Query  43   GGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAG  102
            ||| |||||||||||||||||||||| ||||||||||||||||| || |||| ||| |||
Sbjct  126  GGCACCTACCACGGTGACAGCGACCTCCAGCTGGAGCGCATCAACGTCTACTTCAACGAG  185

Query  103  GCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATG  162
            ||| | || |||   || ||||||||||| |||||  | |||||||||||||||||||||
Sbjct  186  GCGACTGGCGGCCGCTATGTGCCCCGCGCCGTCCTGATGGATCTGGAGCCCGGCACCATG  245

Query  163  GACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGC  222
            |||||||| ||  | || || |  |||||| ||||| | |||||||||||||| || |||
Sbjct  246  GACTCTGTCCGCGCCGGCCCCTATGGCCAGCTCTTCCGCCCCGACAACTTTGTCTTTGGC  305

Query  223  CAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTG  282
            ||| | || ||||||||||||||||||||||| || ||||| ||||| |||||| || | 
Sbjct  306  CAGACTGGCGCCGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGCGCTGAGTTGATT  365

Query  283  GACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTC  342
            ||||| ||||||||||| || |||||||||||||| || |||||||||||||| ||||||
Sbjct  366  GACTCCGTGCTCGATGTGGTGCGCAAGGAGGCCGAGTCTTGCGACTGCCTGCAGGGCTTC  425

Query  343  CAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCC  402
            ||  |  | ||||| || || |||||||| |||||||| ||||| ||||| ||||| |||
Sbjct  426  CAGATTGCCCACTCGCTCGGTGGCGGCACCGGCTCCGGCATGGGCACCCTCCTGATCTCC  485

Query  403  AAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCC  462
            |||||||||||||||||||||||| | || |||  ||| | |||||| ||||| ||||||
Sbjct  486  AAGATCCGCGAGGAGTACCCCGACCGCATGATGCTCACGTTCTCGGTCGTGCCCTCGCCC  545

Query  463  AAGGTGTCGGACACCGTTGTGG  484
            |||||||| || ||||| ||||
Sbjct  546  AAGGTGTCTGATACCGTCGTGG  567


>ref|NM_205315.1| Gallus gallus tubulin, beta 2A (TUBB2A), mRNA
 emb|X07011.1| Chicken mRNA for c(beta)7 tubulin
Length=2878

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||| ||||| ||||||||  |||| ||| ||||||| || |||
Sbjct  149  TTTTGGGAGGTGATCAGCGACGAGCACGGCATCGACCCCACGGGCACCTACCATGGGGAC  208

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||  || ||||||||||||||  | || || || || 
Sbjct  209  AGCGACCTGCAGCTGGACCGCATCAGCGTCTACTACAATGAGGCCACTGGCGGTAAATAT  268

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || || ||||||||||||||||||||||| ||||| ||||||
Sbjct  269  GTGCCACGAGCCATCCTGGTGGACCTGGAGCCCGGCACCATGGACTCGGTGCGCTCGGGA  328

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| ||||| ||||| || || || |||   || |||||||||
Sbjct  329  CCCTTCGGGCAGATCTTCAGACCCGATAACTTCGTTTTTGGGCAGAGCGGGGCCGGCAAC  388

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||| || || ||||| ||||| || |||||||||||||| ||||| || || 
Sbjct  389  AACTGGGCCAAAGGGCACTACACGGAGGGGGCCGAGCTGGTGGACTCGGTGCTGGACGTG  448

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||||| ||   ||||||||||||||| |||||||| || || ||||| || 
Sbjct  449  GTGCGGAAGGAGGCGGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  508

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| ||||| || ||||| ||||| ||||| ||||| |||||||||||||||
Sbjct  509  GGGGGCGGCACGGGCTCGGGGATGGGGACCCTCCTGATCTCCAAAATCCGCGAGGAGTAC  568

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |   || |||||||| || |||||||||||||| || 
Sbjct  569  CCGGACCGCATCATGAACACCTTCAGCGTGGTGCCGTCCCCGAAGGTGTCGGACACGGTG  628

Query  481  GTGG  484
            ||||
Sbjct  629  GTGG  632


>ref|NM_001244101.1| Cricetulus griseus tubulin, beta 5 class I (Tubb5), mRNA
 gb|U08342.1|CGU08342 Cricetulus griseus beta-tubulin isotype I mRNA, complete cds
Length=1664

 Score =  477 bits (528),  Expect = 3e-131
 Identities = 396/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  |||||| || ||||||||  |||||||  |||||||||| |||
Sbjct  194  TTCTGGGAGGTGATCAGCGATGAACACGGCATCGACCCCACCGGTACCTACCACGGAGAC  253

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||| |||| || |||  ||||||||||||||| ||  | ||||||||||| 
Sbjct  254  AGCGACCTGCAGTTGGACCGAATCTCTGTGTACTACAATGAAGCCACAGGTGGCAAGTAT  313

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||| || | || ||||| || ||||| ||||||||||| || ||||| || 
Sbjct  314  GTCCCTCGAGCTATCTTGGTGGATCTAGAACCCGGGACCATGGACTCCGTTCGATCAGGT  373

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||||||||||||||| || ||||||||||| ||||| ||||| || || ||||||
Sbjct  374  CCTTTCGGCCAGATCTTCAGACCAGACAACTTTGTTTTCGGTCAGTCTGGGGCAGGCAAC  433

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| |||||||| ||||| ||||| ||||||||||| ||||| || || ||||| 
Sbjct  434  AACTGGGCTAAGGGTCACTACACCGAGGGAGCTGAGCTGGTTGACTCCGTCCTGGATGTG  493

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||||| ||   ||| ||||||||||| ||||| || || || ||||| || 
Sbjct  494  GTTCGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTTCAGCTGACCCACTCACTG  553

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| || ||||||||||| |||||||| ||   |||||||||||| || |||
Sbjct  554  GGCGGAGGCACCGGTTCCGGTATGGGCACCCTGCTCATCAGCAAGATCCGCGAAGAATAC  613

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| ||||||||||||| | |   || || || || ||||| ||||| |||||||| 
Sbjct  614  CCCGACCGGATCATGAACACCTTCAGCGTCGTACCTTCTCCCAAAGTGTCCGACACCGTG  673

Query  481  GTGG  484
            ||||
Sbjct  674  GTGG  677


>dbj|AB576857.1| Tsukubamonas globosa mRNA for beta tubulin, partial cds, clone: 
2
Length=1430

 Score =  473 bits (524),  Expect = 4e-130
 Identities = 394/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||  |||| ||||| ||||| ||| | ||| |||||||| |||||||||| |||
Sbjct  8    TTTTGGGAAGTCATTTCCGACGAGCACGGCGTTGATCCCACCGGCACCTACCACGGAGAC  67

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||| ||| ||||||||||||| ||||||||||| |||||  |||||||    |||
Sbjct  68   TCTGACCTCCAGTTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGACGCTAC  127

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||  ||||  | ||||| ||||||||||||||||| || || ||  | |||
Sbjct  128  GTCCCTCGTGCCATCCTCATGGATCTTGAGCCCGGCACCATGGATTCCGTCCGTGCTGGA  187

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||| ||||||||||||||||||||||||||| || |||||||||   || |||||||||
Sbjct  188  CCTTACGGCCAGATCTTCAGGCCCGACAACTTCGTTTTCGGCCAGAGCGGCGCCGGCAAC  247

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| ||||||||||||||  | ||||| || |||||||| 
Sbjct  248  AACTGGGCCAAGGGTCACTACACTGAGGGTGCTGAGCTCATCGACTCCGTCCTCGATGTC  307

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||||||||| |||||||| ||||| || ||||||||  |  | |||||||| 
Sbjct  308  GTCCGCAAGGAGGCCGAGTCCTGCGATTGCCTCCAGGGCTTCCAGATTGCTCACTCCCTC  367

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || ||||||||||| || ||||| ||||| || || |||||||||||||||||||||
Sbjct  368  GGTGGTGGCACTGGCTCTGGCATGGGCACCCTCCTCATCTCCAAGATCCGCGAGGAGTAC  427

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||  | || |||  ||| | ||| ||  | || || ||||||||||| |||||||| 
Sbjct  428  CCCGATCGCATGATGCTCACTTTCTCCGTCTTCCCTTCACCCAAGGTGTCCGACACCGTC  487

Query  481  GT  482
            ||
Sbjct  488  GT  489


>gb|EF432477.1| Prasinophyte sp. SL-175 clone H1 beta tubulin (btub) mRNA, partial 
cds
Length=1128

 Score =  473 bits (524),  Expect = 4e-130
 Identities = 394/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||| ||||||||| ||||||||  |||||||| ||||   ||| |||
Sbjct  34   TTCTGGGAGGTCATCTGCGATGAGCACGGCATCGACCCCACCGGCACCTATTGCGGGGAC  93

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||| ||||||||||| || || ||||| ||||||||||| |||   |||
Sbjct  94   TCCGACCTCCAGCTCGAGCGCATCAACGTTTATTACAACGAGGCGTCCGGCGGCCGCTAC  153

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||| || ||  | ||||| |||||||| ||||||||||||||||| || || 
Sbjct  154  GTGCCGCGCGCCGTGCTGATGGATCTCGAGCCCGGAACCATGGACTCTGTGCGCTCCGGC  213

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || ||||| |||||| | ||||||||||| || ||||||||  |||| |||||||||
Sbjct  214  CCCTTTGGCCAAATCTTCCGCCCCGACAACTTCGTCTTCGGCCAAACGGGCGCCGGCAAC  273

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||||||||| |||||| | || || ||| | ||||||
Sbjct  274  AACTGGGCCAAGGGGCACTACACAGAGGGTGCAGAGCTGATCGATTCGGTGTTGGATGTT  333

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||| |||| || |||||||||||||| || |||||  |    ||||| || 
Sbjct  334  GTGCGCAAGGAGTCCGAGTCGTGCGACTGCCTGCAGGGGTTCCAGGTGTGCCACTCGCTG  393

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| || || ||||| || ||||| || ||||| || ||||| |||||||||||||||
Sbjct  394  GGCGGTGGAACCGGCTCGGGAATGGGCACGCTGCTCATCTCCAAAATCCGCGAGGAGTAC  453

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | || |||  ||| | ||| || |||||||||||||||||||| |||||||| 
Sbjct  454  CCTGACCGCATGATGCTCACCTTCTCCGTGGTGCCGTCGCCCAAGGTGTCCGACACCGTG  513

Query  481  GT  482
            ||
Sbjct  514  GT  515


>dbj|AK283039.1| Gryllus bimaculatus mRNA, GBcontig29900
Length=1267

 Score =  473 bits (524),  Expect = 4e-130
 Identities = 394/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Minus

Query  1     TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
             |||||||| ||||||||||| |||||||| || ||  ||||||||||||||||||| |||
Sbjct  1145  TTCTGGGAAATCATCTCCGACGAGCATGGTATTGACCCCACCGGCGCCTACCACGGCGAC  1086

Query  61    AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                ||||| ||||| ||  | || ||||||||||||||||| || ||||||||||| |||
Sbjct  1085  TCAGACCTCCAGCTCGAAAGAATAAATGTGTACTACAATGAAGCCTCCGGTGGCAAATAC  1026

Query  121   GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             |||||||| ||  |||| |||||| ||||||||||||| |||||||| || || || || 
Sbjct  1025  GTGCCCCGTGCCATCCTGGTCGATTTGGAGCCCGGCACAATGGACTCCGTCCGGTCAGGC  966

Query  181   CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             || ||||| ||||| ||| ||||||||||||| || ||||| |||   || ||||| |||
Sbjct  965   CCCTTCGGACAGATTTTCCGGCCCGACAACTTCGTCTTCGGACAGAGTGGAGCCGGAAAC  906

Query  241   AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
             ||||||||||||||||| |||||||| || || ||||| || ||||| ||| | ||||||
Sbjct  905   AACTGGGCCAAGGGTCACTACACAGAAGGCGCCGAGCTCGTAGACTCCGTGTTGGATGTT  846

Query  301   GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
             |||||||||||||||||   |||||| ||||| || |||||||| || ||||| ||| | 
Sbjct  845   GTCCGCAAGGAGGCCGAGAGCTGCGATTGCCTTCAGGGCTTCCAGCTTACACATTCCTTG  786

Query  361   GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
             ||||| ||||| || ||||| ||||| || || || || || |||||| | || || |||
Sbjct  785   GGCGGTGGCACCGGATCCGGCATGGGCACACTCCTTATCTCGAAGATCAGAGAAGAATAC  726

Query  421   CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
             |||||||| || |||||||| ||||| || || || || ||||| || || |||||||| 
Sbjct  725   CCCGACAGAATAATGAACACCTACTCAGTCGTCCCCTCCCCCAAAGTATCAGACACCGTC  666

Query  481   GT  482
             ||
Sbjct  665   GT  664


>emb|AM237834.1| Imantonia rotunda partial tubb gene for beta-tubulin
Length=1209

 Score =  473 bits (524),  Expect = 4e-130
 Identities = 394/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |  ||||||||||||| ||| ||||  | |||||| |||||||||| |||
Sbjct  13   TTCTGGGAGGTTGTCTCCGATGAGCACGGCGTCGACCCGACCGGCACCTACCACGGCGAC  72

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||||||||| ||||||||||| ||||||||||| |||||| |||| |||   || 
Sbjct  73   TCGGACCTGCAGCTCGAGCGCATCAACGTGTACTACAACGAGGCGACCGGCGGCCGCTAT  132

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||    ||||  | || || |||||||||||||||||||| || || ||||| 
Sbjct  133  GTGCCCCGCAACATCCTGATGGACCTCGAGCCCGGCACCATGGACTCCGTCCGCTCGGGC  192

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||| | || |||||||| || |||||||||||||| |||||||||
Sbjct  193  CCCTTCGGCCAGATCTTCCGCCCGGACAACTTCGTCTTCGGCCAGTCGGGCGCCGGCAAC  252

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||  | ||| | || || || || 
Sbjct  253  AACTGGGCCAAGGGCCACTACACCGAGGGCGCCGAGCTCATTGACGCCGTCCTTGACGTC  312

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||||||   |||||||||||| || |||||| |  | || ||||| || 
Sbjct  313  GTCCGCAAGGAGGCCGAGGGCTGCGACTGCCTCCAGGGCTTCAACATGACCCACTCGCTC  372

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| |||||||| ||||| |||||||| ||  ||||||||||||||||||||
Sbjct  373  GGTGGCGGCACCGGCTCCGGCATGGGCACCCTGCTCATCCCCAAGATCCGCGAGGAGTAC  432

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| |  | |||  ||| | ||||||  | ||||||||||||||||| |||||||| 
Sbjct  433  CCCGACCGCGTGATGTGCACCTTCTCGGTCTTCCCGTCGCCCAAGGTGTCCGACACCGTC  492

Query  481  GT  482
            ||
Sbjct  493  GT  494


>gb|AF267188.1|AF267188 Reclinomonas americana clone 14 beta-tubulin gene, partial cds
Length=1232

 Score =  473 bits (524),  Expect = 4e-130
 Identities = 370/442 (84%), Gaps = 0/442 (0%)
 Strand=Plus/Plus

Query  43   GGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAG  102
            ||| |||||||||||||||||||||| ||||||||||||||||| || |||| ||| |||
Sbjct  126  GGCACCTACCACGGTGACAGCGACCTCCAGCTGGAGCGCATCAACGTCTACTTCAACGAG  185

Query  103  GCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATG  162
            ||| | || |||   || ||||||||||| || ||  | |||||||||||||||||||||
Sbjct  186  GCGACTGGCGGCCGCTATGTGCCCCGCGCCGTGCTGATGGATCTGGAGCCCGGCACCATG  245

Query  163  GACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGC  222
            |||||||| ||  | || || |  |||||| ||||| | |||||||||||||| || |||
Sbjct  246  GACTCTGTCCGCGCCGGCCCCTATGGCCAGCTCTTCCGCCCCGACAACTTTGTCTTTGGC  305

Query  223  CAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTG  282
            ||| | || ||||||||||||||||||||||| || ||||| ||||| |||||| || | 
Sbjct  306  CAGACTGGCGCCGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGCGCTGAGTTGATT  365

Query  283  GACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTC  342
            ||||| ||||||||||| || |||||||||||||| || |||||||||||||| ||||||
Sbjct  366  GACTCCGTGCTCGATGTGGTGCGCAAGGAGGCCGAGTCTTGCGACTGCCTGCAGGGCTTC  425

Query  343  CAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCC  402
            ||  |  | ||||| || || |||||||| |||||||| ||||| ||||| ||||| |||
Sbjct  426  CAGATTGCCCACTCGCTCGGTGGCGGCACCGGCTCCGGCATGGGCACCCTCCTGATCTCC  485

Query  403  AAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCC  462
            |||||||||||||||||||||||| | || |||  ||| | |||||| ||||| ||||||
Sbjct  486  AAGATCCGCGAGGAGTACCCCGACCGCATGATGCTCACGTTCTCGGTCGTGCCCTCGCCC  545

Query  463  AAGGTGTCGGACACCGTTGTGG  484
            |||||||| || ||||| ||||
Sbjct  546  AAGGTGTCTGATACCGTCGTGG  567


>gb|AF267185.1|AF267185 Malawimonas jakobiformis clone 1 beta-tubulin gene, partial cds
Length=1162

 Score =  473 bits (524),  Expect = 4e-130
 Identities = 394/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||| ||||| ||| | ||  | || ||||||||||||||||||
Sbjct  14   TTCTGGGAGGTCATCTCCGACGAGCACGGCGTAGACCCGACTGGCGCCTACCACGGTGAC  73

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| ||||||||||||| || |||| ||| |||||  ||||||||||||| 
Sbjct  74   TCTGACTTGCAGTTGGAGCGCATCAACGTTTACTTCAACGAGGCCACCGGTGGCAAGTAT  133

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| ||| | || ||  |||| |||||||||||||||||||| ||  | || 
Sbjct  134  GTGCCCCGCGCCGTCTTGGTTGACTTGGAACCCGGCACCATGGACTCTGTCCGCGCCGGT  193

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | ||||||||||| |||||||||||| | |||||||| |||
Sbjct  194  CCCTTCGGTCAGATCTTCCGCCCCGACAACTTCGTGTTCGGCCAGACTGGTGCCGGTAAC  253

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| |||||||| ||| || | ||||| ||| | || |||
Sbjct  254  AACTGGGCCAAGGGTCACTACACTGAGGGTGCCGAGTTGATCGACTCCGTGTTGGACGTT  313

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||||||   |||||||||||| || ||||||||  ||   |||||  | 
Sbjct  314  GTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCTGCCACTCTTTG  373

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || ||||| || ||||| || ||| ||||  ||||||||||||||||||||
Sbjct  374  GGTGGTGGTACCGGCTCTGGCATGGGCACTCTGTTGATCGCCAAGATCCGCGAGGAGTAC  433

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||  ||| | ||| |||||||| || ||||||||||| ||||| || 
Sbjct  434  CCCGACCGCATGATGTGCACTTTCTCCGTTGTGCCCTCCCCCAAGGTGTCCGACACTGTG  493

Query  481  GT  482
            ||
Sbjct  494  GT  495


>ref|XM_001135050.2| PREDICTED: Pan troglodytes tubulin beta-8 chain-like, transcript 
variant 3 (LOC735320), mRNA
Length=1793

 Score =  471 bits (522),  Expect = 1e-129
 Identities = 395/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| |||| |  || | ||| |||||||||| |||
Sbjct  350  TTCTGGGAGGTGATCTCTGATGAACATGCCATCAACTCCGCTGGCACCTACCACGGGGAC  409

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   ||||||||  || 
Sbjct  410  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGATAT  469

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  470  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCAGGCACCATGGACTCTGTGCGCTCGGGG  529

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||| |||||||||| ||||||||  | ||||| ||||  || ||||| |||
Sbjct  530  CCCTTTGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  589

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | || |||
Sbjct  590  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  649

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  650  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  709

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  710  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  769

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| |||||||||||||| |||||||| 
Sbjct  770  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCAGACACCGTG  829

Query  481  GTGG  484
            ||||
Sbjct  830  GTGG  833


>ref|XM_003229741.1| PREDICTED: Anolis carolinensis tubulin beta-2C chain-like (LOC100563375), 
mRNA
Length=1338

 Score =  471 bits (522),  Expect = 1e-129
 Identities = 395/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| || ||||| ||||||||  |||||||| |||||||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCGGACGAGCACGGCATCGACCCCACCGGCACCTACCACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||| ||||||||||| || || ||||| |||||  |||||||||| || 
Sbjct  118  AGCGACCTCCAGCTCGAGCGCATCAACGTCTATTACAACGAGGCCACCGGTGGCAAATAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || ||||| ||  | || || |||||||| |||||||||||||| ||||| || || 
Sbjct  178  GTCCCACGCGCCGTGTTGGTGGACCTGGAGCCTGGCACCATGGACTCCGTGCGCTCCGGC  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||| |||| || ||||||||||| || |||   || || ||||||
Sbjct  238  CCCTTTGGGCAGATCTTCCGGCCGGATAACTTTGTGTTTGGTCAGAGCGGCGCAGGCAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||||||||||| ||||| || || 
Sbjct  298  AACTGGGCCAAGGGCCACTACACGGAGGGGGCGGAGCTGGTGGACTCGGTGCTGGACGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||||||||   ||| ||||||||||| |||||||| ||||| ||||| || 
Sbjct  358  GTGCGGAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTCACGCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| ||||| || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  418  GGGGGCGGCACGGGCTCTGGCATGGGCACCCTCCTCATCAGCAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| || |||||||| |||||||| || 
Sbjct  478  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCCCCCAAGGTCTCGGACACTGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>ref|XM_002834671.1| PREDICTED: Pongo abelii tubulin beta-8 chain-like, transcript 
variant 1 (LOC100434432), mRNA
Length=1570

 Score =  471 bits (522),  Expect = 1e-129
 Identities = 395/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| |||||||| | ||||||  || | ||| |||||||||| |||
Sbjct  121  TTCTGGGAGGTGATCTCTGATGAGCACGCCATCGACTCCGCTGGCACCTACCACGGGGAC  180

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||| ||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  181  AGCCACCTACAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  240

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| ||||| |||||||||||||| ||||| 
Sbjct  241  GTGCCCCGCGCTGTGCTGGTGGATCTGGAGCCGGGCACTATGGACTCTGTGCGCTCGGGG  300

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| || |||||  | ||||| ||||  || ||||| |||
Sbjct  301  CCCTTCGGGCAGGTCTTCAGGCCAGATAACTTCATCTTCGGTCAGTGTGGGGCCGGAAAC  360

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||| |||| |||||| | || || 
Sbjct  361  AACTGGGCCAAGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTC  420

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  421  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  480

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  481  GGTGGGGGGACGGGGTCTGGGATGGGCACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  540

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  541  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  600

Query  481  GTGG  484
            ||||
Sbjct  601  GTGG  604


>gb|EU079659.1| Phytophthora captiosa isolate PD_00107(P10719) beta-tubulin gene, 
partial cds
Length=1174

 Score =  471 bits (522),  Expect = 1e-129
 Identities = 394/480 (83%), Gaps = 2/480 (0%)
 Strand=Plus/Plus

Query  6    GGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGA  65
            |||| |||||||||| ||||| ||| | ||  |||| |||  ||||||||| |||   ||
Sbjct  1    GGAGGTCATCTCCGACGAGCACGGCGTGGACCCCACGGGCAGCTACCACGGCGACTCGGA  60

Query  66   CCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCC  125
            ||||||||||||||||||||| ||||||||||| |||||  | || |||   ||||||||
Sbjct  61   CCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACGGGCGGCCGCTACGTGCC  120

Query  126  CCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTT  185
             |||||  ||||  | || ||||||||||||||||||||||| || ||  | || || | 
Sbjct  121  GCGCGCCATCCTCATGGACCTGGAGCCCGGCACCATGGACTCGGTCCGCGCCGGCCCCTA  180

Query  186  CGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTG  245
            ||||||| ||||| | || |||||||| || ||||||||| |||| ||||| ||||||||
Sbjct  181  CGGCCAGCTCTTCCGCCCGGACAACTTCGTCTTCGGCCAGACGGGCGCCGGTAACAACTG  240

Query  246  GGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCG  305
            ||||||||| || ||||| ||||| || |||||  | ||||| ||||| || || |||||
Sbjct  241  GGCCAAGGGACACTACACGGAGGGCGCCGAGCTCATCGACTCGGTGCTGGACGTCGTCCG  300

Query  306  CAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGG  365
            ||||||||||||   |||||||||||| || ||||||||  |||| ||||| || || ||
Sbjct  301  CAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCGCTCGGTGG  360

Query  366  CGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGA  425
            |||||| |||||||||||||| || || ||||| ||||||||||| ||||||||||| ||
Sbjct  361  CGGCACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGTGAGGAGTACCCGGA  420

Query  426  CAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGGTGTCGGACACCGTTGTGG  484
            | | ||||||  ||| ||||||| |||| ||||||||||||||||||||||| || ||||
Sbjct  421  CCGCATCATGTGCACCTACTCGG-TGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGG  479


>gb|EF495258.1| Phytophthora capsici beta tubulin mRNA, complete cds
Length=1341

 Score =  471 bits (522),  Expect = 1e-129
 Identities = 397/485 (82%), Gaps = 2/485 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||| ||||||||  | ||  |||| ||| | |||||||| |||
Sbjct  58   TTCTGGGAGGTCATCTCCGACGAGCATGGTGTGGACCCCACGGGCTCGTACCACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || |||||||||||||||||||||||||||||||| || ||  | || ||    |||
Sbjct  118  TCGGATCTGCAGCTGGAGCGCATCAATGTGTACTACAACGAAGCTACGGGCGGACGTTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||  ||||  | ||  |||||||||||||||||||||| || ||  | || 
Sbjct  178  GTGCCCCGTGCCATCCTCATGGACTTGGAGCCCGGCACCATGGACTCGGTCCGTGCTGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||| ||||||| ||||| | ||||||||||| |||||||||||  | || ||||| |||
Sbjct  238  CCTTACGGCCAGCTCTTCCGTCCCGACAACTTCGTGTTCGGCCAAACAGGCGCCGGTAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||||||||||||  | ||||| ||||| ||||||
Sbjct  298  AACTGGGCCAAGGGACACTACACTGAGGGTGCTGAGCTTATTGACTCGGTGCTTGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||| |||||||| ||   ||| ||||||||||| || |||||  |||| ||||| |||
Sbjct  358  GTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTT  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || || ||||||||||| || || || || || ||||| || |||||||||
Sbjct  418  GGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGGTGTCGGACACCGT  479
            |||||| | ||||||  ||||||||||| |||| || |||||||||||||||||||||||
Sbjct  478  CCCGACCGTATCATGTGCACATACTCGG-TGTGCCCATCGCCCAAGGTGTCGGACACCGT  536

Query  480  TGTGG  484
            |||||
Sbjct  537  TGTGG  541


>dbj|AB491651.1| Dolichomastix tenuilepis Btub gene for beta-tubulin, partial 
cds, strain: CCMP2494
Length=1173

 Score =  470 bits (520),  Expect = 5e-129
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||| ||| ||||| ||||| ||  |  ||||| | |||  ||| |||
Sbjct  19   TTCTGGGAGGTCATCTGCGACGAGCACGGCATTGACCCGGCCGGCACGTACGGCGGCGAC  78

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||| ||||||||||| ||||||||||| ||||||||||| |||   || 
Sbjct  79   TCCGACCTCCAGCTCGAGCGCATCAACGTGTACTACAACGAGGCGTCCGGCGGCCGCTAT  138

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  ||||  | || || ||||| || ||||||||||| ||||| || || 
Sbjct  139  GTGCCGCGCGCGATCCTCATGGACCTCGAGCCGGGGACCATGGACTCCGTGCGCTCTGGC  198

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||||||||| | || ||||||||||||||||||||| | || || ||||||
Sbjct  199  CCGTACGGCCAGATCTTCCGCCCSGACAACTTTGTGTTCGGCCAGACKGGCGCGGGCAAC  258

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||| ||||| || |||||  | ||||| |||||||| || 
Sbjct  259  AACTGGGCGAAGGGACACTACACCGAGGGCGCGGAGCTSATCGACTCGGTGCTCGACGTG  318

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||| | || || ||||||||||| || || |||||  ||   ||||| || 
Sbjct  319  GTGCGCAAGGAGTCGGAGTCGTGCGACTGCCTCCAGGGTTTCCAGATCTGCCACTCGCTC  378

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| |||||||| ||||| |||||||| || |||||||||||||||||||||
Sbjct  379  GGCGGCGGCACGGGCTCCGGCATGGGCACCCTGCTCATCTCCAAGATCCGCGAGGAGTAC  438

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | || |||  ||| | |||||| ||||||||||||||||||||||||||||| 
Sbjct  439  CCGGACCGCATGATGCTCACCTTCTCGGTGGTGCCGTCGCCCAAGGTGTCGGACACCGTG  498

Query  481  GT  482
            ||
Sbjct  499  GT  500


>emb|FN392564.1| Imantonia rotunda partial mRNA for tubulin beta, contig 03066
Length=642

 Score =  470 bits (520),  Expect = 5e-129
 Identities = 392/480 (82%), Gaps = 0/480 (0%)
 Strand=Plus/Minus

Query  3    CTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAG  62
            ||||||| |  ||||||| ||||| ||| ||||  | |||||| |||||||||| |||  
Sbjct  640  CTGGGAGGTTGTCTCCGACGAGCACGGCGTCGACCCGACCGGCACCTACCACGGCGACTC  581

Query  63   CGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGT  122
             ||||||||||| ||||||||||| ||||||||||| |||||| |||| |||   |||||
Sbjct  580  GGACCTGCAGCTCGAGCGCATCAACGTGTACTACAACGAGGCGACCGGCGGCCGCTACGT  521

Query  123  GCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACC  182
            |||||||    ||||  | || || |||||||||||||||||||| || || ||||| ||
Sbjct  520  GCCCCGCAACATCCTGATGGACCTCGAGCCCGGCACCATGGACTCCGTCCGCTCGGGCCC  461

Query  183  TTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAA  242
             ||||||||||||||| | || |||||||| || |||||||||||||| |||||||||||
Sbjct  460  CTTCGGCCAGATCTTCCGCCCGGACAACTTCGTCTTCGGCCAGTCGGGCGCCGGCAACAA  401

Query  243  CTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGT  302
            |||||||||||| || ||||| ||||| || |||||  | ||| | || || || || ||
Sbjct  400  CTGGGCCAAGGGCCACTACACCGAGGGCGCCGAGCTCATCGACGCCGTCCTTGACGTCGT  341

Query  303  CCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGG  362
            |||||||||||||||   |||||||||||| || |||||| |  | || ||||| || ||
Sbjct  340  CCGCAAGGAGGCCGAGGGCTGCGACTGCCTCCAGGGCTTCAACATGACCCACTCGCTCGG  281

Query  363  CGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCC  422
             |||||||| |||||||| ||||| |||||||| || |||||||||||||||||||||||
Sbjct  280  TGGCGGCACCGGCTCCGGCATGGGCACCCTGCTCATCTCCAAGATCCGCGAGGAGTACCC  221

Query  423  CGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGT  482
            |||| |  | |||  ||| | ||| ||  | ||||||||||||||||| |||||||| ||
Sbjct  220  CGACCGCGTGATGTGCACCTTCTCCGTCTTCCCGTCGCCCAAGGTGTCCGACACCGTCGT  161


>ref|XM_535868.3| PREDICTED: Canis lupus familiaris tubulin, beta 2A (TUBB2A), 
mRNA
Length=1828

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||   || ||||| || |||||  ||||||||   ||||| || |||
Sbjct  352  TTTTGGGAGGTCATCAGTGACGAGCACGGGATCGACCCCACCGGCAGTTACCATGGAGAC  411

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||| ||||||||||| | ||||| |||||||||||||| ||  | |||  ||| |||
Sbjct  412  AGCGACTTGCAGCTGGAGAGAATCAACGTGTACTACAATGAAGCTGCAGGTAACAAATAC  471

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || ||||||||||| |||||||||||||| || || || || 
Sbjct  472  GTGCCTCGGGCCATCCTGGTGGATCTGGAGCCGGGCACCATGGACTCGGTCCGGTCCGGG  531

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||||||||||||||||||||||| ||||||||||||   |||||||| |||
Sbjct  532  CCCTTTGGCCAGATCTTCAGGCCCGACAACTTCGTGTTCGGCCAGAGCGGTGCCGGGAAC  591

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||||| ||||| ||||| || || 
Sbjct  592  AACTGGGCCAAGGGCCACTACACCGAGGGCGCCGAGCTGGTAGACTCGGTGCTGGACGTG  651

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||| | ||   ||||||||||||||| |||||||| || || ||||| || 
Sbjct  652  GTGAGGAAGGAGTCGGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTGACGCACTCGCTG  711

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| || ||||| ||   |||||||||||||||||||
Sbjct  712  GGCGGCGGCACGGGCTCGGGCATGGGCACGCTGCTCATCAGCAAGATCCGCGAGGAGTAC  771

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| |||||||||||||||||||| || 
Sbjct  772  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCGGACACGGTG  831

Query  481  GTGG  484
            ||||
Sbjct  832  GTGG  835


>ref|XM_003429369.1| PREDICTED: Ornithorhynchus anatinus tubulin beta-4 chain-like 
(LOC100086969), partial mRNA
Length=1278

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||   |||||||| ||||| ||  |||| ||  | |||||||| |||
Sbjct  1    TTTTGGGAGGTGATCAGTGATGAGCACGGCATTGACCCCACGGGGACTTACCACGGAGAC  60

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||||||||||||| | ||||| || |||||||||||||| || ||||| ||||| 
Sbjct  61   AGTGACCTGCAGCTGGAGAGGATCAACGTTTACTACAATGAGGCCTCAGGTGGGAAGTAT  120

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct  121  GTGCCCCGAGCTGTTCTTGTCGACCTGGAGCCGGGCACCATGGACTCTGTCCGCTCCGGC  180

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || || ||||||||| | || ||||||||||| ||||| ||||| || |||||||| 
Sbjct  181  CCCTTTGGACAGATCTTCCGTCCGGACAACTTTGTCTTCGGTCAGTCTGGGGCCGGCAAT  240

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            || ||||||||||| || ||||| ||||| || ||||||||||| || || || || || 
Sbjct  241  AATTGGGCCAAGGGCCACTACACGGAGGGGGCAGAGCTGGTGGATTCGGTCCTGGACGTG  300

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | || ||||| ||   ||||||||||||||| ||||||||||| || ||||| || 
Sbjct  301  GTCAGGAAAGAGGCAGAGAGCTGCGACTGCCTGCAGGGCTTCCAACTGACCCACTCGCTG  360

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || ||||| ||||| || ||||| || ||||||||   ||||||||||||||| |||
Sbjct  361  GGTGGGGGCACGGGCTCGGGCATGGGCACGCTGCTGATCAGCAAGATCCGCGAGGAATAC  420

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| ||||||||||| |||||||| || 
Sbjct  421  CCCGACCGCATCATGAACACTTTCAGCGTGGTGCCCTCGCCCAAGGTATCGGACACGGTG  480

Query  481  GTGG  484
            ||||
Sbjct  481  GTGG  484


>ref|NM_001243434.1| Sus scrofa tubulin, beta 2B class IIb (TUBB2B), mRNA
Length=1688

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 393/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||  ||| ||||||||||||||  |||| |||   ||||| || |||
Sbjct  169  TTTTGGGAGGTCATCAGCGACGAGCATGGCATCGACCCCACTGGCAGTTACCATGGCGAC  228

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | ||||| |||||||||||||| ||  | |||  |||||| 
Sbjct  229  AGTGACTTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCCACTGGTAACAAGTAT  288

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||  |||| || ||||||||||| |||||||||||||| ||  | || |||
Sbjct  289  GTGCCCCGGGCCATCCTGGTGGATCTGGAGCCGGGCACCATGGACTCGGTCAGGTCTGGA  348

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||| ||||| ||||||   ||||||||||||
Sbjct  349  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTCGTGTTTGGCCAGAGCGGTGCCGGCAAC  408

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||||| || || || || 
Sbjct  409  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  468

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| | ||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  469  GTCAGGAAGGAGTCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  528

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| |||||||| ||   |||||||||||||||||||
Sbjct  529  GGGGGCGGCACGGGTTCGGGGATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTAC  588

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| ||||||||||| |||||||| || 
Sbjct  589  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTCTCGGACACGGTG  648

Query  481  GT  482
            ||
Sbjct  649  GT  650


>ref|XM_001170953.2| PREDICTED: Pan troglodytes tubulin beta-8 chain-like, transcript 
variant 3 (TUBB4Q), mRNA
Length=1598

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  160  TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  219

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| || ||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  220  AGCCACTTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  279

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  280  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGT  339

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | | ||| ||||  || ||||| |||
Sbjct  340  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATTTCCGGTCAGTGTGGGGCCGGAAAC  399

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |  |||||||| || || |||||| |||| |||||| | || |||
Sbjct  400  AACTGGGCCAAGGGACGCTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  459

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||| ||||| || ||||| || || |||||||| 
Sbjct  460  GTCAGAAAGGAGGCTGAGAGCTGTGACTGTCTGCAGGGTTTCCAGCTGACCCACTCCCTG  519

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||  | || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  520  GGTTGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  579

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| |||||||||||||| |||||||| 
Sbjct  580  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCAGACACCGTG  639

Query  481  GTGG  484
            ||||
Sbjct  640  GTGG  643


>ref|XM_001170922.2| PREDICTED: Pan troglodytes tubulin beta-8 chain-like, transcript 
variant 1 (TUBB4Q), mRNA
Length=1496

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| |||| ||||||  || | ||| |||||||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| || ||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  118  AGCCACTTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  178  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGT  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | | ||| ||||  || ||||| |||
Sbjct  238  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATTTCCGGTCAGTGTGGGGCCGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |  |||||||| || || |||||| |||| |||||| | || |||
Sbjct  298  AACTGGGCCAAGGGACGCTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||| ||||| || ||||| || || |||||||| 
Sbjct  358  GTCAGAAAGGAGGCTGAGAGCTGTGACTGTCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||  | || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  418  GGTTGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| |||||||||||||| |||||||| 
Sbjct  478  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCAGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>dbj|AK352151.1| Sus scrofa mRNA, clone:UTR010013F04, expressed in uterus
Length=1707

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 393/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||  ||| ||||||||||||||  |||| |||   ||||| || |||
Sbjct  169  TTTTGGGAGGTCATCAGCGACGAGCATGGCATCGACCCCACTGGCAGTTACCATGGCGAC  228

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | ||||| |||||||||||||| ||  | |||  |||||| 
Sbjct  229  AGTGACTTGCAGCTGGAGAGGATCAACGTGTACTACAATGAAGCCACTGGTAACAAGTAT  288

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||  |||| || ||||||||||| |||||||||||||| ||  | || |||
Sbjct  289  GTGCCCCGGGCCATCCTGGTGGATCTGGAGCCGGGCACCATGGACTCGGTCAGGTCTGGA  348

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||| ||||| ||||||   ||||||||||||
Sbjct  349  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTCGTGTTTGGCCAGAGCGGTGCCGGCAAC  408

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||||| || || || || 
Sbjct  409  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  468

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| | ||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  469  GTCAGGAAGGAGTCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  528

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| |||||||| ||   |||||||||||||||||||
Sbjct  529  GGGGGCGGCACGGGTTCGGGGATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTAC  588

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| ||||||||||| |||||||| || 
Sbjct  589  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTCTCGGACACGGTG  648

Query  481  GT  482
            ||
Sbjct  649  GT  650


>gb|EU980443.1| Anastrepha suspensa beta-1 tubulin gene, complete cds
Length=3001

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1     TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
             |||||||| |||||||| || || ||||| || ||||| || || ||||| |||||||| 
Sbjct  1681  TTCTGGGAAATCATCTCGGACGAACATGGAATTGATGCGACTGGTGCCTATCACGGTGAT  1740

Query  61    AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
             || || |||||  | || |||||||||||||| || ||||||||||||||||| || || 
Sbjct  1741  AGTGATCTGCAATTAGAACGCATCAATGTGTATTATAATGAGGCGTCCGGTGGAAAATAT  1800

Query  121   GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             || || ||||| || |||||||||||||| || || || ||||| || ||||| ||||||
Sbjct  1801  GTACCACGCGCAGTTCTTGTCGATCTGGAACCTGGTACTATGGATTCAGTGCGTTCGGGA  1860

Query  181   CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             ||||| || || || ||| | || || |||||||| ||||| || || || ||||| |||
Sbjct  1861  CCTTTTGGACAAATTTTCCGTCCAGATAACTTTGTCTTCGGACAATCTGGAGCCGGAAAC  1920

Query  241   AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
             |||||||| ||||| ||||||||||| ||||||||| |||| ||||| ||||| ||||| 
Sbjct  1921  AACTGGGCGAAGGGCCATTACACAGAAGGTGCTGAGTTGGTCGACTCTGTGCTTGATGTC  1980

Query  301   GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
             |||||||| ||||| ||||||||||| ||||| ||||| |||||||| ||||| ||| | 
Sbjct  1981  GTCCGCAAAGAGGCTGAATCCTGCGATTGCCTTCAAGGATTCCAACTGACACATTCCTTG  2040

Query  361   GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
             || || ||||| || ||||||||||||||  | || || || || ||||| || || |||
Sbjct  2041  GGTGGTGGCACCGGTTCCGGTATGGGAACTTTACTCATCTCAAAAATCCGTGAAGAATAC  2100

Query  421   CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
             |||||||| || ||||| |||||||| || || || || ||||| || || ||||| |||
Sbjct  2101  CCCGACAGAATAATGAATACATACTCAGTCGTACCCTCACCCAAAGTATCAGACACAGTT  2160

Query  481   GTGG  484
             ||||
Sbjct  2161  GTGG  2164


>gb|BT057955.1| Salmo salar clone ssal-rgf-511-369 Tubulin beta-2C chain putative 
mRNA, complete cds
Length=1049

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||   || ||||||||||| ||  | || ||  | ||||| || |||
Sbjct  115  TTCTGGGAGGTGATCAGTGACGAGCATGGCATTGACCCAACTGGTACATACCATGGGGAC  174

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||| ||||| ||  | || ||||||||||||||||| || || ||||| || |||
Sbjct  175  AGTGACCTCCAGCTAGATAGAATTAATGTGTACTACAATGAAGCTTCAGGTGGTAAATAC  234

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| ||||||||  ||||||| || ||||||||||||||| |||| |||
Sbjct  235  GTGCCCCGCGCTGTGCTTGTCGACTTGGAGCCAGGGACCATGGACTCTGTGAGATCCGGA  294

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||| || |||||||||||||||||||||   ||||| || |||
Sbjct  295  CCCTTCGGCCAGATCTTCAGACCTGACAACTTTGTGTTCGGCCAGAGTGGTGCTGGAAAC  354

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct  355  AACTGGGCCAAGGGCCACTACACAGAGGGAGCTGAGCTGGTGGACTCAGTCCTGGATGTT  414

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | || | ||| ||   ||| ||||| ||||| |||||||| ||||| |||||||| 
Sbjct  415  GTGAGGAAAGGGGCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTCACCCACTCCCTG  474

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || |||||||| || ||||| |||||||| ||   ||||||||| || ||||||
Sbjct  475  GGAGGTGGAACTGGCTCTGGCATGGGCACCCTGCTCATCAGCAAGATCCGTGAAGAGTAC  534

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| || ||||| || || ||||| || 
Sbjct  535  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCACCCAAAGTATCAGACACTGTG  594

Query  481  GTGG  484
            ||||
Sbjct  595  GTGG  598


>gb|BT057055.1| Salmo salar clone ssal-evd-510-244 Tubulin beta-2C chain putative 
mRNA, complete cds
Length=1062

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||   || ||||||||||| ||  | || ||  | ||||| || |||
Sbjct  128  TTCTGGGAGGTGATCAGTGACGAGCATGGCATTGACCCAACTGGTACATACCATGGGGAC  187

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||| ||||| ||  | || ||||||||||||||||| || || ||||| || |||
Sbjct  188  AGTGACCTCCAGCTAGATAGAATTAATGTGTACTACAATGAAGCTTCAGGTGGTAAATAC  247

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| ||||||||  ||||||| || ||||||||||||||| |||| |||
Sbjct  248  GTGCCCCGCGCTGTGCTTGTCGACTTGGAGCCAGGGACCATGGACTCTGTGAGATCCGGA  307

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||| || |||||||||||||||||||||   ||||| || |||
Sbjct  308  CCCTTCGGCCAGATCTTCAGACCTGACAACTTTGTGTTCGGCCAGAGTGGTGCTGGAAAC  367

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct  368  AACTGGGCCAAGGGCCACTACACAGAGGGAGCTGAGCTGGTGGACTCAGTCCTGGATGTT  427

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | || | ||| ||   ||| ||||| ||||| |||||||| ||||| |||||||| 
Sbjct  428  GTGAGGAAAGGGGCAGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTCACCCACTCCCTG  487

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || |||||||| || ||||| |||||||| ||   ||||||||| || ||||||
Sbjct  488  GGAGGTGGAACTGGCTCTGGCATGGGCACCCTGCTCATCAGCAAGATCCGTGAAGAGTAC  547

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| || ||||| || || ||||| || 
Sbjct  548  CCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCACCCAAAGTATCAGACACTGTG  607

Query  481  GTGG  484
            ||||
Sbjct  608  GTGG  611


>ref|NM_001139793.1| Salmo salar Tubulin beta chain (tbb5), mRNA
 gb|BT044664.1| Salmo salar clone ssal-rgf-002-123 Tubulin beta chain putative 
mRNA, complete cds
Length=2039

 Score =  468 bits (518),  Expect = 2e-128
 Identities = 394/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  |||||| |||||||||||  |||| ||| |||||||||| |||
Sbjct  173  TTCTGGGAGGTGATCAGCGATGAACATGGCATCGACCCCACAGGCACCTACCACGGAGAC  232

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||||||||  | |||| ||| |||||||| ||||| || ||||||||||| 
Sbjct  233  AGCGACCTGCAGCTGGACAGGATCAGTGTCTACTACAACGAGGCTTCAGGTGGCAAGTAT  292

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||| | || ||||| || || |||||||||||||||||||| |||||  |||| |||
Sbjct  293  GTACCCAGAGCGGTCCTAGTGGACCTGGAGCCCGGCACCATGGATTCTGTCAGATCCGGA  352

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || |||||||||||||| || |||   ||||| || |||
Sbjct  353  CCCTTCGGGCAGATCTTCAGACCAGACAACTTTGTGTTTGGTCAGAGCGGTGCAGGAAAC  412

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||| ||||| || ||||||||||||||||| || ||||| 
Sbjct  413  AACTGGGCAAAGGGCCACTACACTGAGGGAGCAGAGCTGGTGGACTCAGTCCTGGATGTG  472

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | || ||||| ||   |||||||||||| || |||||||| ||||| |||||||| 
Sbjct  473  GTGAGGAAAGAGGCTGAGAGCTGCGACTGCCTCCAGGGCTTCCAGCTCACCCACTCCCTG  532

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || ||||||||||| || ||||| |||||||| ||   ||||||||| || ||||||
Sbjct  533  GGTGGGGGCACTGGCTCGGGCATGGGCACCCTGCTCATCAGCAAGATCCGTGAAGAGTAC  592

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   || ||||| || || || || || ||||| || 
Sbjct  593  CCCGACCGTATCATGAACACCTTCAGCGTGGTGCCCTCCCCTAAAGTATCAGACACTGTG  652

Query  481  GTGG  484
            ||||
Sbjct  653  GTGG  656


>gb|EU080684.1| Phytophthora ramorum isolate PD_00058(P10301) beta-tubulin gene, 
partial cds
Length=1204

 Score =  466 bits (516),  Expect = 6e-128
 Identities = 393/480 (82%), Gaps = 2/480 (0%)
 Strand=Plus/Plus

Query  6    GGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGA  65
            |||| |||||||||| ||||| ||| | ||  |||| ||| | |||||||| |||   ||
Sbjct  1    GGAGGTCATCTCCGACGAGCACGGCGTGGACCCCACGGGCTCGTACCACGGCGACTCGGA  60

Query  66   CCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCC  125
            ||||||||||||||||||||||||||||||||| |||||  | || |||   ||||||||
Sbjct  61   CCTGCAGCTGGAGCGCATCAATGTGTACTACAACGAGGCCACGGGCGGCCGCTACGTGCC  120

Query  126  CCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTT  185
            ||||||  ||||  | || ||||||||||||||||||||||| || ||  | || || | 
Sbjct  121  CCGCGCCATCCTCATGGACCTGGAGCCCGGCACCATGGACTCGGTCCGCGCCGGCCCCTA  180

Query  186  CGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTG  245
            ||||||| ||||| | || |||||||| |||||||| ||| | || ||||| ||||||||
Sbjct  181  CGGCCAGCTCTTCCGCCCGGACAACTTCGTGTTCGGTCAGACCGGCGCCGGTAACAACTG  240

Query  246  GGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCG  305
            ||| ||||| || ||||| |||||||| |||||  | ||||| |||||||| || |||||
Sbjct  241  GGCTAAGGGACACTACACGGAGGGTGCCGAGCTTATCGACTCGGTGCTCGACGTCGTCCG  300

Query  306  CAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGG  365
            ||||||||||||   ||| ||||||||||| || |||||  |||| ||||| ||||| ||
Sbjct  301  CAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGGTTCCAGATCACGCACTCGCTTGGTGG  360

Query  366  CGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGA  425
            ||| || || || |||||||| || || ||||| ||||||||||| ||||||||||| ||
Sbjct  361  CGGTACCGGTTCTGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGA  420

Query  426  CAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGGTGTCGGACACCGTTGTGG  484
            | | ||||||  ||| ||||||| |||| ||||||||||||||||||||||| || ||||
Sbjct  421  CCGTATCATGTGCACGTACTCGG-TGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGG  479


>emb|FQ225007.1| Rattus norvegicus TL0AEA55YH02 mRNA sequence
Length=1570

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  122  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  181

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  182  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  241

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  242  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  301

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  302  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  361

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  362  AACTGGGCCAAGGGGCACTACACAGAAGGTGCGGAGCTGGTTGACTCGGTGTTGGACGTT  421

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  422  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  481

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  482  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  541

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||| | |   || || || || ||||||||||||||||| || 
Sbjct  542  CCAGACAGAATCATGAACACCTCCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACACAGTG  601

Query  481  GT  482
            ||
Sbjct  602  GT  603


>emb|FQ218503.1| Rattus norvegicus TL0ABA51YL12 mRNA sequence
Length=1581

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  122  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  181

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  182  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  241

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  242  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  301

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  302  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  361

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  362  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTTGACTCGGTGTTGGACGTT  421

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  422  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  481

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  482  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  541

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||| | |   || || || || ||||||||||||||||| || 
Sbjct  542  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACACAGTG  601

Query  481  GT  482
            ||
Sbjct  602  GT  603


>emb|CT837951.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA129F19, 
full insert sequence
Length=1636

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||| ||||| |||||||| |||||  | || ||  |||| ||||| |||
Sbjct  155  TTCTGGGAGGTCATTTCCGACGAGCATGGTATCGACCCGACTGGTACCTATCACGGCGAC  214

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| ||||||| |||||||| |||| ||| |||||  ||||||||||||| 
Sbjct  215  TCTGACTTGCAGTTGGAGCGTATCAATGTCTACTTCAACGAGGCCACCGGTGGCAAGTAT  274

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||||||||| |||||||| ||||| || |||||||||||||| || || || 
Sbjct  275  GTGCCGCGCGCTGTCCTAGTCGATCTAGAGCCTGGTACCATGGACTCTGTTCGCTCTGGT  334

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || ||||| ||||| || ||||| || ||||| || |||
Sbjct  335  CCATTCGGTCAGATCTTCAGACCAGACAATTTTGTCTTTGGCCAATCTGGTGCTGGTAAC  394

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| |||||||||||| |||| ||||| ||| | || || 
Sbjct  395  AACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGTTGGTCGACTCTGTGTTGGACGTA  454

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||| |||||| || || || || ||| |||||||||| || ||||| ||||| |||
Sbjct  455  GTACGCAGGGAGGCTGAGTCTTGTGATTGCTTGCAAGGCTTTCAGCTCACTCACTCGCTT  514

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || |||||||||||||||||||| ||  || ||||   ||||||||| |||||||||
Sbjct  515  GGTGGTGGCACTGGCTCCGGTATGGGCACTTTGTTGATCAGCAAGATCCGTGAGGAGTAC  574

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||  | || |||||||| | |||||| ||||| ||||| ||||| || || ||||| 
Sbjct  575  CCTGATCGTATTATGAACACTTTCTCGGTCGTGCCCTCGCCAAAGGTATCTGATACCGTC  634

Query  481  GT  482
            ||
Sbjct  635  GT  636


>ref|XM_001176315.1| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC586940 
(LOC586940), mRNA
Length=2115

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | || |||||||| || ||||||||  | |||||  ||||||| || |||
Sbjct  154  TTCTGGGAGGTGATTTCCGATGAACACGGCATCGACCCGACCGGTACCTACCATGGCGAC  213

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || || |||||||||||||||||||||||||||||||||||  |||| |||||||||
Sbjct  214  TCTGATCTCCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  273

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||||| || |||||||| ||||| ||||||||||||||||| ||||| |||
Sbjct  274  GTTCCACGAGCTGTGCTCGTCGATCTCGAGCCAGGCACCATGGACTCTGTCCGATCTGGA  333

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || |||||||| || ||||| |||   || || || |||
Sbjct  334  CCATTCGGACAGATCTTCAGACCAGACAACTTCGTCTTCGGACAGAGTGGAGCAGGAAAC  393

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||||||||| ||||| || || || || || |||||||| 
Sbjct  394  AACTGGGCCAAGGGACATTACACAGAGGGAGCTGAACTCGTCGATTCTGTCCTCGATGTC  453

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | || || || |||  ||| || ||||| || || ||||| || |||||||| |||
Sbjct  454  GTCAGGAAAGAAGCAGAAAGCTGTGATTGCCTCCAGGGATTCCAGCTTACACACTCACTT  513

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || |||||||||||||| ||||||||||| |||||   ||||||||| ||||| |||
Sbjct  514  GGTGGAGGCACTGGCTCCGGCATGGGAACCCTTCTGATCAGCAAGATCCGTGAGGAATAC  573

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||||| |   || || || || || ||||| || ||||| |||
Sbjct  574  CCAGACCGCATCATGAACACATTCAGTGTCGTACCATCCCCTAAGGTTTCAGACACTGTT  633

Query  481  GT  482
            ||
Sbjct  634  GT  635


>ref|XM_786697.2| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC586940 
(LOC586940), mRNA
Length=2115

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | || |||||||| || ||||||||  | |||||  ||||||| || |||
Sbjct  154  TTCTGGGAGGTGATTTCCGATGAACACGGCATCGACCCGACCGGTACCTACCATGGCGAC  213

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || || |||||||||||||||||||||||||||||||||||  |||| |||||||||
Sbjct  214  TCTGATCTCCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  273

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || || ||||| || |||||||| ||||| ||||||||||||||||| ||||| |||
Sbjct  274  GTTCCACGAGCTGTGCTCGTCGATCTCGAGCCAGGCACCATGGACTCTGTCCGATCTGGA  333

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || |||||||| || ||||| |||   || || || |||
Sbjct  334  CCATTCGGACAGATCTTCAGACCAGACAACTTCGTCTTCGGACAGAGTGGAGCAGGAAAC  393

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||||||||| ||||| || || || || || |||||||| 
Sbjct  394  AACTGGGCCAAGGGACATTACACAGAGGGAGCTGAACTCGTCGATTCTGTCCTCGATGTC  453

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | || || || |||  ||| || ||||| || || ||||| || |||||||| |||
Sbjct  454  GTCAGGAAAGAAGCAGAAAGCTGTGATTGCCTCCAGGGATTCCAGCTTACACACTCACTT  513

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || |||||||||||||| ||||||||||| |||||   ||||||||| ||||| |||
Sbjct  514  GGTGGAGGCACTGGCTCCGGCATGGGAACCCTTCTGATCAGCAAGATCCGTGAGGAATAC  573

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||||| |   || || || || || ||||| || ||||| |||
Sbjct  574  CCAGACCGCATCATGAACACATTCAGTGTCGTACCATCCCCTAAGGTTTCAGACACTGTT  633

Query  481  GT  482
            ||
Sbjct  634  GT  635


>gb|BC090334.1| Rattus norvegicus tubulin, beta 2c, mRNA (cDNA clone IMAGE:7301482), 
**** WARNING: chimeric clone ****
Length=4215

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1     TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
             ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  2759  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  2818

Query  61    AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
             |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  2819  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  2878

Query  121   GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  2879  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  2938

Query  181   CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  2939  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  2998

Query  241   AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
             |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  2999  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTTGACTCGGTGTTGGACGTT  3058

Query  301   GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
             ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  3059  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  3118

Query  361   GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
             || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  3119  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  3178

Query  421   CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
             || ||||| ||||||||||| | |   || || || || ||||||||||||||||| || 
Sbjct  3179  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACACAGTG  3238

Query  481   GT  482
             ||
Sbjct  3239  GT  3240


>ref|NM_199094.1| Rattus norvegicus tubulin, beta 4B class IVb (Tubb4b), mRNA
 gb|BC060597.1| Rattus norvegicus tubulin, beta 2c, mRNA (cDNA clone MGC:73008 
IMAGE:6889737), complete cds
Length=1582

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  129  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  188

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  189  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  248

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  249  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  308

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  309  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  368

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  369  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTTGACTCGGTGTTGGACGTT  428

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  429  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  488

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  489  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  548

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||| | |   || || || || ||||||||||||||||| || 
Sbjct  549  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACACAGTG  608

Query  481  GT  482
            ||
Sbjct  609  GT  610


>gb|AY729820.1| Pavlova lutheri beta-tubulin gene, partial cds
Length=1218

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 389/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||||||| ||||| ||  ||||  | || ||| |||||||||| || 
Sbjct  37   TTCTGGGAGGTGATCTCCGACGAGCACGGTGTCGACCCGACGGGCACCTACCACGGCGAT  96

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||| ||||||||||| || |||| ||| |||||| | || |||   |||
Sbjct  97   TCCGACCTCCAGCTCGAGCGCATCAACGTCTACTTCAACGAGGCGACGGGCGGCCGCTAC  156

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  ||||  | || || ||||| ||||| |||||||| ||||| ||||| 
Sbjct  157  GTGCCGCGCGCGATCCTGATGGACCTCGAGCCGGGCACGATGGACTCGGTGCGCTCGGGC  216

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| || ||||| || |||||||||||||| || ||||||
Sbjct  217  CCGTTCGGYCAGATCTTCCGGCCRGATAACTTYGTCTTCGGCCAGTCGGGCGCSGGCAAC  276

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||  | ||| | |||||||| || 
Sbjct  277  AACTGGGCCAAGGGCCACTACACSGAGGGCGCCGAGCTSATCGACGCCGTGCTCGACGTC  336

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||| || |||||||||||||| ||||||||  |||| |||||  | 
Sbjct  337  GTGCGCAAGGAGGCCGAGTCGTGCGACTGCCTGCAGGGCTTCCAGATCACGCACTCGATG  396

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| || ||||| || |||||||| ||||||||||| 
Sbjct  397  GGCGGCGGCACGGGCTCGGGCATGGGCACGCTGCTCATCTCCAAGATYCGCGAGGAGTAY  456

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            ||| || | ||||||  ||| ||||||||  | || ||||| |||||||||||||| || 
Sbjct  457  CCCRACCGCATCATGGCCACCTACTCGGTCTTCCCRTCGCCAAAGGTGTCGGACACGGTC  516

Query  481  GT  482
            ||
Sbjct  517  GT  518


>gb|AF092952.1|AF092952 Cyanophora paradoxa beta 1 tubulin (tubB1) mRNA, complete cds
Length=1513

 Score =  464 bits (514),  Expect = 2e-127
 Identities = 392/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||||| |||||||| ||  ||||  | |||||| |||||||||| |||
Sbjct  111  TTCTGGGAGGTCATCTCGGATGAGCACGGTGTCGACCCGACCGGCACCTACCACGGCGAC  170

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||| ||||||||||| || ||||||||||||||| |||| ||    |||
Sbjct  171  TCCGACCTCCAGCTTGAGCGCATCAACGTCTACTACAATGAGGCGACCGGCGGGCGCTAC  230

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| || |||||  | || || ||||||||||| |||||||| || ||  | || 
Sbjct  231  GTGCCCCGTGCCGTCCTGATGGACCTTGAGCCCGGCACGATGGACTCCGTCCGCGCCGGC  290

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || | ||||||| ||||| | || || |||||  | ||||||||||| || |||||||||
Sbjct  291  CCCTACGGCCAGCTCTTCCGTCCGGATAACTTCATCTTCGGCCAGTCCGGCGCCGGCAAC  350

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| ||||||||  | ||||| || |||||||| 
Sbjct  351  AACTGGGCCAAGGGCCACTACACCGAGGGCGCTGAGCTCATCGACTCCGTCCTCGATGTC  410

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||| ||   |||||||||||| || ||||||||  |||| |||||| | 
Sbjct  411  GTCCGCAAGGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCCATG  470

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||||||||| || ||||| ||||| || ||  ||||| ||||||||||||||
Sbjct  471  GGCGGTGGCACTGGCTCGGGCATGGGCACCCTCCTCATCGCCAAGGTCCGCGAGGAGTAC  530

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | || |||  ||| ||||||||  | ||||||||||||||||||||||| || 
Sbjct  531  CCTGACCGCATGATGTGCACGTACTCGGTGTTCCCGTCGCCCAAGGTGTCGGACACAGTC  590

Query  481  GT  482
            ||
Sbjct  591  GT  592


>ref|XR_020296.2| PREDICTED: Pan troglodytes tubulin beta-8 chain B-like (LOC737774), 
miscRNA
Length=1499

 Score =  462 bits (512),  Expect = 8e-127
 Identities = 393/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| || || |||| ||||||  || | ||| |||||||||| |||
Sbjct  58   TTCTGGGAGGTGATCTCTGAAGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||| ||| ||||
Sbjct  118  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTAGCAGGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||||||||||||||||| ||||| 
Sbjct  178  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||||||||| ||||||||  | | ||| ||||  || ||||| |||
Sbjct  238  CCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATTTCCGGTCAGTGTGGGGCCGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||| |||||||| |  |||||||| || || |||||| |||| |||||| | || |||
Sbjct  298  AACTGAGCCAAGGGACGCTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  358  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || || || ||||| ||| |    |||||||| |||||||||
Sbjct  418  GGTGGGGGGACTGGGTCTGGGATCGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |   ||  |||| |||||||||||||| |||||| | 
Sbjct  478  CCAGACAGGATCATAAACACATTCAGCGTCCTGCCCTCGCCCAAGGTGTCAGACACCATG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>emb|FQ227178.1| Rattus norvegicus TL0AEA14YK04 mRNA sequence
Length=1568

 Score =  462 bits (512),  Expect = 8e-127
 Identities = 388/476 (82%), Gaps = 0/476 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  122  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  181

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  182  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  241

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  242  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGTTCAGGG  301

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  302  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  361

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  362  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTTGACTCGGTGTTGGACGTT  421

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  422  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  481

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  482  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  541

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACAC  476
            || ||||| ||||||||||| | |   || || || || |||||||||||||||||
Sbjct  542  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACAC  597


>ref|XM_002412028.1| Ixodes scapularis beta-tubulin, putative, mRNA
Length=1371

 Score =  462 bits (512),  Expect = 8e-127
 Identities = 393/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||  | |||||||| ||||| ||||||||| | ||||||  ||| |||||||| 
Sbjct  88   TTTTGGGATGTGATCTCCGACGAGCACGGCATCGATTCAACCGGCAGCTATCACGGTGAT  147

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                |||| ||||||||| | ||||||||||||||||| ||||| |||||||||| ||| 
Sbjct  148  TCGAACCTCCAGCTGGAGAGAATCAATGTGTACTACAACGAGGCCTCCGGTGGCAGGTAT  207

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||| | || ||||| || ||||| || ||||||||| | || || || |||
Sbjct  208  GTGCCGCGTGCTATACTGGTCGACCTTGAGCCGGGAACCATGGACACCGTACGGTCTGGA  267

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||| | |||| ||| |||||||||||||| ||||||   |||||||||| |
Sbjct  268  CCCTTTGGCCAGCTTTTCAAGCCAGACAACTTTGTGTTTGGCCAGAGTGGTGCCGGCAGC  327

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| |||||||| |||||||||||||| || || || || 
Sbjct  328  AACTGGGCCAAGGGTCACTACACGGAGGGTGCGGAGCTGGTGGACTCGGTCCTGGACGTG  387

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||| ||   ||| ||||||||||| ||||||||  | || |||||| | 
Sbjct  388  GTGCGCAAGGAGGCAGAGGGCTGTGACTGCCTGCAGGGCTTCCAGATGACCCACTCCTTG  447

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || ||||| || ||||| |||||||| || ||||||||||| |||||||||
Sbjct  448  GGTGGTGGTACCGGCTCGGGCATGGGCACCCTGCTCATCTCCAAGATCCGAGAGGAGTAC  507

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||||||||| | |   || || || || |||||||| ||||||||||| 
Sbjct  508  CCGGACAGGATCATGAACACGTTCAGCGTGGTACCTTCCCCCAAGGTTTCGGACACCGTG  567

Query  481  GTGG  484
            ||||
Sbjct  568  GTGG  571


>ref|XM_002020094.1| Drosophila persimilis GL13671 (Dper\GL13671), mRNA
Length=1338

 Score =  462 bits (512),  Expect = 8e-127
 Identities = 393/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | || || || |||||  | || |||||||||||| | ||| |||| |||
Sbjct  58   TTTTGGGAGGTAATATCTGACGAGCACTGTATAGATGCCACCGGCACGTACTACGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||  ||||  | ||||| || |||||||||||||| |||||| | || |  ||||| 
Sbjct  118  AGTGATTTGCAATTAGAGCGAATAAATGTGTACTACAACGAGGCGACAGGAGCGAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || || |||||  | |||||||| |||||||||||||||||||| || ||||| || || 
Sbjct  178  GTACCACGCGCCATTCTTGTCGACCTGGAGCCCGGCACCATGGATTCGGTGCGCTCCGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             |||| || || |||||| |||||||||||||||| || || |||||||| || || |||
Sbjct  238  GCTTTTGGTCAAATCTTCCGGCCCGACAACTTTGTCTTTGGGCAGTCGGGGGCGGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| || || || |||||||||||||| ||||| ||||| 
Sbjct  298  AACTGGGCCAAGGGACACTACACGGAAGGAGCCGAGCTGGTGGACTCTGTGCTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||| | ||   ||| || || ||||| |||||||| || || ||||| || 
Sbjct  358  GTGCGAAAGGAGTCGGAGGGCTGTGATTGTCTGCAGGGCTTCCAGCTGACTCACTCGCTC  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| ||||| || ||||| ||||||||||| |||||||||||||||||||||
Sbjct  418  GGCGGAGGCACCGGCTCGGGCATGGGCACCCTGCTGATCTCCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |||||| ||||| |||||||| ||||||||||| || 
Sbjct  478  CCCGACCGAATCATGAACACCTTCTCGGTGGTGCCATCGCCCAAAGTGTCGGACACGGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|EU080882.1| Phytophthora sp. PDA576 beta-tubulin gene, partial cds
Length=1203

 Score =  462 bits (512),  Expect = 8e-127
 Identities = 389/475 (82%), Gaps = 2/475 (0%)
 Strand=Plus/Plus

Query  11   TCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGC  70
            ||||||| || ||||| ||| ||||  |||| |||  ||||||||| |||   |||||||
Sbjct  2    TCATCTCGGACGAGCACGGCGTCGACCCCACGGGCAGCTACCACGGCGACTCGGACCTGC  61

Query  71   AGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCG  130
            |||| ||||||||||| ||||||||||| |||||  | || |||   |||||||| ||||
Sbjct  62   AGCTCGAGCGCATCAACGTGTACTACAACGAGGCCACGGGCGGCCGCTACGTGCCGCGCG  121

Query  131  CTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCC  190
            |  ||||  | || ||||||||||||||||||||||| || ||  | || || | |||||
Sbjct  122  CCATCCTCATGGACCTGGAGCCCGGCACCATGGACTCGGTCCGCGCCGGCCCCTACGGCC  181

Query  191  AGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCA  250
            || ||||| | || |||||||| |||||||||||| |||| ||||| |||||||||||||
Sbjct  182  AGCTCTTCCGCCCGGACAACTTCGTGTTCGGCCAGACGGGCGCCGGTAACAACTGGGCCA  241

Query  251  AGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGG  310
            |||| || ||||| || ||||| |||||  | ||||| ||||| || || ||||||||||
Sbjct  242  AGGGACACTACACGGAAGGTGCGGAGCTCATCGACTCGGTGCTGGACGTCGTCCGCAAGG  301

Query  311  AGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCA  370
            |||||||   ||| ||||||||||| ||||||||  |||| ||||| || || ||||| |
Sbjct  302  AGGCCGAGAGCTGTGACTGCCTGCAGGGCTTCCAGATCACCCACTCGCTGGGTGGCGGTA  361

Query  371  CTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGA  430
            | |||||||||||||| || || ||||| ||||||||||| ||||||||||| ||| | |
Sbjct  362  CCGGCTCCGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTA  421

Query  431  TCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGGTGTCGGACACCGTTGTGG  484
            |||||  ||| ||||||| |||| ||||||||||||||||||||||| || ||||
Sbjct  422  TCATGTGCACGTACTCGG-TGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGG  475


>gb|BC118413.1| Bos taurus tubulin, beta 2A, mRNA (cDNA clone MGC:140632 IMAGE:8272633), 
complete cds
Length=1293

 Score =  462 bits (512),  Expect = 8e-127
 Identities = 393/484 (82%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||  |||||   |||||||||||||||||  |||| |||   |||||||| |||
Sbjct  95   TTTTGGGAAGTCATCAGTGATGAGCATGGCATCGACCCCACTGGCAGTTACCACGGAGAC  154

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | |||||||||||||||||||||||  |||||  |||||| 
Sbjct  155  AGTGACTTGCAGCTGGAGAGAATCAATGTGTACTACAATGAGGCCACCGGTAACAAGTAT  214

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || || |||||||| |||||||||||||| ||  | || |||
Sbjct  215  GTGCCTCGGGCCATCCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCAGGTCTGGA  274

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || |||||||||||||||||||| |||||||| ||||| ||||||   |||||||| |||
Sbjct  275  CCCTTCGGCCAGATCTTCAGGCCTGACAACTTCGTGTTTGGCCAGAGTGGTGCCGGGAAC  334

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||||| || || || || 
Sbjct  335  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  394

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| ||||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  395  GTCAGGAAGGAGTCCGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  454

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || ||||| || || || ||||| ||||| || |||   ||||||||||||||||||
Sbjct  455  GGGGGTGGCACGGGGTCTGGGATGGGGACCCTTCTCATTAGTAAGATCCGCGAGGAGTAC  514

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| |||||||||||||| ||||| || 
Sbjct  515  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCCGACACGGTG  574

Query  481  GTGG  484
            ||||
Sbjct  575  GTGG  578


>emb|BX052775.1| Single read from an extremity of a full-length cDNA clone made 
from Anopheles gambiae total adult females. 5-PRIME end of 
clone FK0AAC30AC12 of strain 6-9 of Anopheles gambiae (African 
malaria mosquito)
Length=928

 Score =  462 bits (512),  Expect = 8e-127
 Identities = 345/404 (86%), Gaps = 0/404 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            |||||||| || |||||||||||||| || |||||||| ||||| |  |||||||| |||
Sbjct  239  TTCTGGGAAATTATCTCCGATGAGCACGGTATCGATGCGACCGGTGGATACCACGGCGAC  298

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || |||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct  299  TCAGATCTGCAGCTAGAGCGCATCAACGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  358

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || || || || |||||||| |||||||| ||||||||||| || || || || 
Sbjct  359  GTGCCGCGTGCCGTGCTGGTCGATCTCGAGCCCGGTACCATGGACTCGGTCCGCTCCGGC  418

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| |||||||| |||||||| ||||| |||
Sbjct  419  CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTGTTCGGACAGTCGGGCGCCGGTAAC  478

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||||||||||||||| ||||| |||||||| || 
Sbjct  479  AACTGGGCCAAGGGCCACTACACCGAGGGTGCTGAGCTGGTCGACTCCGTGCTCGACGTG  538

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||||||||||||||| ||||| |||||||| || || ||||| || 
Sbjct  539  GTGCGCAAGGAGGCCGAATCCTGCGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTC  598

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAA  404
            || ||||| || |||||||| ||||| || |||||||| || ||
Sbjct  599  GGTGGCGGTACCGGCTCCGGCATGGGCACGCTGCTGATCTCGAA  642


>emb|FQ228801.1| Rattus norvegicus TL0ADA51YK12 mRNA sequence
Length=1565

 Score =  461 bits (510),  Expect = 3e-126
 Identities = 392/482 (82%), Gaps = 1/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  122  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  181

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  182  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  241

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  242  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  301

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||  | | || || |||
Sbjct  302  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAG-AGTGGGCTGGGAAC  360

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  361  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTTGACTCGGTGTTGGACGTT  420

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  421  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  480

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  481  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  540

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||| | |   || || || || ||||||||||||||||| || 
Sbjct  541  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACACAGTG  600

Query  481  GT  482
            ||
Sbjct  601  GT  602


>gb|EU080659.1| Phytophthora macrochlamydospora isolate PD_00006(P8017) beta-tubulin 
gene, partial cds
Length=1140

 Score =  461 bits (510),  Expect = 3e-126
 Identities = 372/447 (84%), Gaps = 2/447 (0%)
 Strand=Plus/Plus

Query  39   CACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAA  98
            ||| |||  ||||||||| |||   ||||||||||||||||||||||| |||||||||||
Sbjct  1    CACGGGCAGCTACCACGGCGACTCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAA  60

Query  99   TGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCAC  158
             |||||  | || |||   |||||||| |||||  ||||  | || ||||||||||||||
Sbjct  61   CGAGGCCACGGGCGGCCGCTACGTGCCGCGCGCCATCCTCATGGACCTGGAGCCCGGCAC  120

Query  159  CATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTT  218
            ||||||||| |||||  | || || | ||||||| ||||| | || ||||||||||||||
Sbjct  121  CATGGACTCGGTGCGCGCCGGYCCCTACGGCCAGCTCTTCCGCCCGGACAACTTTGTGTT  180

Query  219  CGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCT  278
            ||||||| |||| ||||| ||||||||||||||||| || ||||| || || || |||||
Sbjct  181  CGGCCAGACGGGCGCCGGTAACAACTGGGCCAAGGGACACTACACGGAAGGCGCCGAGCT  240

Query  279  GGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGG  338
              | ||||| ||||| || || |||||||||||||||||   ||||||||||||||| ||
Sbjct  241  CATCGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGG  300

Query  339  CTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGAT  398
            ||||||  |||| ||||| || || ||||||||||||||||||||||| || || |||||
Sbjct  301  CTTCCAGATCACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGAT  360

Query  399  TTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTG-CCGT  457
             ||||||||||||||||||||||| ||| | ||||||  ||| ||||||| |||| ||||
Sbjct  361  CTCCAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGT  419

Query  458  CGCCCAAGGTGTCGGACACCGTTGTGG  484
            |||||||||| |||||||| || ||||
Sbjct  420  CGCCCAAGGTCTCGGACACGGTCGTGG  446


>gb|DQ980513.1| Chrysochromulina sp. NIES-1333 beta tubulin mRNA, partial cds
Length=1141

 Score =  461 bits (510),  Expect = 3e-126
 Identities = 381/465 (82%), Gaps = 0/465 (0%)
 Strand=Plus/Plus

Query  18   CGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGA  77
            ||| ||||||||||||||  | |||||| |||||||||| |||   ||||| ||||| ||
Sbjct  10   CGACGAGCATGGCATCGACCCGACCGGCACCTACCACGGCGACTCGGACCTCCAGCTCGA  69

Query  78   GCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCT  137
            ||||||||| ||||||||||| |||||| |||| |||   ||||||||||||    ||||
Sbjct  70   GCGCATCAACGTGTACTACAACGAGGCGACCGGCGGCCGCTACGTGCCCCGCAACATCCT  129

Query  138  TGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTT  197
              | || || ||||| |||||||||||||| || || ||||| || ||||||||||||||
Sbjct  130  GATGGACCTCGAGCCGGGCACCATGGACTCGGTCCGCTCGGGCCCCTTCGGCCAGATCTT  189

Query  198  CAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCA  257
            | | || |||||||| || |||||||||||||| ||||||||||||||||||||||| ||
Sbjct  190  CCGCCCGGACAACTTCGTCTTCGGCCAGTCGGGCGCCGGCAACAACTGGGCCAAGGGCCA  249

Query  258  TTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGA  317
             ||||| ||||| || |||||  | ||  | || || || || |||||||||||||||||
Sbjct  250  CTACACCGAGGGCGCCGAGCTCATCGATGCCGTCCTTGACGTCGTCCGCAAGGAGGCCGA  309

Query  318  ATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTC  377
               |||||||||||| || ||||||    | || ||||| || || |||||||| |||||
Sbjct  310  GGGCTGCGACTGCCTCCAGGGCTTCACCATGACGCACTCGCTCGGTGGCGGCACCGGCTC  369

Query  378  CGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAA  437
            ||| ||||| || || ||||| ||||||||||||||||||||||||||| |  |||||  
Sbjct  370  CGGCATGGGCACGCTCCTGATCTCCAAGATCCGCGAGGAGTACCCCGACCGCGTCATGTG  429

Query  438  CACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGT  482
            ||| ||||||||  | |||||||||||||||||||||||||| ||
Sbjct  430  CACCTACTCGGTCTTCCCGTCGCCCAAGGTGTCGGACACCGTCGT  474


>ref|XM_003480812.1| PREDICTED: Sus scrofa tubulin beta-4 chain-like (LOC100736584), 
mRNA
Length=2011

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||   |||||||||||||| ||| |||| ||| | |||||||| |||
Sbjct  185  TTTTGGGAGGTGATCAGTGATGAGCATGGCATTGATCCCACTGGCACATACCACGGGGAC  244

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||| ||||| | ||||| || ||||||||||||||  | || || || || 
Sbjct  245  AGCGACCTGCAGTTGGAGAGGATCAACGTCTACTACAATGAGGCCACAGGAGGAAATTAT  304

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||| | ||||| || || || |||||||| |||||||||||||| || || || || 
Sbjct  305  GTCCCCAGAGCTGTGCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCCGCTCAGGT  364

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||||||||  | || |||||||||||||| ||||| || || |||||||||
Sbjct  365  CCCTTTGGCCAGATCTTTCGACCTGACAACTTTGTGTTTGGCCAATCCGGAGCCGGCAAC  424

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||| | || || || || 
Sbjct  425  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACGCGGTTCTGGACGTG  484

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||| |||||||| ||   ||| ||||||||||| ||||||||||| || ||||| || 
Sbjct  485  GTCCGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAACTGACCCACTCGCTG  544

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| || ||||| ||||| |||||||| ||   ||||||||||||||||| |
Sbjct  545  GGCGGTGGCACGGGGTCCGGCATGGGGACCCTGCTCATCAGCAAGATCCGCGAGGAGTTC  604

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| ||||||||||||| | |   || || || || ||||||||||| ||||| || 
Sbjct  605  CCGGACCGGATCATGAACACCTTCAGCGTGGTACCCTCCCCCAAGGTGTCTGACACGGTG  664

Query  481  GTGG  484
            ||||
Sbjct  665  GTGG  668


>ref|XM_003455030.1| PREDICTED: Oreochromis niloticus tubulin beta-1 chain-like (LOC100712415), 
mRNA
Length=1543

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 391/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||   |||||||||||||| ||  | || ||| | ||||||||||||
Sbjct  111  TTTTGGGAGGTGATCAGTGATGAGCATGGCATTGACCCAACTGGCACTTACCACGGTGAC  170

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||||||||||||  | |||||||| ||||||||||| || || |||||||| || 
Sbjct  171  AGTGACCTGCAGCTGGACAGGATCAATGTCTACTACAATGAAGCATCAGGTGGCAAATAT  230

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||||||||||| ||||||||||| |||||||||||||||||| | || || 
Sbjct  231  GTGCCCCGTGCTGTCCTTGTGGATCTGGAGCCAGGCACCATGGACTCTGTGAGGTCTGGT  290

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||  ||||||| || |||||||| || || ||||||   ||||| || |||
Sbjct  291  CCCTTTGGCCAAGTCTTCAGACCAGACAACTTCGTTTTTGGCCAGAGCGGTGCTGGTAAC  350

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| |||||||| ||||| |||||||||||||| || || ||||| 
Sbjct  351  AACTGGGCCAAGGGTCACTACACAGAAGGTGCAGAGCTGGTGGACTCTGTCCTGGATGTG  410

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||||||||||||||| |||||||| |||||||||||||| 
Sbjct  411  GTGAGGAAGGAGGCAGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTCACACACTCCCTG  470

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || || || |||||||| || ||||| ||   |||||||||||| ||||| 
Sbjct  471  GGTGGCGGTACGGGATCTGGTATGGGCACACTGCTCATCAGCAAGATCCGCGAAGAGTAT  530

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | || |||||||| | |   || ||||| || || || || || ||||| |||
Sbjct  531  CCTGACCGCATTATGAACACCTTCAGCGTGGTGCCTTCCCCAAAAGTATCAGACACAGTT  590

Query  481  GT  482
            ||
Sbjct  591  GT  592


>ref|XM_851058.2| PREDICTED: Canis lupus familiaris tubulin, beta 2B, transcript 
variant 2 (TUBB2B), mRNA
Length=1745

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| |||||   || ||||| || |||||  ||||||||   ||||| || |||
Sbjct  161  TTTTGGGAGGTCATCAGTGACGAGCACGGGATCGACCCCACCGGCAGTTACCATGGAGAC  220

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||| ||||||||||| | |||||||||||||||||||| ||  | |||  ||| || 
Sbjct  221  AGCGACTTGCAGCTGGAGAGAATCAATGTGTACTACAATGAAGCTACTGGTAACAAATAT  280

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || ||||||||||| |||||||||||||| ||  | || || 
Sbjct  281  GTGCCTCGGGCCATCCTGGTGGATCTGGAGCCAGGCACCATGGACTCGGTCAGGTCTGGG  340

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||||||||||||||||||||||| ||||| ||||||   |||||||| |||
Sbjct  341  CCATTTGGCCAGATCTTCAGGCCCGACAACTTCGTGTTTGGCCAGAGCGGTGCCGGGAAC  400

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||||| ||||| ||||| || || 
Sbjct  401  AACTGGGCCAAGGGCCACTACACGGAGGGCGCCGAGCTGGTAGACTCGGTGCTGGACGTG  460

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||| | ||   ||||||||||||||| |||||||| || || ||||| || 
Sbjct  461  GTGAGGAAGGAGTCGGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTGACGCACTCGCTG  520

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| || ||||| ||   |||||||||||||||||||
Sbjct  521  GGCGGCGGCACGGGCTCGGGCATGGGCACGCTGCTCATCAGCAAGATCCGCGAGGAGTAC  580

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| |||||||||||||||||||| || 
Sbjct  581  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCGGACACGGTG  640

Query  481  GTGG  484
            ||||
Sbjct  641  GTGG  644


>dbj|AB512849.1| Pythium senticosum gene for beta-tubulin, partial cds, strain: 
NBRC 104222
Length=1287

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||  | ||||||||||| || ||| ||||  |||||||   |||||||||||||
Sbjct  28   TTCTGGGAAGTGATCTCCGATGAACACGGCGTCGACCCCACCGGTAGCTACCACGGTGAC  87

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              ||||||||||||||||||||| |||||||||||||| || ||  | |||||    |||
Sbjct  88   TCCGACCTGCAGCTGGAGCGCATTAATGTGTACTACAACGAAGCCACTGGTGGTCGCTAC  147

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||  | ||  | ||||||||||| || ||||||||||| || ||  | || 
Sbjct  148  GTGCCCCGCGCCATTCTCATGGATCTGGAGCCTGGTACCATGGACTCGGTCCGTGCTGGC  207

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || |  || ||| | ||| | || ||||||||||| ||||||||| | ||||| || |||
Sbjct  208  CCGTATGGTCAGCTTTTCCGCCCTGACAACTTTGTCTTCGGCCAGACTGGTGCTGGTAAC  267

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||||||||| ||||| || ||||||||  || | ||||| || |||||||| 
Sbjct  268  AACTGGGCCAAGGGTCACTACACGGAAGGTGCTGAATTGATCGACTCGGTCCTCGATGTC  327

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||| ||||||||||| || |||||||| || |||||  |||| ||||| || 
Sbjct  328  GTCCGCAAGGAAGCCGAATCCTGTGATTGCCTGCAGGGTTTCCAGATCACGCACTCTCTC  387

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| ||||||||||| || || ||||||||||||||||| || ||||||
Sbjct  388  GGTGGTGGTACTGGTTCCGGTATGGGCACGCTTCTGATTTCCAAGATCCGTGAAGAGTAC  447

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||  | ||||||  ||| |||||||||   |||||||||||||||||||| ||||| 
Sbjct  448  CCGGATCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCCAAGGTGTCGGATACCGTC  507

Query  481  GTGG  484
            ||||
Sbjct  508  GTGG  511


>emb|FQ212956.1| Rattus norvegicus TL0AAA50YI04 mRNA sequence
Length=1577

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 391/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  122  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  181

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  |||||| |||||| 
Sbjct  182  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGACAAGTAT  241

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  242  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  301

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  302  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  361

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  362  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTCGACTCGGTGTTGGACGTT  421

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  422  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  481

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  482  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  541

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||| | |   || || || || ||||||||||||||||| || 
Sbjct  542  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACACAGTG  601

Query  481  GT  482
            ||
Sbjct  602  GT  603


>emb|FQ213825.1| Rattus norvegicus TL0AAA45YH10 mRNA sequence
Length=1571

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 391/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | |||||||| || 
Sbjct  122  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACCACGGAGAT  181

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  182  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  241

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  242  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  301

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  302  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  361

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  362  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTTGACTCGGTGTTGGACGTT  421

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  422  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  481

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  482  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  541

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||| | |   || || ||  | ||||||||||||||||| || 
Sbjct  542  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTCCCCCCAAGGTGTCGGACACAGTG  601

Query  481  GT  482
            ||
Sbjct  602  GT  603


>emb|FQ215022.1| Rattus norvegicus TL0ACA50YB23 mRNA sequence
Length=1570

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 391/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||  ||| ||||||||||| ||| |||| ||| | ||| |||| || 
Sbjct  122  TTCTGGGAGGTAATCAGCGACGAGCATGGCATTGATCCCACTGGCACGTACTACGGAGAT  181

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| ||||||||||| |||||  ||||||||||||| 
Sbjct  182  AGCGACCTCCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACCGGTGGCAAGTAT  241

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||  |||||||||||||||||||||| ||||| || || 
Sbjct  242  GTGCCCCGCGCTGTGCTCGTGGACTTGGAGCCCGGCACCATGGACTCGGTGCGCTCAGGG  301

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || || ||||| || || || |||   || || || |||
Sbjct  302  CCCTTCGGGCAGATCTTCAGACCTGATAACTTCGTTTTTGGTCAGAGTGGGGCTGGGAAC  361

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| ||||| |||||||| ||||| ||| | || |||
Sbjct  362  AACTGGGCCAAGGGGCACTACACAGAAGGTGCAGAGCTGGTTGACTCGGTGTTGGACGTT  421

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | ||||| || ||   ||| |||||||||||||||||||| || || |||||||| 
Sbjct  422  GTGAGGAAGGAAGCTGAGAGCTGTGACTGCCTGCAAGGCTTCCAGCTGACCCACTCCCTG  481

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| || ||   ||||||||| |||||||||
Sbjct  482  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTTATCAGCAAGATCCGGGAGGAGTAC  541

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||| | |   || || || || ||||||||||||||||| || 
Sbjct  542  CCAGACAGAATCATGAACACCTTCAGTGTGGTCCCTTCCCCCAAGGTGTCGGACACAGTG  601

Query  481  GT  482
            ||
Sbjct  602  GT  603


>ref|XR_096940.1| PREDICTED: Pongo abelii tubulin beta-8 chain-like (LOC100439021), 
partial miscRNA
Length=1581

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| | || ||| ||  || | ||| ||| |||||| |||
Sbjct  131  TTCTGGGAGGTGATCTCTGATGAACGTGCCATTGACTCCGCTGGCACCTGCCACGGGGAC  190

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||| |||||||||||||||||||||| ||||||||||| |||||   |||||||| ||||
Sbjct  191  AGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTAC  250

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || |||||||||||| ||||| ||||||||||||| ||||| 
Sbjct  251  GTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCCCGCACCGTGGACTCTGTGCGCTCGGGG  310

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||| |||| ||||| ||||||||  | ||||| |||   || ||||| |||
Sbjct  311  CCCTTCGGGCAGGTCTTTAGGCCAGACAACTTCATCTTCGGTCAGAGTGGGGCCGGAAAC  370

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| ||  ||||||| || || |||||| ||||  ||||| | || |||
Sbjct  371  AACTGGGCCAAGGGACACCACACAGAAGGCGCGGAGCTGATGGAGCCAGTGATGGACGTT  430

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  431  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  490

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  491  GGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  550

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||||||||||||||||||| 
Sbjct  551  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTG  610

Query  481  GTGG  484
            ||||
Sbjct  611  GTGG  614


>ref|XM_001104203.2| PREDICTED: Macaca mulatta tubulin beta-8 chain-like, transcript 
variant 2 (LOC715011), mRNA
Length=1382

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | ||||| ||||| || | ||||||  || | ||| |||||||||| |||
Sbjct  99   TTCTGGGAGGTGATCTCTGATGAACACGCCATCGACTCCGCGGGCACCTACCACGGGGAC  158

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||  ||||||||||||||||||| | ||||||||||| ||||| | |||||||| ||||
Sbjct  159  AGCCGCCTGCAGCTGGAGCGCATCGACGTGTACTACAACGAGGCCTTCGGTGGCAGGTAC  218

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||||||| || || ||||||||||| |||||| ||||||||||||| ||||| 
Sbjct  219  GTGCCCCGCGCTGTGCTGGTGGATCTGGAGCCGGGCACCCTGGACTCTGTGCGCTCGGGG  278

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| |||||||||||||| ||||||||  | ||||| |||   || ||||| |||
Sbjct  279  CCCTTCGGGCAGATCTTCAGGCCAGACAACTTCATCTTCGGTCAGAGTGGGGCCGGAAAC  338

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||| ||| || |||||||| || || |||||| |||| |||||| | || |||
Sbjct  339  AACTGGGCCAGGGGACACTACACAGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTT  398

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||||| ||   ||| ||||||||||| || ||||| || || |||||||| 
Sbjct  399  GTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTG  458

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || || || ||||| ||||| ||| |    |||||||| |||||||||
Sbjct  459  GGTGGGGGGACGGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTAC  518

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||||||||| ||||||| |    |  |||| ||||||| |||||| ||||| || 
Sbjct  519  CCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAGGGTGTCAGACACGGTG  578

Query  481  GTGG  484
            ||||
Sbjct  579  GTGG  582


>ref|XM_002720955.1| PREDICTED: Oryctolagus cuniculus tubulin, beta-like (LOC100350045), 
mRNA
Length=1338

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||   || || || || |||||  |||| |||   ||||| || |||
Sbjct  58   TTCTGGGAGGTCATCAGTGACGAACACGGTATCGACCCCACTGGCAGTTACCATGGAGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | ||||||||||||||||| || ||  | ||   |||||||
Sbjct  118  AGTGACTTGCAGCTGGAGAGGATCAATGTGTACTACAACGAAGCCACTGGCAACAAGTAC  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  |||| || || ||||||||||||||||||||||| ||  | ||||||
Sbjct  178  GTCCCCCGGGCCATCCTGGTGGACCTGGAGCCCGGCACCATGGACTCGGTCAGGTCGGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || |||||||||||||||||||| |||||||| ||||| ||||||   || || || |||
Sbjct  238  CCCTTCGGCCAGATCTTCAGGCCGGACAACTTCGTGTTTGGCCAGAGCGGGGCTGGGAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||||||||| || |||||||||||||| ||||| || || 
Sbjct  298  AACTGGGCTAAGGGCCACTACACAGAGGGGGCCGAGCTGGTGGACTCGGTGCTGGACGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||  ||||   ||||||||||||||| |||||||| || || ||||| || 
Sbjct  358  GTGAGGAAGGAATCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||||| || ||||| |||||||| ||   |||||||||||||||||||
Sbjct  418  GGCGGCGGCACGGGCTCGGGCATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| |||||||||||||| |||||||| 
Sbjct  478  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCCGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>dbj|AK347939.1| Sus scrofa mRNA, clone:OVRM10021H10, expressed in ovary
Length=2005

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||   |||||||||||||| ||| |||| ||| | |||||||| |||
Sbjct  164  TTTTGGGAGGTGATCAGTGATGAGCATGGCATTGATCCCACTGGCACATACCACGGGGAC  223

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||| ||||| | ||||| || ||||||||||||||  | || || || || 
Sbjct  224  AGCGACCTGCAGTTGGAGAGGATCAACGTCTACTACAATGAGGCCACAGGAGGAAATTAT  283

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||| | ||||| || || || |||||||| |||||||||||||| || || || || 
Sbjct  284  GTCCCCAGAGCTGTGCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCCGCTCAGGT  343

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || || |||||||||||  | || |||||||||||||| ||||| || || |||||||||
Sbjct  344  CCCTTTGGCCAGATCTTTCGACCTGACAACTTTGTGTTTGGCCAATCCGGAGCCGGCAAC  403

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||| | || || || || 
Sbjct  404  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACGCGGTTCTGGACGTG  463

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||| |||||||| ||   ||| ||||||||||| ||||||||||| || ||||| || 
Sbjct  464  GTCCGGAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGCTTCCAACTGACCCACTCGCTG  523

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| || ||||| ||||| |||||||| ||   ||||||||||||||||| |
Sbjct  524  GGCGGTGGCACGGGGTCCGGCATGGGGACCCTGCTCATCAGCAAGATCCGCGAGGAGTTC  583

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| ||||||||||||| | |   || || || || ||||||||||| ||||| || 
Sbjct  584  CCGGACCGGATCATGAACACCTTCAGCGTGGTACCCTCCCCCAAGGTGTCTGACACGGTG  643

Query  481  GTGG  484
            ||||
Sbjct  644  GTGG  647


>gb|FJ168554.1| Bodo saltans clone fosmid 5M18, complete sequence
Length=28046

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Minus

Query  1      TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
              ||||||||| |||||||||| ||||| ||| ||||  |||||||  ||||||| || |||
Sbjct  15052  TTCTGGGAGGTCATCTCCGACGAGCACGGCGTCGACCCCACCGGTACCTACCAGGGCGAC  14993

Query  61     AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                 ||||||||| ||||||||||||| ||||||| ||| |||||  |||| ||    |||
Sbjct  14992  TCGGACCTGCAGTTGGAGCGCATCAACGTGTACTTCAACGAGGCCACCGGCGGACGCTAC  14933

Query  121    GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
              || |||||||| || ||  | ||  |||||||||||||||||||||| || ||  | || 
Sbjct  14932  GTCCCCCGCGCGGTGCTGATGGACTTGGAGCCCGGCACCATGGACTCCGTCCGCGCCGGC  14873

Query  181    CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
              || | ||||||||||||| | || |||||||| || ||||||||||| || || ||||||
Sbjct  14872  CCCTACGGCCAGATCTTCCGCCCAGACAACTTCGTCTTCGGCCAGTCTGGCGCTGGCAAC  14813

Query  241    AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
              |||||||||||||| || ||||| |||||||| |||||| | ||||| || ||||| || 
Sbjct  14812  AACTGGGCCAAGGGCCACTACACGGAGGGTGCGGAGCTGATTGACTCCGTCCTCGACGTG  14753

Query  301    GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
                |||||||||||| ||   ||||||||||||||| ||||||||  || | |||||||| 
Sbjct  14752  TGCCGCAAGGAGGCGGAGAGCTGCGACTGCCTGCAGGGCTTCCAGATCTCCCACTCCCTC  14693

Query  361    GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
              || || ||||| |||||||| ||||||||||||||||| || ||| | ||||||||||||
Sbjct  14692  GGTGGTGGCACGGGCTCCGGCATGGGAACCCTGCTGATCTCGAAGCTGCGCGAGGAGTAC  14633

Query  421    CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
              |||||| | |||||||  || | |||  |  | || |||||||||||||| |||||||| 
Sbjct  14632  CCCGACCGTATCATGATGACCTTCTCCATCATCCCCTCGCCCAAGGTGTCCGACACCGTC  14573

Query  481    GTGG  484
              ||||
Sbjct  14572  GTGG  14569


 Score = 66.2 bits (72),  Expect = 2e-07
 Identities = 190/287 (67%), Gaps = 4/287 (1%)
 Strand=Plus/Minus

Query  112    GGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTG  171
              |||||| |||| |||||| | ||  |  |||| ||||||||   |  | | |||   |||
Sbjct  13400  GGCAAGCACGTCCCCCGCTCCGTGTTCCTCGACCTGGAGCCGACCGTCGTTGACGAGGTG  13341

Query  172    CG-ATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGG  230
              || | ||| ||||  || |||| | |||   |||||  |  |  | | |||| ||  || 
Sbjct  13340  CGCACCGGCACCTACCG-CCAGCTGTTCCACCCCGAGCAGCTGATCTCCGGCAAGGAGGA  13282

Query  231    TGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGT  290
              ||| |  |||||||  |||   ||||| |||||    ||    ||| | || ||| | ||
Sbjct  13281  TGCGGCGAACAACTACGCCCGTGGTCACTACACCATTGGCAAGGAGATCGTCGAC-CTGT  13223

Query  291    GC-TCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCA  349
              || ||||     ||||||||   || ||   ||||  | ||||||| ||||||    || 
Sbjct  13222  GCCTCGACCGCATCCGCAAGCTTGCGGACAACTGCACCGGCCTGCAGGGCTTCATGATCT  13163

Query  350    CACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTG  396
                ||| || | ||||| ||||||||||||||  ||||  |||| |||
Sbjct  13162  TCCACGCCGTCGGCGGTGGCACTGGCTCCGGCCTGGGCGCCCTCCTG  13116


 Score = 62.6 bits (68),  Expect = 2e-06
 Identities = 189/287 (66%), Gaps = 4/287 (1%)
 Strand=Plus/Minus

Query  112    GGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTG  171
              |||||| |||| |||||| | ||  |  | || ||||||||   |  | | |||   |||
Sbjct  16620  GGCAAGCACGTCCCCCGCTCCGTGTTCCTTGACCTGGAGCCGACCGTCGTTGACGAGGTG  16561

Query  172    CG-ATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGG  230
              || | ||| ||||  || |||| | |||   |||||  |  |  | | |||| ||  || 
Sbjct  16560  CGCACCGGCACCTACCG-CCAGCTGTTCCACCCCGAGCAGCTGATCTCCGGCAAGGAGGA  16502

Query  231    TGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGT  290
              ||| |  |||||||  |||   ||||| |||||    ||    ||| | || ||| | ||
Sbjct  16501  TGCGGCGAACAACTACGCCCGTGGTCACTACACCATTGGCAAGGAGATCGTCGAC-CTGT  16443

Query  291    GC-TCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCA  349
              || ||||     ||||||||   || ||   ||||  | ||||||| ||||||    || 
Sbjct  16442  GCCTCGACCGCATCCGCAAGCTTGCGGACAACTGCACCGGCCTGCAGGGCTTCATGATCT  16383

Query  350    CACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTG  396
                ||| || | ||||| ||||||||||||||  ||||  |||| |||
Sbjct  16382  TCCACGCCGTCGGCGGTGGCACTGGCTCCGGCCTGGGCGCCCTCCTG  16336


>ref|XM_002070539.1| Drosophila willistoni GK12133 (Dwil\GK12133), mRNA
Length=1341

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 391/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||||| || |||||  ||||||||||||| ||  | ||  | || |||
Sbjct  58   TTCTGGGAGGTCATCTCGGACGAGCACTGCATCGATGCCACGGGTACGTATTATGGCGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||  ||||  | ||||| || ||||||||||||||  |||| |  ||||| 
Sbjct  118  AGTGACTTGCAATTGGAAAGGATCAACGTCTACTACAATGAGGCCACCGGAGCGAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||| | || || |||||||| ||||||||||||||||||||||| || || 
Sbjct  178  GTGCCACGAGCTATTCTGGTAGATCTGGAACCCGGCACCATGGACTCTGTGCGCTCTGGG  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             | ||||| ||||||||||||||||| ||||||||||| |||||||| || || || |||
Sbjct  238  GCATTCGGTCAGATCTTCAGGCCCGATAACTTTGTGTTTGGCCAGTCAGGAGCTGGTAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||| || |||||||||||||| ||||| ||||| ||||| 
Sbjct  298  AACTGGGCCAAGGGACATTACACCGAAGGTGCTGAGCTGGTCGACTCTGTGCTGGATGTC  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || || |||||  | ||   |||||| |||||||| || ||||| || || ||||| || 
Sbjct  358  GTGCGAAAGGAATCTGAGGGCTGCGATTGCCTGCAGGGTTTCCAGCTGACTCACTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||| || ||||| || ||||| || |||||||| |||||||||||||| ||||| 
Sbjct  418  GGAGGCGGTACCGGCTCTGGAATGGGTACTCTGCTGATCTCCAAGATCCGCGAAGAGTAT  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | || |||||||||| ||| || || || || |||||||||||||| ||||| 
Sbjct  478  CCCGACCGCATTATGAACACATTCTCTGTGGTCCCTTCACCCAAGGTGTCGGATACCGTG  537

Query  481  GT  482
            ||
Sbjct  538  GT  539


>gb|EU080633.1| Phytophthora sp. P3007 beta-tubulin gene, partial cds
Length=1133

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 366/438 (84%), Gaps = 2/438 (0%)
 Strand=Plus/Plus

Query  48   CTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTC  107
            ||||||||| |||   ||||||||||||||||||||||| ||||||||||| |||||  |
Sbjct  7    CTACCACGGCGACTCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAC  66

Query  108  CGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTC  167
             || |||   |||||||| |||||  ||||  | || |||||||||||||||||||||||
Sbjct  67   GGGCGGCCGCTACGTGCCGCGCGCCATCCTCATGGACCTGGAGCCCGGCACCATGGACTC  126

Query  168  TGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTC  227
             |||||  | || || | ||||||| ||||| | || ||||||||||||||||||||| |
Sbjct  127  GGTGCGCGCCGGCCCCTACGGCCAGCTCTTCCGCCCGGACAACTTTGTGTTCGGCCAGAC  186

Query  228  GGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTC  287
            ||| ||||| ||||||||||||||||| || ||||| || || ||||||||  | |||||
Sbjct  187  GGGCGCCGGTAACAACTGGGCCAAGGGACACTACACGGAAGGCGCTGAGCTCATCGACTC  246

Query  288  AGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACT  347
             ||||| || || |||||||||||||||||   ||||||||||||||| ||||||||  |
Sbjct  247  GGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGAT  306

Query  348  CACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGAT  407
            ||| ||||| || || ||||||||||||||||||||||| || || ||||| ||||||||
Sbjct  307  CACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATCTCCAAGAT  366

Query  408  CCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGG  466
            ||| ||||||||||| ||| | ||||||  ||| ||||||| |||| |||||||||||||
Sbjct  367  CCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGTCGCCCAAGG  425

Query  467  TGTCGGACACCGTTGTGG  484
            | |||||||| || ||||
Sbjct  426  TCTCGGACACGGTCGTGG  443


>gb|EU080545.1| Phytophthora sp. P6875 beta-tubulin gene, partial cds
Length=1142

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 371/446 (84%), Gaps = 2/446 (0%)
 Strand=Plus/Plus

Query  40   ACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAAT  99
            || |||  ||||||||| |||   ||||||||||||||||||||||| ||||||||||| 
Sbjct  2    ACGGGCAGCTACCACGGCGACTCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAAC  61

Query  100  GAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACC  159
            |||||  | || |||   |||||||| |||||  ||||  | || |||||||||||||||
Sbjct  62   GAGGCCACGGGCGGCCGCTACGTGCCGCGCGCCATCCTCATGGACCTGGAGCCCGGCACC  121

Query  160  ATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTC  219
            |||||||| |||||  | || || | ||||||| ||||| | || |||||||||||||||
Sbjct  122  ATGGACTCGGTGCGCGCCGGTCCCTACGGCCAGCTCTTCCGCCCGGACAACTTTGTGTTC  181

Query  220  GGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTG  279
            |||||| |||| ||||| ||||||||||||||||| || ||||| || || || ||||| 
Sbjct  182  GGCCAGACGGGCGCCGGTAACAACTGGGCCAAGGGACACTACACGGAAGGCGCCGAGCTC  241

Query  280  GTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGC  339
             | ||||| ||||| || || |||||||||||||||||   ||||||||||||||| |||
Sbjct  242  ATCGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGC  301

Query  340  TTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATT  399
            |||||  |||| ||||| || || ||||||||||||||||||||||| || || ||||| 
Sbjct  302  TTCCAGATCACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATC  361

Query  400  TCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTC  458
            ||||||||||||||||||||||| ||| | ||||||  ||| ||||||| |||| |||||
Sbjct  362  TCCAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGTC  420

Query  459  GCCCAAGGTGTCGGACACCGTTGTGG  484
            ||||||||| |||||||| || ||||
Sbjct  421  GCCCAAGGTCTCGGACACGGTCGTGG  446


>gb|EU080511.1| Phytophthora sp. P1087 beta-tubulin gene, partial cds
Length=1134

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 366/438 (84%), Gaps = 2/438 (0%)
 Strand=Plus/Plus

Query  48   CTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTC  107
            ||||||||| |||   ||||||||||||||||||||||| ||||||||||| |||||  |
Sbjct  7    CTACCACGGCGACTCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAC  66

Query  108  CGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTC  167
             || |||   |||||||| |||||  ||||  | || |||||||||||||||||||||||
Sbjct  67   GGGCGGCCGCTACGTGCCGCGCGCCATCCTCATGGACCTGGAGCCCGGCACCATGGACTC  126

Query  168  TGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTC  227
             |||||  | || || | ||||||| ||||| | || ||||||||||||||||||||| |
Sbjct  127  GGTGCGCGCCGGCCCCTACGGCCAGCTCTTCCGCCCGGACAACTTTGTGTTCGGCCAGAC  186

Query  228  GGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTC  287
            ||| ||||| ||||||||||||||||| || ||||| || || ||||||||  | |||||
Sbjct  187  GGGCGCCGGTAACAACTGGGCCAAGGGACACTACACGGAAGGCGCTGAGCTCATCGACTC  246

Query  288  AGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACT  347
             ||||| || || |||||||||||||||||   ||||||||||||||| ||||||||  |
Sbjct  247  GGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGAT  306

Query  348  CACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGAT  407
            ||| ||||| || || ||||||||||||||||||||||| || || ||||| ||||||||
Sbjct  307  CACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATCTCCAAGAT  366

Query  408  CCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGG  466
            ||| ||||||||||| ||| | ||||||  ||| ||||||| |||| |||||||||||||
Sbjct  367  CCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGTCGCCCAAGG  425

Query  467  TGTCGGACACCGTTGTGG  484
            | |||||||| || ||||
Sbjct  426  TCTCGGACACGGTCGTGG  443


>gb|EU080005.1| Phytophthora macrochlamydospora isolate PD_00156(P10267) beta-tubulin 
gene, partial cds
Length=1140

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 371/446 (84%), Gaps = 2/446 (0%)
 Strand=Plus/Plus

Query  40   ACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAAT  99
            || |||  ||||||||| |||   ||||||||||||||||||||||| ||||||||||| 
Sbjct  1    ACGGGCAGCTACCACGGCGACTCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAAC  60

Query  100  GAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACC  159
            |||||  | || |||   |||||||| |||||  ||||  | || |||||||||||||||
Sbjct  61   GAGGCCACGGGCGGCCGCTACGTGCCGCGCGCCATCCTCATGGACCTGGAGCCCGGCACC  120

Query  160  ATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTC  219
            |||||||| |||||  | || || | ||||||| ||||| | || |||||||||||||||
Sbjct  121  ATGGACTCGGTGCGCGCCGGYCCCTACGGCCAGCTCTTCCGCCCGGACAACTTTGTGTTC  180

Query  220  GGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTG  279
            |||||| |||| ||||| ||||||||||||||||| || ||||| || || || ||||| 
Sbjct  181  GGCCAGACGGGCGCCGGTAACAACTGGGCCAAGGGACACTACACGGAAGGCGCCGAGCTC  240

Query  280  GTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGC  339
             | ||||| ||||| || || |||||||||||||||||   ||||||||||||||| |||
Sbjct  241  ATCGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGC  300

Query  340  TTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATT  399
            |||||  |||| ||||| || || ||||||||||||||||||||||| || || ||||| 
Sbjct  301  TTCCAGATCACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATC  360

Query  400  TCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTC  458
            ||||||||||||||||||||||| ||| | ||||||  ||| ||||||| |||| |||||
Sbjct  361  TCCAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGTC  419

Query  459  GCCCAAGGTGTCGGACACCGTTGTGG  484
            ||||||||| |||||||| || ||||
Sbjct  420  GCCCAAGGTCTCGGACACGGTCGTGG  445


>gb|EU079999.1| Phytophthora macrochlamydospora isolate PD_00155(P10266) beta-tubulin 
gene, partial cds
Length=1137

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 366/438 (84%), Gaps = 2/438 (0%)
 Strand=Plus/Plus

Query  48   CTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTC  107
            ||||||||| |||   ||||||||||||||||||||||| ||||||||||| |||||  |
Sbjct  6    CTACCACGGCGACTCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAC  65

Query  108  CGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTC  167
             || |||   |||||||| |||||  ||||  | || |||||||||||||||||||||||
Sbjct  66   GGGCGGCCGCTACGTGCCGCGCGCCATCCTCATGGACCTGGAGCCCGGCACCATGGACTC  125

Query  168  TGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTC  227
             |||||  | || || | ||||||| ||||| | || ||||||||||||||||||||| |
Sbjct  126  GGTGCGCGCCGGYCCCTACGGCCAGCTCTTCCGCCCGGACAACTTTGTGTTCGGCCAGAC  185

Query  228  GGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTC  287
            ||| ||||| ||||||||||||||||| || ||||| || || || |||||  | |||||
Sbjct  186  GGGCGCCGGTAACAACTGGGCCAAGGGACACTACACGGAAGGCGCCGAGCTCATCGACTC  245

Query  288  AGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACT  347
             ||||| || || |||||||||||||||||   ||||||||||||||| ||||||||  |
Sbjct  246  GGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGAT  305

Query  348  CACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGAT  407
            ||| ||||| || || ||||||||||||||||||||||| || || ||||| ||||||||
Sbjct  306  CACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATCTCCAAGAT  365

Query  408  CCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGG  466
            ||||||||||||||| ||| | ||||||  ||| ||||||| |||| |||||||||||||
Sbjct  366  CCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGTCGCCCAAGG  424

Query  467  TGTCGGACACCGTTGTGG  484
            | |||||||| || ||||
Sbjct  425  TCTCGGACACGGTCGTGG  442


>gb|EU079907.1| Phytophthora colocasiae isolate PD_00139(P6317) beta-tubulin 
gene, partial cds
Length=1169

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/481 (82%), Gaps = 2/481 (0%)
 Strand=Plus/Plus

Query  5    GGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCG  64
            ||||| | |||||||| ||||| ||| | ||  | || ||| | |||||||| |||   |
Sbjct  1    GGGAGGTGATCTCCGACGAGCACGGCGTGGACCCGACGGGCTCGTACCACGGCGACTCGG  60

Query  65   ACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGC  124
            |||||||||||||||||||||||||||||||||| |||||  | || |||   |||||||
Sbjct  61   ACCTGCAGCTGGAGCGCATCAATGTGTACTACAACGAGGCTACGGGCGGCCGTTACGTGC  120

Query  125  CCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTT  184
            |||||||  ||||  | ||||||||||||||||| |||||||| || ||  |||| ||||
Sbjct  121  CCCGCGCCATCCTCATGGATCTGGAGCCCGGCACAATGGACTCGGTCCGTGCGGGCCCTT  180

Query  185  TCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACT  244
             ||| ||| ||||| | || |||||||| |||||||||||  | || || || |||||||
Sbjct  181  ACGGTCAGCTCTTCCGTCCGGACAACTTCGTGTTCGGCCAAACAGGCGCTGGTAACAACT  240

Query  245  GGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCC  304
            |||||||||| || ||||||||||||||||||||| | ||||| ||||| ||||| ||||
Sbjct  241  GGGCCAAGGGACACTACACAGAGGGTGCTGAGCTGATCGACTCGGTGCTTGATGTCGTCC  300

Query  305  GCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCG  364
            | |||||||| ||   ||| ||||||||||| || |||||  |||| ||||| ||||| |
Sbjct  301  GTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTG  360

Query  365  GCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCG  424
            |||| || || ||||||||||| || || || || || ||||| || |||||||||||||
Sbjct  361  GCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCG  420

Query  425  ACAGGATCATGAACACATACTCGGTTGTG-CCGTCGCCCAAGGTGTCGGACACCGTTGTG  483
            || | ||||||  ||| ||||||| |||| |||||||| |||||||||||||| || |||
Sbjct  421  ACCGTATCATGTGCACGTACTCGG-TGTGCCCGTCGCCTAAGGTGTCGGACACTGTCGTG  479

Query  484  G  484
            |
Sbjct  480  G  480


>ref|XM_001627986.1| Nematostella vectensis predicted protein (NEMVEDRAFT_v1g230370) 
partial mRNA
Length=750

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||||||||||||| || |||||  | || ||| | |||||||| || 
Sbjct  58   TTTTGGGAGGTGATCTCCGATGAGCACGGAATCGACCCTACTGGCACATACCACGGCGAT  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||| ||  | || || || |||||||| |||||  |||| || || || 
Sbjct  118  TCCGACCTCCAGCTCGAAAGAATTAACGTTTACTACAACGAGGCAACCGGCGGGAAATAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| || ||||| |||||| ||||||| || |||||||| || || ||||| |||
Sbjct  178  GTTCCCCGTGCCGTCCTCGTCGATTTGGAGCCAGGAACCATGGATTCCGTTCGATCTGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||| ||||||||||| || || ||||| || |||||||||   || || || |||
Sbjct  238  CCTTTCGGACAGATCTTCAGACCAGATAACTTCGTTTTCGGCCAGAGTGGCGCTGGAAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || |||||||| || || ||  |||| |||||||| |||||||||
Sbjct  298  AACTGGGCAAAGGGCCACTACACAGAAGGAGCCGAATTGGTCGACTCAGTTCTCGATGTT  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||| || ||||||  |||||| || || ||||||||||| |||||||||||||| 
Sbjct  358  GTGCGCAAAGAAGCCGAAAGCTGCGATTGTCTACAAGGCTTCCAGCTCACACACTCCCTC  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| |||||||| ||||||||||| || || ||||| ||| | || ||||||
Sbjct  418  GGAGGCGGCACAGGCTCCGGCATGGGAACCCTTCTCATCTCCAAAATCAGAGAAGAGTAC  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||| ||||||||||||| |   |||||||||||||| ||||| || |||||||| 
Sbjct  478  CCCGACAGAATCATGAACACATTCAGCGTTGTGCCGTCGCCGAAGGTTTCTGACACCGTG  537

Query  481  GTGG  484
            ||||
Sbjct  538  GTGG  541


>gb|DQ450531.1| Bodo saltans alpha tubulin and beta tubulin genes, partial cds
Length=1362

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1     TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
             ||||||||| |||||||||| ||||| ||| ||||  |||||||| | ||||| || |||
Sbjct  732   TTCTGGGAGGTCATCTCCGACGAGCACGGCGTCGACCCCACCGGCACGTACCAGGGCGAC  791

Query  61    AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                ||||||||  | ||||||||||| ||||||| ||| |||||  |||| |||   |||
Sbjct  792   TCGGACCTGCAATTAGAGCGCATCAACGTGTACTTCAACGAGGCCACCGGCGGCCGCTAC  851

Query  121   GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
             || ||||| || || ||  | ||||| |||||||||||||||||||| || ||  | || 
Sbjct  852   GTCCCCCGTGCGGTGCTGATGGATCTTGAGCCCGGCACCATGGACTCCGTCCGCGCTGGT  911

Query  181   CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
             || |  |||||||||||| | ||||||||||| |||||||||||||| || || || |||
Sbjct  912   CCCTATGGCCAGATCTTCCGTCCCGACAACTTCGTGTTCGGCCAGTCTGGCGCTGGTAAC  971

Query  241   AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
             ||||||||||||||||| ||||| |||||||| |||||  | ||||| || ||||| || 
Sbjct  972   AACTGGGCCAAGGGTCACTACACCGAGGGTGCGGAGCTCATTGACTCCGTCCTCGACGTG  1031

Query  301   GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
               |||||||||||| ||   |||||||||||| |||||||||||  || | |||||||| 
Sbjct  1032  TGCCGCAAGGAGGCTGAGAGCTGCGACTGCCTCCAAGGCTTCCAGATCTCCCACTCCCTC  1091

Query  361   GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
             || || ||||| |||||||||||||||||||||||||| |||||| | ||||||||||||
Sbjct  1092  GGTGGTGGCACGGGCTCCGGTATGGGAACCCTGCTGATCTCCAAGCTGCGCGAGGAGTAC  1151

Query  421   CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
             |||||| | |||||||  || | |||  |  | || || ||||||||||| |||||||| 
Sbjct  1152  CCCGACCGAATCATGATGACCTTCTCCATCATTCCCTCCCCCAAGGTGTCCGACACCGTC  1211

Query  481   GTGG  484
             ||||
Sbjct  1212  GTGG  1215


>gb|AF064849.1| Homo sapiens map 4q35 repeat region, complete sequence
Length=570

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 385/469 (83%), Gaps = 3/469 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||  ||||||||| ||||||||  |||| ||| |||||||||| |||
Sbjct  105  TTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGAC  164

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            ||||||||||||||||| |||||||| |||||||||||||||||  |||| |||||||||
Sbjct  165  AGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTAC  224

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||||||||| || || || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct  225  GTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGG  284

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| |||| |||||||| || ||||| |||   ||||| || |||
Sbjct  285  CCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAAC  344

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || |||||||| || || |||||||||||||| ||||| ||||||
Sbjct  345  AACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTT  404

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| ||||| ||||| || ||||| || || |||||||| 
Sbjct  405  GTGAGAAAGGAGGCTGAGAGCTGTGACTGNCTGCAGGGTTTCCAGCTGAC-CACTCCCTG  463

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| ||  | ||||| ||||| || ||   ||||||||| |||||||| 
Sbjct  464  GGTGGGGGGACTGGGTCTNGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTA-  522

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGT  469
            || |||||||||||| |||| |     || ||| | |||||||| ||||
Sbjct  523  CCAGACAGGATCATG-ACACGTTTAGTGTGGTGGCTTCGCCCAANGTGT  570


>ref|NM_001003900.1| Bos taurus tubulin, beta 2A class IIa (TUBB2A), mRNA
 gb|AY675081.1| Bos taurus beta tubulin mRNA, complete cds
Length=1642

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 392/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||  |||||   |||||||||||||||||  |||| |||   |||||||| |||
Sbjct  164  TTTTGGGAAGTCATCAGTGATGAGCATGGCATCGACCCCACTGGCAGTTACCACGGAGAC  223

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | |||||||||||||||||||||||  |||||  |||||| 
Sbjct  224  AGTGACTTGCAGCTGGAGAGAATCAATGTGTACTACAATGAGGCCACCGGTAACAAGTAT  283

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || || |||||||| |||||||||||||| ||  | || |||
Sbjct  284  GTGCCTCGGGCCATCCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCAGGTCTGGA  343

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || |||||||||||||||||||| |||||||| ||||| ||||||   |||||||| |||
Sbjct  344  CCCTTCGGCCAGATCTTCAGGCCTGACAACTTCGTGTTTGGCCAGAGTGGTGCCGGGAAC  403

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||||| || || || || 
Sbjct  404  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  463

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| ||||   ||| ||||| ||||| |||||||| || || || || || 
Sbjct  464  GTCAGGAAGGAGTCCGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCATTCGCTG  523

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| ||||| || |||   ||||||||||||||||||
Sbjct  524  GGGGGCGGCACGGGGTCTGGGATGGGGACCCTTCTCATTAGTAAGATCCGCGAGGAGTAC  583

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| |     ||  |||| |||||||||||||| ||||| || 
Sbjct  584  CCCGACCGCATCATGAACACCTTTAGCGTCATGCCCTCGCCCAAGGTGTCCGACACGGTG  643

Query  481  GTGG  484
            ||||
Sbjct  644  GTGG  647


>emb|X15389.1| Paracentrotus lividus mRNA for beta-tubulin
Length=1826

 Score =  459 bits (508),  Expect = 9e-126
 Identities = 391/482 (82%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||  ||||||| || |||||||| |||||  |||||||  ||||||| || |||
Sbjct  124  TTCTGGGAAGTCATCTCTGACGAGCATGGAATCGACCCCACCGGTACCTACCATGGAGAC  183

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               || || ||||| ||| | ||||| || ||||||||||||||  | || ||||| || 
Sbjct  184  TCTGATCTTCAGCTTGAGAGGATCAACGTCTACTACAATGAGGCTACTGGAGGCAAATAT  243

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || || ||||| |||||| ||||||| || |||||||||||||| ||||| |||
Sbjct  244  GTGCCACGTGCCGTCCTCGTCGATTTGGAGCCAGGTACCATGGACTCTGTCCGATCCGGA  303

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||||| || ||||||||||| || || |||   || || || |||
Sbjct  304  CCATTCGGACAGATCTTCAGACCAGACAACTTTGTTTTTGGACAGAGTGGAGCTGGAAAC  363

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| ||||||||||| || |||||||| || ||||| || |||||||||
Sbjct  364  AACTGGGCCAAGGGACATTACACAGAAGGAGCTGAGCTTGTAGACTCTGTTCTCGATGTT  423

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||||||||| |||||   ||| ||||| || || |||||||| || ||||||||||||
Sbjct  424  GTCCGCAAGGAAGCCGAGAGCTGTGACTGTCTTCAGGGCTTCCAGCTTACACACTCCCTT  483

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || || ||||||||||||||||| || ||   ||||||||| || ||||| 
Sbjct  484  GGTGGTGGTACCGGTTCCGGTATGGGAACCCTTCTCATCAGCAAGATCCGTGAAGAGTAT  543

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||||| ||||||||||||| |   |||||||| || ||||| || || ||||| |||
Sbjct  544  CCAGACAGAATCATGAACACATTCAGCGTTGTGCCATCACCCAAAGTATCAGACACTGTT  603

Query  481  GT  482
            ||
Sbjct  604  GT  605


>gb|JF410995.1| Pristigloma alba beta tubulin (BTUB) gene, partial cds
Length=921

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 383/470 (82%), Gaps = 0/470 (0%)
 Strand=Plus/Plus

Query  15   CTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGCT  74
            |||||| ||||| ||  | ||  |||||||| |||||||||| |||  ||| ||||||||
Sbjct  3    CTCCGACGAGCACGGTGTGGACCCCACCGGCACCTACCACGGAGACTCCGATCTGCAGCT  62

Query  75   GGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGT  134
            |||| | ||||||||||||||||| || ||  |||||||    ||||||||||||||  |
Sbjct  63   GGAGAGAATCAATGTGTACTACAACGAAGCCACCGGTGGTCGCTACGTGCCCCGCGCCAT  122

Query  135  CCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGAT  194
            |||  | ||| ||||||||||||||||||||||||||||  | || |||||||||||| |
Sbjct  123  CCTCATGGATTTGGAGCCCGGCACCATGGACTCTGTGCGCGCCGGTCCTTTCGGCCAGCT  182

Query  195  CTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGG  254
            |||||| ||||| |||||||||||||||||||| || ||||||||||| |||||||||||
Sbjct  183  CTTCAGACCCGATAACTTTGTGTTCGGCCAGTCCGGAGCCGGCAACAATTGGGCCAAGGG  242

Query  255  TCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGC  314
             || ||||| ||||| || |||||| | ||||| || || ||||| ||||||||||| ||
Sbjct  243  ACACTACACCGAGGGAGCCGAGCTGATCGACTCTGTCCTGGATGTGGTCCGCAAGGAAGC  302

Query  315  CGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGG  374
            ||| ||||  |||||||| || || |||||  | || |||||  | || || || |||||
Sbjct  303  CGAGTCCTCTGACTGCCTTCAGGGATTCCAGTTTACCCACTCGTTGGGTGGTGGTACTGG  362

Query  375  CTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCAT  434
             || |||||||| ||||| ||||| ||||||||||||||||| || |||||||| |||||
Sbjct  363  GTCTGGTATGGGTACCCTTCTGATCTCCAAGATCCGCGAGGAATATCCCGACAGAATCAT  422

Query  435  GAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGTGG  484
            |   || | ||| ||  | || || ||||||||||| |||||||| ||||
Sbjct  423  GTCTACCTTCTCCGTCATCCCTTCCCCCAAGGTGTCTGACACCGTCGTGG  472


>ref|XM_003224397.1| PREDICTED: Anolis carolinensis tubulin beta-2 chain-like (LOC100558555), 
mRNA
Length=1338

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 390/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||  ||||||||| ||||| ||  ||||||||  ||||||||| |||
Sbjct  58   TTCTGGGAGGTCATCAGCGATGAGCACGGCATTGACCCCACCGGCAGCTACCACGGAGAC  117

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||||||| ||||| | ||||| || ||||||||||| ||  | |||  |||||| 
Sbjct  118  AGCGACCTGCAGTTGGAGAGGATCAACGTCTACTACAATGAAGCAACTGGTAACAAGTAT  177

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||| ||  ||||||||||  ||||||| ||||| |||||||| ||| | || |||
Sbjct  178  GTTCCCCGTGCCATCCTTGTCGACTTGGAGCCTGGCACAATGGACTCGGTGAGGTCTGGA  237

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||||||||||||||||  |||| ||||| ||||| || |||||    ||||| || |||
Sbjct  238  CCTTTCGGCCAGATCTTTCGGCCTGACAATTTTGTCTTTGGCCAAAGTGGTGCTGGGAAC  297

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||| || || |||||||||||||| ||  |||||||||| ||||| ||||| 
Sbjct  298  AACTGGGCCAAAGGCCACTACACAGAGGGTGCCGAATTGGTGGACTCTGTGCTGGATGTG  357

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| ||||   |||||||||||| || |||||||| ||||| || || || 
Sbjct  358  GTCAGGAAGGAGTCCGAGAGCTGCGACTGCCTTCAGGGCTTCCAGCTCACCCATTCGCTG  417

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||| ||||| || ||||| ||||| || ||   ||||||| | |||||||| 
Sbjct  418  GGCGGTGGCACCGGCTCTGGGATGGGCACCCTCCTCATCAGCAAGATCAGGGAGGAGTAT  477

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||||||||||||||||| | |   ||  |||| || ||||||||||||||||| || 
Sbjct  478  CCCGACAGGATCATGAACACCTTCAGCGTAATGCCCTCACCCAAGGTGTCGGACACAGTG  537

Query  481  GT  482
            ||
Sbjct  538  GT  539


>gb|HM245045.1| Alveolata sp. CCMP3155 tubulin beta chain mRNA, partial cds
Length=1256

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 390/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||||||| ||||||||||||||  | || ||  | ||||||||||||
Sbjct  31   TTCTGGGAGGTGATCTCCGACGAGCATGGCATCGACCCGACGGGGACGTACCACGGTGAC  90

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            |||||||| ||||||||||||||||| || | |||||| |||||| | || |||   || 
Sbjct  91   AGCGACCTCCAGCTGGAGCGCATCAACGTCTTCTACAACGAGGCGACTGGCGGCCGCTAT  150

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| || |||||  | || |||||||||||||||||||||   || ||  | |||
Sbjct  151  GTGCCCCGTGCCGTCCTCATGGACCTGGAGCCCGGCACCATGGACAGCGTCCGCGCAGGA  210

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||| ||||||| ||||||||||| || ||||| ||| | ||||| ||||||
Sbjct  211  CCCTTCGGCCAGCTCTTCAGACCCGACAACTTCGTCTTCGGTCAGACCGGTGCGGGCAAC  270

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||  | ||||| || || || || 
Sbjct  271  AACTGGGCCAAGGGCCACTACACCGAGGGCGCCGAGCTCATCGACTCGGTCCTGGACGTG  330

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || ||||||||||||||   ||||||||||||||| || |||||  |||||||||| || 
Sbjct  331  GTGCGCAAGGAGGCCGAGGGCTGCGACTGCCTGCAGGGGTTCCAGATCACACACTCGCTC  390

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || ||||||||||||  ||||||||| ||||| || || ||||||||| | |||||||||
Sbjct  391  GGTGGCGGCACTGGCAGCGGTATGGGCACCCTCCTCATCTCCAAGATCAGAGAGGAGTAC  450

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||  | |||||| | || | ||| ||  | || || || |||||||| || ||||||
Sbjct  451  CCCGATCGTATCATGGAAACCTTCTCCGTCTTCCCATCACCAAAGGTGTCTGATACCGTT  510

Query  481  GT  482
            ||
Sbjct  511  GT  512


>gb|FJ973416.1| Ankylochrysis lutea strain RCC 286 beta-tubulin (btub) gene, 
partial cds
Length=1206

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 390/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| | |||||||| ||||| ||| ||||  | || ||| |||||||||| |||
Sbjct  37   TTCTGGGAGGTGATCTCCGACGAGCACGGCGTCGACCCGACGGGCACCTACCACGGGGAC  96

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||| ||||| ||||| |||||||| |||||||| |||||  | || |||   |||
Sbjct  97   TCTGACCTCCAGCTCGAGCGGATCAATGTCTACTACAACGAGGCCACGGGCGGCCGCTAC  156

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| |||||  ||||  | || || |||||||||||||||||||| || ||  | || 
Sbjct  157  GTGCCGCGCGCCATCCTGATGGACCTCGAGCCCGGCACCATGGACTCCGTCCGCGCCGGG  216

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||| ||||| | || |||||||| || ||||||||| | || || ||||||
Sbjct  217  CCCTTCGGCCAGCTCTTCCGCCCGGACAACTTCGTCTTCGGCCAGACTGGCGCGGGCAAC  276

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || |||||  | ||||| ||||| || || 
Sbjct  277  AACTGGGCCAAGGGCCACTACACCGAGGGCGCCGAGCTCATCGACTCCGTGCTGGACGTG  336

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||| ||||||||||| |||||||||||||| || |||||||| || || |||||| | 
Sbjct  337  GTCCGAAAGGAGGCCGAGTCCTGCGACTGCCTCCAGGGCTTCCAGCTGACGCACTCCATG  396

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||||||||| ||| |||| ||||| |||||||| || |||||||||||||||||||||
Sbjct  397  GGCGGCGGCACGGGCGCCGGCATGGGCACCCTGCTCATCTCCAAGATCCGCGAGGAGTAC  456

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| |  | |||  ||| ||||||||  | |||||||||||||| || |||||||| 
Sbjct  457  CCGGACCGCGTAATGTCCACCTACTCGGTCATCCCGTCGCCCAAGGTCTCCGACACCGTC  516

Query  481  GT  482
            ||
Sbjct  517  GT  518


>gb|EF432455.1| Rhodomonas salina clone D1 beta tubulin (btub) mRNA, partial 
cds
Length=801

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 390/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| |||||||||| ||||| ||  | ||| |||||||  | |||||||| |||
Sbjct  34   TTCTGGGAGGTCATCTCCGACGAGCACGGTGTTGATCCCACCGGTACTTACCACGGAGAC  93

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
              |||||| ||||| ||||||||||| |||||||||||||||||| | || ||    || 
Sbjct  94   TCCGACCTTCAGCTTGAGCGCATCAACGTGTACTACAATGAGGCGACTGGCGGACGCTAT  153

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            || ||||||||||| ||  | ||| ||||||| || ||||||||||| || ||  | |||
Sbjct  154  GTTCCCCGCGCTGTGCTCATGGATTTGGAGCCTGGAACCATGGACTCCGTTCGCGCTGGA  213

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            |||| ||||||||||||| | || ||||||||||||||||| ||| | ||||||||||||
Sbjct  214  CCTTACGGCCAGATCTTCCGCCCGGACAACTTTGTGTTCGGACAGACCGGTGCCGGCAAC  273

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| |||||||| ||||| || ||  || | || || ||  | ||||||
Sbjct  274  AACTGGGCCAAGGGACATTACACGGAGGGCGCGGAATTGATTGATTCGGTTTTGGATGTT  333

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            || |||||||||||||| || ||||| ||||| ||||| |||||  || | ||||| || 
Sbjct  334  GTGCGCAAGGAGGCCGAGTCTTGCGATTGCCTTCAAGGATTCCAGATCTCTCACTCGCTC  393

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            ||||| ||||||||| | || |||||||| ||  |||| ||||||||||| |||||||| 
Sbjct  394  GGCGGTGGCACTGGCGCTGGCATGGGAACGCTCTTGATCTCCAAGATCCGTGAGGAGTAT  453

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||   || | |||  |||||||||||||||||||||| ||||| || 
Sbjct  454  CCTGACCGTATCATGCTTACCTTCTCCATTGTGCCGTCGCCCAAGGTGTCCGACACTGTC  513

Query  481  GT  482
            ||
Sbjct  514  GT  515


>gb|EU080326.1| Phytophthora pistaciae isolate PD_01119(P6197) beta-tubulin gene, 
partial cds
Length=1196

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 384/472 (82%), Gaps = 0/472 (0%)
 Strand=Plus/Plus

Query  11   TCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGC  70
            |||||||||| ||||| ||| | ||  |||| ||  |||||||||| |||   |||||||
Sbjct  2    TCATCTCCGACGAGCACGGCGTGGACCCCACGGGATCCTACCACGGCGACTCGGACCTGC  61

Query  71   AGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCG  130
            |||||||||||||||| ||||||||||| |||||  | || |||   |||||||||||||
Sbjct  62   AGCTGGAGCGCATCAACGTGTACTACAACGAGGCCACGGGCGGCCGCTACGTGCCCCGCG  121

Query  131  CTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCC  190
            |  ||||  | || ||||||||||||||||||||||| |||||  | || || | |||||
Sbjct  122  CCATCCTCATGGACCTGGAGCCCGGCACCATGGACTCGGTGCGCGCCGGCCCCTACGGCC  181

Query  191  AGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCA  250
            || ||||| | || |||||||| |||||||||||| |||| ||||| |||||||||||||
Sbjct  182  AGCTCTTCCGCCCGGACAACTTCGTGTTCGGCCAGACGGGCGCCGGTAACAACTGGGCCA  241

Query  251  AGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGG  310
            |||| || ||||| ||||||||||||||  | ||||| ||||| || |||||||||||||
Sbjct  242  AGGGACACTACACGGAGGGTGCTGAGCTCATCGACTCGGTGCTTGACGTTGTCCGCAAGG  301

Query  311  AGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCA  370
            |||| ||   ||| |||||||| || || |||||  |||| ||||| || || ||||| |
Sbjct  302  AGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTA  361

Query  371  CTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGA  430
            | || ||||||||||| || || || || |||||||| |||||||||||||| ||| | |
Sbjct  362  CCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGCGAGGAGTACCCGGACCGTA  421

Query  431  TCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGT  482
            |||||  ||| ||||||||    |||||||| |||||||||||||| || ||
Sbjct  422  TCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGT  473


>gb|EU079521.1| Phytophthora sp. P10335 beta-tubulin gene, partial cds
Length=1140

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 369/446 (83%), Gaps = 2/446 (0%)
 Strand=Plus/Plus

Query  40   ACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAAT  99
            || |||  ||||||||| |||   ||||||||||||||||||||||| ||||||||||| 
Sbjct  1    ACGGGCAGCTACCACGGCGACTCGGACCTGCAGCTGGAGCGCATCAACGTGTACTACAAC  60

Query  100  GAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACC  159
            |||||  | || |||   |||||||| |||||  ||||  | || |||||||||||||||
Sbjct  61   GAGGCCACGGGCGGCCGCTACGTGCCGCGCGCCATCCTCATGGACCTGGAGCCCGGCACC  120

Query  160  ATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTC  219
            |||||||| |||||  | || || | ||||||| ||||| | || |||||||||||||||
Sbjct  121  ATGGACTCGGTGCGCGCCGGYCCCTACGGCCAGCTCTTCCGCCCGGACAACTTTGTGTTC  180

Query  220  GGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTG  279
            |||||| |||| ||||| ||||||||||||||||| || ||||| || || || ||||| 
Sbjct  181  GGCCAGACGGGCGCCGGTAACAACTGGGCCAAGGGACACTACACGGAAGGCGCYGAGCTC  240

Query  280  GTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGC  339
             | ||||| ||||| || || |||||||||||||||||   ||||||||||||||| |||
Sbjct  241  ATCGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGC  300

Query  340  TTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATT  399
            |||||  |||| ||||| || || ||||||||||||||||||||||| || || ||||| 
Sbjct  301  TTCCAGATCACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATC  360

Query  400  TCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTCGGTTGTG-CCGTC  458
            ||||||||||| ||||||||||| ||| | ||||||  ||| ||||||| |||| |||||
Sbjct  361  TCCAAGATCCGYGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGG-TGTGCCCGTC  419

Query  459  GCCCAAGGTGTCGGACACCGTTGTGG  484
            ||| ||||| |||||||| || ||||
Sbjct  420  GCCYAAGGTCTCGGACACGGTCGTGG  445


>dbj|AB194979.1| Chrysochromulina sp. TKB79 btub gene for putative beta tubulin, 
partial cds
Length=1135

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 390/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||   ||| ||||||||||||||  | |||||| |||||||||| |||
Sbjct  6    TTCTGGGAGGTCATGAGCGACGAGCATGGCATCGACCCGACCGGCACCTACCACGGCGAC  65

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||||| ||||| ||||||||||| ||||||||||| |||||| |||| |||   |||
Sbjct  66   TCGGACCTCCAGCTCGAGCGCATCAACGTGTACTACAACGAGGCGACCGGCGGCCGCTAC  125

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||||    ||||  | || || ||||| |||||||||||||| || || ||||| 
Sbjct  126  GTGCCCCGCAACATCCTGATGGACCTCGAGCCGGGCACCATGGACTCGGTCCGTTCGGGC  185

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||| | || |||||||| || |||||||||||||| |||||||||
Sbjct  186  CCCTTCGGCCAGATCTTCCGCCCGGACAACTTCGTCTTCGGCCAGTCGGGCGCCGGCAAC  245

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||| ||||| || || ||  | ||  | || || || || 
Sbjct  246  AACTGGGCCAAGGGCCACTACACCGAGGGCGCCGAACTCATCGATGCCGTCCTTGACGTC  305

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            |||||||||||||||||   |||||||||||| || || |||    | || || || || 
Sbjct  306  GTCCGCAAGGAGGCCGAGGGCTGCGACTGCCTCCAGGGATTCACCATGACCCATTCGCTC  365

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| |||||||| ||||| || || ||||| |||||||||||||||||||||
Sbjct  366  GGTGGCGGCACCGGCTCCGGCATGGGCACGCTCCTGATCTCCAAGATCCGCGAGGAGTAC  425

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| |  |||||  | | ||||||||  | |||||||||||||||||||||||||| 
Sbjct  426  CCCGACCGCGTCATGTGCTCCTACTCGGTCTTCCCGTCGCCCAAGGTGTCGGACACCGTC  485

Query  481  GT  482
            ||
Sbjct  486  GT  487


>dbj|AK109162.1| Oryza sativa Japonica Group cDNA clone:002-155-G09, full insert 
sequence
Length=1944

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 390/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            ||||||||| ||||||| || ||||| || |||||  | || ||| |||||||||| |||
Sbjct  163  TTCTGGGAGGTCATCTCGGACGAGCACGGTATCGACCCGACTGGCACCTACCACGGCGAC  222

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
               ||| ||||| ||||||||||||| ||||||| ||| |||||| |||||||||| || 
Sbjct  223  TCGGACTTGCAGTTGGAGCGCATCAACGTGTACTTCAACGAGGCGACCGGTGGCAAATAT  282

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| ||||| ||| | |||||| ||||||| || ||||||||||| || || ||||| 
Sbjct  283  GTGCCACGCGCCGTCTTGGTCGATTTGGAGCCGGGTACCATGGACTCCGTTCGTTCGGGC  342

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||| ||||||||| | || |||||||| || ||||| || || || || || |||
Sbjct  343  CCGTTCGGTCAGATCTTCCGCCCGGACAACTTCGTTTTCGGTCAATCAGGCGCTGGAAAC  402

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||| ||||| || ||||| |||||||||||| |||| ||||| || ||||| || 
Sbjct  403  AACTGGGCTAAGGGACACTACACTGAGGGTGCTGAGTTGGTCGACTCTGTCCTCGACGTC  462

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||||| ||||||||||| || ||||| ||| ||||||| || ||| | || |||||  | 
Sbjct  463  GTCCGAAAGGAGGCCGAGTCTTGCGATTGCTTGCAAGGATTTCAATTGACCCACTCGTTG  522

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || ||||| || |||||||| ||| || |||| || ||||||||||||||||||
Sbjct  523  GGAGGTGGTACTGGTTCAGGTATGGGCACCTTGTTGATCTCGAAGATCCGCGAGGAGTAC  582

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||||| |||||| || || ||||| || || || || ||||| 
Sbjct  583  CCAGACCGTATCATGAACACATTCTCGGTCGTCCCATCGCCGAAAGTCTCCGATACCGTC  642

Query  481  GT  482
            ||
Sbjct  643  GT  644


>gb|AF255554.1|AF255554 Notothenia coriiceps isolate ncb3 beta tubulin mRNA, complete 
cds
Length=1528

 Score =  455 bits (504),  Expect = 1e-124
 Identities = 390/482 (81%), Gaps = 0/482 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||| | |||   ||||| || || || ||  | || ||  | ||||||||||||
Sbjct  96   TTTTGGGAGGTGATCAGTGATGAACACGGTATTGACCCAACTGGTACATACCACGGTGAC  155

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||||||||||||||  | |||||||| |||||||||||||| || ||||| || || 
Sbjct  156  AGTGACCTGCAGCTGGACAGGATCAATGTCTACTACAATGAGGCCTCGGGTGGTAAATAT  215

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            |||||||| ||||| || || ||||| ||||| |||||||||||||| ||  | || |||
Sbjct  216  GTGCCCCGTGCTGTGCTGGTTGATCTTGAGCCAGGCACCATGGACTCAGTAAGGTCTGGA  275

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            ||||| |||||||||||||| || |||||||||||||| ||||||   ||||| ||||||
Sbjct  276  CCTTTTGGCCAGATCTTCAGACCAGACAACTTTGTGTTTGGCCAGAGTGGTGCTGGCAAC  335

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            ||||||||||| ||||| |||||||||||||| |||||||||||||| || || ||||| 
Sbjct  336  AACTGGGCCAAAGGTCACTACACAGAGGGTGCAGAGCTGGTGGACTCTGTCCTGGATGTG  395

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||  | |||||||| ||   ||| |||||||| || |||||||| || ||||||||||| 
Sbjct  396  GTGAGGAAGGAGGCAGAGAGCTGTGACTGCCTTCAGGGCTTCCAGCTTACACACTCCCTG  455

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || || || || ||||| ||||||||||||||||| ||   ||||||||| || ||||||
Sbjct  456  GGTGGTGGTACGGGCTCTGGTATGGGAACCCTGCTTATCAGCAAGATCCGTGAAGAGTAC  515

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |   || ||||| || ||||| || || ||||| |||
Sbjct  516  CCTGACCGCATCATGAACACTTTCAGCGTGGTGCCTTCCCCCAAAGTATCAGACACTGTT  575

Query  481  GT  482
            ||
Sbjct  576  GT  577


>ref|XM_003583930.1| PREDICTED: Bos taurus tubulin, beta 2A class IIa-like, transcript 
variant 2 (LOC100295973), mRNA
Length=1659

 Score =  453 bits (502),  Expect = 4e-124
 Identities = 391/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||  |||||  ||||||||||||||||||  |||| |||   ||||| || |||
Sbjct  180  TTTTGGGAAGTCATCAGCGATGAGCATGGCATCGACCCCACTGGCAGTTACCATGGAGAC  239

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | ||||| ||||||||||| || ||  | |||  |||||| 
Sbjct  240  AGTGACTTGCAGCTGGAGAGAATCAACGTGTACTACAACGAAGCTGCTGGTAACAAGTAT  299

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || || |||||||| |||||||||||||| ||  | || |||
Sbjct  300  GTGCCTCGGGCCATCCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCAGGTCTGGA  359

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||| ||||| ||||||   |||||||| |||
Sbjct  360  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTCGTGTTTGGCCAGAGTGGTGCCGGGAAC  419

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||||| || || || || 
Sbjct  420  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  479

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| ||||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  480  GTCAGGAAGGAGTCCGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  539

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| ||||| || |||   ||||||||||||||||||
Sbjct  540  GGGGGCGGCACGGGGTCTGGGATGGGGACCCTTCTCATTAGTAAGATCCGCGAGGAGTAC  599

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| |||||||||||||| ||||| || 
Sbjct  600  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCCGACACGGTG  659

Query  481  GTGG  484
            ||||
Sbjct  660  GTGG  663


>ref|XM_002702957.2| PREDICTED: Bos taurus tubulin, beta 2A class IIa-like, transcript 
variant 1 (LOC100295973), mRNA
Length=1640

 Score =  453 bits (502),  Expect = 4e-124
 Identities = 391/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||  |||||  ||||||||||||||||||  |||| |||   ||||| || |||
Sbjct  161  TTTTGGGAAGTCATCAGCGATGAGCATGGCATCGACCCCACTGGCAGTTACCATGGAGAC  220

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | ||||| ||||||||||| || ||  | |||  |||||| 
Sbjct  221  AGTGACTTGCAGCTGGAGAGAATCAACGTGTACTACAACGAAGCTGCTGGTAACAAGTAT  280

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || || |||||||| |||||||||||||| ||  | || |||
Sbjct  281  GTGCCTCGGGCCATCCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCAGGTCTGGA  340

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||| ||||| ||||||   |||||||| |||
Sbjct  341  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTCGTGTTTGGCCAGAGTGGTGCCGGGAAC  400

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| || |||||||||||||| || || || || 
Sbjct  401  AACTGGGCCAAGGGCCACTACACAGAGGGCGCCGAGCTGGTGGACTCGGTCCTGGACGTG  460

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| ||||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  461  GTCAGGAAGGAGTCCGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  520

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| ||||| || |||   ||||||||||||||||||
Sbjct  521  GGGGGCGGCACGGGGTCTGGGATGGGGACCCTTCTCATTAGTAAGATCCGCGAGGAGTAC  580

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            |||||| | ||||||||||| | |   ||  |||| |||||||||||||| ||||| || 
Sbjct  581  CCCGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCCGACACGGTG  640

Query  481  GTGG  484
            ||||
Sbjct  641  GTGG  644


>ref|XM_002697606.1| PREDICTED: Bos taurus tubulin, beta 2-like (LOC100295973), mRNA
Length=1640

 Score =  453 bits (502),  Expect = 4e-124
 Identities = 391/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1    TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
            || |||||  |||||  ||||||||||||||||||  |||| |||   ||||| || |||
Sbjct  161  TTTTGGGAAGTCATCAGCGATGAGCATGGCATCGACCCCACTGGCAGTTACCATGGAGAC  220

Query  61   AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
            || ||| ||||||||||| | ||||| ||||||||||| || ||  | |||  |||||| 
Sbjct  221  AGTGACTTGCAGCTGGAGAGAATCAACGTGTACTACAACGAAGCTGCTGGTAACAAGTAT  280

Query  121  GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
            ||||| || ||  |||| || || |||||||| |||||||||||||| ||  | || |||
Sbjct  281  GTGCCTCGGGCCATCCTGGTGGACCTGGAGCCGGGCACCATGGACTCCGTCAGGTCTGGA  340

Query  181  CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
            || ||||||||||||||||||||||||||||| ||||| ||||||   |||||||| |||
Sbjct  341  CCCTTCGGCCAGATCTTCAGGCCCGACAACTTCGTGTTTGGCCAGAGTGGTGCCGGGAAC  400

Query  241  AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
            |||||||||||||| || ||||||||||| ||||||||||||||||| || || || || 
Sbjct  401  AACTGGGCCAAGGGCCACTACACAGAGGGCGCTGAGCTGGTGGACTCGGTCCTGGACGTG  460

Query  301  GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
            ||| | |||||| ||||   ||| ||||| ||||| |||||||| || || ||||| || 
Sbjct  461  GTCAGGAAGGAGTCCGAGAGCTGTGACTGTCTGCAGGGCTTCCAGCTGACCCACTCGCTG  520

Query  361  GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
            || |||||||| || || || ||||| ||||| || |||   ||||||||||||||||||
Sbjct  521  GGGGGCGGCACGGGGTCTGGGATGGGGACCCTTCTCATTAGTAAGATCCGCGAGGAGTAC  580

Query  421  CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
            || ||| | ||||||||||| | |   ||  |||| |||||||||||||| ||||| || 
Sbjct  581  CCTGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCCGACACGGTG  640

Query  481  GTGG  484
            ||||
Sbjct  641  GTGG  644


>gb|FJ168548.1| Bodo saltans clone fosmid 14L17, complete sequence
Length=38184

 Score =  453 bits (502),  Expect = 4e-124
 Identities = 391/484 (81%), Gaps = 0/484 (0%)
 Strand=Plus/Plus

Query  1      TTCTGGGAGATCATCTCCGATGAGCATGGCATCGATGCCACCGGCGCCTACCACGGTGAC  60
              ||||||||| |||||||||| ||||| ||| ||||  |||||||  ||||||| || || 
Sbjct  18349  TTCTGGGAGGTCATCTCCGACGAGCACGGCGTCGACCCCACCGGTACCTACCAGGGCGAT  18408

Query  61     AGCGACCTGCAGCTGGAGCGCATCAATGTGTACTACAATGAGGCGTCCGGTGGCAAGTAC  120
                 ||||||||| |||||||||| || ||||||| ||| |||||  |||| ||    |||
Sbjct  18409  TCGGACCTGCAGTTGGAGCGCATTAACGTGTACTTCAACGAGGCCACCGGCGGACGCTAC  18468

Query  121    GTGCCCCGCGCTGTCCTTGTCGATCTGGAGCCCGGCACCATGGACTCTGTGCGATCGGGA  180
              || |||||||| || ||  | ||  |||||||||||||||||||||| || ||  | |||
Sbjct  18469  GTCCCCCGCGCGGTGCTCATGGACTTGGAGCCCGGCACCATGGACTCCGTCCGCGCCGGA  18528

Query  181    CCTTTCGGCCAGATCTTCAGGCCCGACAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAAC  240
              || | ||||||||||||| | || |||||||| || ||||||||||| || || || |||
Sbjct  18529  CCCTACGGCCAGATCTTCCGCCCAGACAACTTCGTCTTCGGCCAGTCTGGCGCTGGTAAC  18588

Query  241    AACTGGGCCAAGGGTCATTACACAGAGGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTT  300
              |||||||||||||| || ||||| |||||||| |||||| | ||||| || ||||| || 
Sbjct  18589  AACTGGGCCAAGGGCCACTACACGGAGGGTGCGGAGCTGATTGACTCCGTCCTCGACGTG  18648

Query  301    GTCCGCAAGGAGGCCGAATCCTGCGACTGCCTGCAAGGCTTCCAACTCACACACTCCCTT  360
                |||||||||||| ||   ||||||||||||||| ||||||||  || | |||||||| 
Sbjct  18649  TGCCGCAAGGAGGCGGAGAGCTGCGACTGCCTGCAGGGCTTCCAGATCTCCCACTCCCTC  18708

Query  361    GGCGGCGGCACTGGCTCCGGTATGGGAACCCTGCTGATTTCCAAGATCCGCGAGGAGTAC  420
              || || ||||| |||||||||||||||||||||||||| |||||| | ||||||||||||
Sbjct  18709  GGTGGTGGCACGGGCTCCGGTATGGGAACCCTGCTGATCTCCAAGCTGCGCGAGGAGTAC  18768

Query  421    CCCGACAGGATCATGAACACATACTCGGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTT  480
              |||||| | |||||||  || | |||  |  | || || ||||||||||| |||||||| 
Sbjct  18769  CCCGACCGCATCATGATGACCTTCTCCATCATCCCCTCACCCAAGGTGTCCGACACCGTC  18828

Query  481    GTGG  484
              ||||
Sbjct  18829  GTGG  18832



Lambda     K      H
   0.634    0.408    0.912 

Gapped
Lambda     K      H
   0.625    0.410    0.780 

Effective search space used: 17306996295036


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Nov 30, 2011  4:13 AM
  Number of letters in database: 39,074,138,929
  Number of sequences in database:  15,099,719



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Query
>query
TTCTGGGAGATCATCTCCGATGAGCA
TGGCATCGATGCCACCGGCGCCTACCACGGTGACAGCGACCTGCAGCTGGAGCGCATCAA
TGTGTACTACAATGAGGCGTCCGGTGGCAAGTACGTGCCCCGCGCTGTCCTTGTCGATCT
GGAGCCCGGCACCATGGACTCTGTGCGATCGGGACCTTTCGGCCAGATCTTCAGGCCCGA
CAACTTTGTGTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCATTACACAGA
GGGTGCTGAGCTGGTGGACTCAGTGCTCGATGTTGTCCGCAAGGAGGCCGAATCCTGCGA
CTGCCTGCAAGGCTTCCAACTCACACACTCCCTTGGCGGCGGCACTGGCTCCGGTATGGG
AACCCTGCTGATTTCCAAGATCCGCGAGGAGTACCCCGACAGGATCATGAACACATACTC
GGTTGTGCCGTCGCCCAAGGTGTCGGACACCGTTGTGG
Documentation
About
API
API tutorial
Alternative representations
jsonJSON
txtTXT

Adhoc 12.7 SciLifeLab tools Per Kraulis (per.kraulis@scilifelab.se)